U.S. flag An official website of the United States government
  1. Home
  2. Food
  3. Science & Research (Food)
  4. Laboratory Methods (Food)
  5. BAM Chapter 29: Cronobacter
  1. Laboratory Methods (Food)

BAM Chapter 29: Cronobacter

Bacteriological Analytical Manual (BAM) Main Page

Authors: Yi Chen, Keith Lampel, and Thomas Hammack

Revision History:

  • March 2012: New Chapter (This chapter has replaced the method for Isolation and Enumeration of Enterobacter sakazakii from Dehydrated Powdered Infant Formula (available as archived content)).
  • April 2012: Sections D.1.a, D.1.b, D.2.3; Correction: The fluorescence is recorded at the end of each annealing step, not at the end of each extension step.


Cronobacter is a Gram-negative rod within the family Enterobacteriaceae (7). The organism was called "yellow-pigmented Enterobacter cloacae" until it was renamed Enterobacter sakazakii (6) in 1980. Urmenyi and Franklin reported the first two known cases of meningitis caused by E. sakazakii in 1961 (11). Subsequently, cases of meningitis, septicemia, and necrotizing enterocolitis due to E. sakazakii have been reported worldwide (9). Although most documented cases involve infants, reports describe infections in adults as well. Overall, case-fatality rates vary considerably with some as high as 80 percent (8). While a reservoir for E. sakazakii is unknown, a growing number of reports suggest powdered infant formulas as a vehicle for infection (12).

Recently obtained evidence using amplified fragment length polymorphism, phenotypic arrays, automated ribotyping, 16S rRNA gene sequencing and DNA-DNA hybridization has resulted in a nomenclature change. E. sakazakii was reclassified into a new genus, Cronobacter, comprising five species including Cronobacter sakazakii gen. nov., Cronobacter malonaticus sp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., and Cronobacter dublinensis sp. nov. These species have all been previously involved in clinical cases. One additional new species was also proposed, Cronobacter genomospecies I (Table 1) (7).

Table 1. Biochemical tests for the differentiation of species and subspecies of the genus Cronobacter (7).

  C. sakazakii C. malonaticus C. turicensis C. genomospecies I C. muytjensii C. dublinensis subsp. dublinensis C. dublinensis subsp. lactaridi C. dublinensis subsp. lausannensis
Indole production + + + V
Carbon source utilization:
Dulcitol + + +
Lactulose + + + + + + +
Malonated + + V + +
Maltitol + + + + + +
Palatinose + + + + V + + +
Putrescine + V + V + + + V
Melezitose + +
Turanose + + + V V + V
myo-Inositol V V + + + + +
cis-Aconitate + + + + V + + +
trans-Aconitate + + V + + +
1-0-Methyl a-D-glucopyranoside + + + + + + +
4-Aminobutyrate + + + V + + + +

+: 90% Positive; V: 20-80% positive; −: 10% positive


The method described here contains both a real-time PCR method for rapid screening and a cultural method for the detection/isolation of Cronobacter spp. (3). Chromogenic agars are used to isolate the culture for confirmation. A pre-enrichment step is used to grow the bacteria to an amount (≥ 103 CFU/ mL) detectable by PCR and chromogenic agars. The cultural portion of this method is a complete detection/isolation method, so it can be used as a stand alone method if PCR technology is unavailable.  The PCR portion of the method is a screening method, whose positive results should always be confirmed with the cultural method. The PCR method may be used to confirm pure cultures as Cronobacter spp.  This method was validated in pre-collaborative and collaborative studies (1,2).

The inclusivity of this method was determined by analyzing 51 different Cronobacter strains representing the six Cronobacter species that were isolated from foods, clinical samples, environmental surfaces, and nationally/internationally recognized culture depositories. The origin and source of each strain are listed in the Inclusivity Table (A). Each strain was enriched in brain heart infusion (BHI) broth and diluted in buffered peptone water (BPW) to approximately 10 times the limit of detection. The diluted cultures were then tested according to this method.

The exclusivity of this method was determined by testing 42 non-Cronobacter strains. The source and origin of each strain are listed in the Exclusivity Table (B). Each strain was enriched in BHI broth. These incubated cultures were tested according to this method.

  1. Equipment and materials
    1. Balance with capacity of 2 kg and sensitivity of 0.1 g
    2. Incubator, 36 ± 1º C
    3. Sterile Erlenmeyer flasks with polyethylene screw caps equipped with teflon liners, 2 liter
    4. Micropipette and tips to dispense 1 µL , 100 µL, 150 µL, and 200 µL volumes
    5. Pipets, 1, 5, and 10 mL, graduated in 0.1 mL units
    6. Sterile inoculating loops, 3 mm loop size
    7. Glass spreading rods (e.g., hockey stick) 3-4 mm diameter with 45-55 mm spreading area
    8. Sterile utensils for sample handling (see BAM Chapter 1)
    9. Centrifuge with a swinging bucket rotor, capable of 3,000 × g
    10. Microcentrifuge, capable of 10,000 × g
    11. Centrifuge tubes, polypropylene, 50 mL tubes with conical bottoms; 1.5 mL microcentrifuge tubes
    12. Vortex mixer
    13. Water bath, capable of 100 °C
    14. Thermal cyclers: ABI Prism 7500 Fast Sequence Detection System (Life Technologies, Inc. Carlsbad, CA 92008), SmartCycler Real-Time PCR system (Cepheid, Sunnyvale, CA 94089)
    15. Sample tubes with centrifuge adapters for SmartCycler II (minimum reaction volume of 25 µL)
    16. 96-well microwell plate
    17. Optical adhesive covers
    18. Petri dishes, plastic, sterile, 15 × 150 mm
    19. VITEK® 2 Compact (bioMerieux, Hazelwood, MO 63402)
    20. NanoDrop ND1000 (Thermal Scientific, Wilmington, DE, 19810)
  2. Media and reagents
    1. Phosphate-buffered saline (BAM R59)
    2. Buffered peptone water (BPW) (BAM M192)
    3. Brilliance Enterobacter sakazakii agar (DFI formulation) (Cat. No. CM1055, Oxoid, Lenexa, KS). Prepare media according to the instructions on the packaging label. After the plates have been poured and dried upside down at room temperature, they can be placed in petri plate sleeves and stored upside down at 2-8 ºC in the dark for up to 2 weeks.
    4. Enterobacter sakazakii chromogenic plating agar (R&F agar), (Cat. No. M-0700, R & F Laboratories, Downers Grove, IL). Prepare media according to the manufacturer's instructions on the packaging label. After the plates have been poured, they should be stored upside down in the dark for 48 hours at room temperature to dry the agar surface. Then the plates can be placed in petri plate sleeves (cutting a 0.5" to 1" hole in the sleeves to allow condensation to escape) and stored upside down at 2-8 ºC in the dark for up to 45 days.
    5. Oxidase test reagent (BAM R54)
    6. PrepMan Ultra® sample preparation reagent (Cat. No. 4318930. Life Technologies)
    7. iQ™ Supermix PCR master mix (Cat. No. 170-8860, Bio-Rad, Hercules, CA 94547). 2×mix contains 100 mM KCl, 40 mM Tris-HCl, pH8.4, 0.4 mM each dNTP, 50 U/ml iTaq DNA polymerase and 6 mM MgCl2.
    8. Rapid ID 32 E biochemical strips (bioMerieux)
    9. VITEK Gram Negative Identification Card (bioMérieux)
    10. Platinum® Taq DNA Polymerase (Cat. No. 10966-018, Invitrogen, Carlsbad, CA 92008)
    11. Primers and probes (Table 2). PCR primers are commercially synthesized with basic desalt purification and then reconstituted using PCR grade water to 100 µM for prolonged storage. They are diluted to 40 µM working stock concentrations. PCR probes are commercially synthesized with HPLC purification and reconstituted to 2.5 µM in single use aliquots using 1× PCR grade TE buffer. Primers and probes need to be stored frozen (-20 to -70 ºC). Discard leftover thawed probes and avoid repeating freeze-thawing.

      Table 2. Primers and probes for the PCR assay

      Oligos Name Sequences (5' to 3')
      Cronobacter forward CronoF GGGATATTGTCCCCTGAAACAG
      Cronobacter reverse CronoR CGAGAATAAGCCGCGCATT
      Internal control forward InCF CTAACCTTCGTGATGAGCAATCG
      Internal control reverse InCR GATCAGCTACGTGAGGTCCTAC
      Internal control probe InCP Cy5-AGCTAGTCGATGCACTCCAGTCCTCCT-Iowa Black RQ-Sp.
    12. Internal Control DNA (3): Internal control (InC) DNA is constructed by generating a 198 bp sequence that is synthesized and inserted into a pZErO-2 vector and transformed into Escherichia coli pDMD801 partial sequence representation containing the internal control is shown below (GenBank accession no. FJ357008, Figure 1). The internal control DNA (IAC in Figure 1) sequence is in grey, T7 promoter is represented in a box, and M13, internal control forward and reverse primers and probe targets are represented by arrows. The plasmid is extracted by Qiagen Plasmid Mini Kit (Cat. No. 12125, Qiagen, Valencia, CA 91355) from the transformed Escherichia coli cells following manufacturer's instructions and quantified by NanoDrop ND1000. The internal control DNA can also be commercially synthesized and diluted to a stock solution which will provide a reliable Ct of no less than 24 when Cronobacter DNA are present and no more than 34 when Cronobacter are not present.

      Figure 1. Illustration of the internal control DNA

      Illustration of the internal control DNA
  3. Preparation of infant formula samples for isolation of Cronobacter
    1. Wear double gloves at all times. Change outer gloves, wipe clean the balance and working area after processing each sample
    2. Sterilize the container margins and the spoons used for sampling prior to withdrawing the samples.
    3. Aseptically weigh out 100 g of the powdered infant formula and add to 2 liter size Erlenmeyer flasks.
    4. Add 900 mL (1:10 dilution) of sterile buffered peptone water (BPW) and gently shake by hand until the powder is uniformly suspended. Incubate for 24 ± 2 h at 36 ± 1 °C.
    5. Thoroughly mix the enrichment mix and remove four aliquots of 40 mL each from the incubated sample and place them into four 50 mL centrifuge tubes. Centrifuge the aliquots at 3,000 × g for ten minutes in a swinging bucket centrifuge (fixed angle centrifuges are not recommended because of problems separating the fats from the pellet).
    6. Aspirate the supernatants of each centrifuge tube.
    7. Use sterile cotton swabs or equivalent tools to remove the fat precipitate on the side wall of the centrifuge tube, if necessary.
    8. Suspend the resultant pellet in 200 µL of phosphate buffered saline (PBS) by vortexing at maximum speed for at least 20 sec. Two of the aliquots will be used for PCR. Two of the aliquots will be used for culture confirmation if necessary.
  4. PCR screening of Cronobacter
    DNA extraction. Centrifuge 200 µL suspended cells (in PBS) at 3,000 × g for 5 min in a 1.5 mL microcentrifuge tube. Depending on the presence and absence of bacterial cells and the efficiency of fat removal at the previous step, there could be 4 layers after centrifugation. The top layer is fat residues, the second layer is supernatant, the third layer is bacterial cell pellets which are brown/yellow and the bottom pellets are milk particles. Discard the supernatants and any fat residues of each centrifuge tube. Add 400 µl of PrepMan Ultra® sample preparation reagent to each tube and vortex at maximum speed to allow complete suspension. Heat the sample for 10 min at 100 °C in a boiling water bath or heating block, then cool the sample to room temperature for 2 min. Centrifuge the sample for 2 min at a speed of at least 15,000 × g. Transfer 50 µl of the supernatant into a new tube for PCR analysis. For each DNA extract, run both PCR protocols with and without InC. If any of the PCR result is positive, the sample is considered presumptive positive or cannot rule out (CRO) and proceed to the culture confirmation (Section E). If both DNA extracts are negative by PCR, the sample is considered negative and stop analysis.

    Include a positive control (prepared by 1:10 dilution of a pure culture of Cronobacter strain, i.e. E604) and a no template (water) control in each PCR run. The PCR is designed to detect very low level of Cronobacter cells. If after enrichment, a significant large amount cells are grown, the PCR could yield high fluorescence. One solution is to dilute the DNA (1:10 or 1:100) and rerun the PCR.

    1. Cepheid SmartCycler Thermal Cycler (software version 2.0d).

      Prepare PCR reactions from the reaction components and final concentrations listed in Table 3 and Table 4. Create a "run" on SmartCycler. Give each run a unique run name, select dye set FCTC25, select 3-step PCR protocol as described below and assign appropriate sites on the cycler block.

      1. PCR setup without InC
        PCR condition: 95 °C for 3 min followed by 40 cycles of 95 °C for 15 sec, 52 °C for 20 sec and 72 °C for 30 sec. The fluorescence is recorded at the end of each annealing step.

        Table 3. PCR reaction components for SmartCycler without InC

        Component Volume/reaction Final Concentration
        IQ Supermix 12.5 µL 50 mM KCl, 20 mM Tris-HCl, 0.2 mM each dNTP,
        0.625 U iTaq DNA polymerase and 3 mM MgCl2
        CronoF 0.5625 µL (40 µM stock solution) 900 nM
        CronoR 0.5625 µL (40 µM stock solution) 900 nM
        CronoP 2.5 µL (2.5 µM stock solution) 250 nM
        Taq Polymerase 0.1 µL (5 U/ µL) 0.5 U
        DNA extract or control 2 µL  
        PCR grade water Appropriate amount to reach 25 µL  
      2. PCR setup with InC
        PCR condition: 95 °C for 3 min followed by 40 cycles of 95 °C for 20 sec, 50 °C for 60 sec and 72 °C for 30 sec. The fluorescence is recorded at the end of each annealing step.

        Table 4. PCR reaction components for SmartCycler with InC

        Component Volume/reaction Final Concentration
        IQ Supermix 12.5 µL 50 mM KCl, 20 mM Tris-HCl, 0.2 mM each dNTP,
        0.625 U iTaq DNA polymerase and 3 mM MgCl2
        CronoF 0.5625 µL (40 µM stock solution) 900 nM
        CronoR 0.5625 µL (40 µM stock solution) 900 nM
        CronoP 2.5 µL (2.5 µM stock solution) 250 nM
        InCF 0.625 µL (40 µM stock solution) 1000 nM
        InCR 0.625 µL (40 µM stock solution) 1000 nM
        InCP 2.5 µL (2.5 µM stock solution) 250 nM
        InC DNA 1 µL (0.01 pg/µL; equivalent to
        3 ×103 plasmid copies per µL)
        0.01 pg
        Taq Polymerase 0.5 µL (5 U/ µL) 2.5 U
        MgCl2 1.5 µL (50 mM solution) 3 mM
        DNA extract or control 2 µL  
        PCR grade water Appropriate amount to reach 25 µL  
      3. Qualitative Data Interpretation

        On the SmartCycler Instrument, set the following analysis settings for FAM and Cy5 channels. Update analysis settings if they are changed before recording results.

        1. Usage: Assay
        2. Curve Analysis: Primary
        3. Threshold Setting: Manual
        4. Manual Threshold Fluorescence Units: FAM channel set at 20 units. Cy5 channel set at 30 units.
        5. Auto Min Cycle: 5
        6. Auto Max Cycle: 10
        7. Valid Min Cycle: 3
        8. Valid Max. Cycle: 60
        9. Background subtraction: ON
        10. Boxcar Avg. Cycles: 0
        11. Background Min. Cycle: 5
        12. Background Max. Cycle: 40

        Primary fluorescence curves that cross the threshold will be recorded as "POS" and the cycle number when it crosses the threshold will be displayed in the "Results Table" view. Negative results are shown as "NEG". The FAM and Cy5 channels correlate to Cronobacter and InC targets, respectively. Results can also be viewed graphically (Figure 2).

        Figure 2. Sample screenshots of the SmartCycler result (graph and table views). The amplification curves of Cronobacter (labeled with FAM) and internal control (labeled with Cy5) are shown in the graph. The Ct values, positive/negative results and dye sets are shown in the result table. FCTC25 dye set contains FAM, Cy3, TxR and Cy5. Cy3 and TxR are not used in the PCR assay.

        A DNA extract is considered PCR positive if either of the PCR runs (with and without InC) is positive.
        For PCR with InC, DNA extracts that have Ct values for FAM and also demonstrate sigmoidal amplification curves are considered CRO. If there is no Ct value in FAM for a DNA extract, or the curve is not the typical sigmoidal shape, the InC for that DNA extract must be analyzed:

        1. The DNA extract is considered negative if there is Ct value in Cy5 and the curve for Cy5 is sigmoidal;
        2. If there is no Ct value in Cy5, then there is possible inhibitory substance in the sample and PCR result is invalid. The DNA extracts need to be diluted (1/10, in PCR grade water) or centrifuged for further purification, and the PCR repeated; or directly proceed with culture confirmation (Section E).

        For PCR without InC, DNA extracts that have Ct values for FAM and also demonstrate a sigmoidal amplification curve are considered CRO and proceed to culture confirmation. If there are no Ct values in FAM, the DNA extract is considered negative. If PCR without InC is negative, but the PCR with InC shows possible presence of inhibitory substances in the sample, then further purified DNA extracts need to be diluted and repeated with the PCR without InC.

        With both protocols, a positive template control should generate positive signal for the PCR results to be valid. If the no template control shows amplification, then the reaction may be contaminated and the PCR result is invalid. Repeat PCR; or directly proceed with culture confirmation.

    2. ABI 7500 Fast Thermal Cycler (software version 2.0.4)

      Prepare PCR reactions from the reaction components and final concentrations listed in Table 5 and Table 6. Create a "new experiment" on 7500 Fast. Give each experiment a unique name. Select the following parameters:

      1. In "Experimental properties", select quantitation-standard curve as the type of experiments; Taqman reagents and standard ramp speed,
      2. In "Plate Setup", select none for reference dye, TAMRA as quencher for Cronobacter probe and none as quencher for InC probe. Assign appropriate sites on the cycler block.
      3. In "Run Method", set reaction volume per well to 25 µL. Select the PCR conditions: 95 °C for 3 min followed by 40 cycles of 95 °C for 15 sec, 52 °C for 40 sec and 72 °C for 15 sec. The fluorescence is recorded at the end of each annealing step. The PCR with and without InC employ the same PCR condition.
      1. PCR setup without InC

        Table 5. PCR reaction components for ABI 7500 Fast without InC

        Component Volume/reaction Final Concentration
        IQ Supermix 12.5 µL 50 mM KCl, 20 mM Tris-HCl, 0.2 mM each dNTP,
        0.625 U iTaq DNA polymerase and 3 mM MgCl2
        CronoF 0.25 µL (40 µM stock solution) 400 nM
        CronoR 0.25 µL (40 µM stock solution) 400 nM
        CronoP 3 µL (2.5 µM stock solution) 300 nM
        Taq Polymerase 0.1 µL (5 U/ µL) 0.5 U
        DNA extract or control 2 µL
        PCR grade water Appropriate amount to reach 25 µL
      2. PCR setup with InC

        Table 6. PCR reaction components for ABI 7500 Fast with InC

        Component Volume/reaction Final Concentration
        IQ Supermix 12.5 µL 50 mM KCl, 20 mM Tris-HCl, 0.2 mM each dNTP,
        0.625 U iTaq DNA polymerase and 3 mM MgCl2
        CronoF 0.25 µL (40 µM stock solution) 400 nM
        CronoR 0.25 µL (40 µM stock solution) 400 nM
        CronoP 3 µL (2.5 µM stock solution) 300 nM
        InCF 0.09375 µL (40 µM stock solution) 150 nM
        InCR 0.09375 µL (40 µM stock solution) 150 nM
        InCP 1.5 µL (2.5 µM stock solution) 150 nM
        InC DNA 0.005 pg/µL (equivalent to
        1.5 ×103 plasmid copies per µL)
        0.005 pg
        Taq Polymerase 0.5 µL (5 U/µL) 2.5 U
        MgCl2 1.5 µL (50 mM solution) 3 mM
        DNA extract or control 2 µL
        PCR grade water Appropriate amount to reach 25 µL

        To analyze the data, set auto baseline and set the threshold value to 50,000 units for both FAM and Cy5.  Sample screen shots of the graph and table view is shown in Figure 3.  Follow the data interpretation criteria for the SmartCycler to interpret the data.

        Sample Screenshots Fast Result

        Figure 3. Sample screenshots of the 7500 Fast result. The amplification curves of Cronobacter (assigned as target 1) and InC (assigned as target 2) are shown in the graph and the Ct values and dye sets are shown in the result table.

  5. Isolation of Cronobacter

    For CRO samples, spread 100 µL aliquots of suspended cells (obtained in C8) evenly onto each of the two DFI chromogenic agar (4) and two R&F Cronobacter chromogenic plating agar (9) with sterile spreading rods. In addition, streak a loopful of aliquots of suspended cells onto the surface of two DFI and two R&F agar with sterile inoculation loops. Incubate the agar plates at 36 ± 1 °C for 18 to 24 h. Observe plates for colonial morphology typical of Cronobacter (Figure 4). If the cultures overgrow on the plates, streak a 3 mm loopful (10 µL) of lawn materials to at least three quadrants of a new plate for isolation of single colonies.

    Figure 4a. Cronobacter colonies on DFI agar.

    Figure 4b. Cronobacter colonies on R&F agar. The plate on the right shows an infant formula sample with Cronobacter and background flora. The background flora changes the background color of the agar from red to yellow in most areas. Cronobacter colonies are green with yellow background and black with red background.

  6. Identification of Cronobacter

    Presumptive Cronobacter colonies on DFI agar appear either dark green, weak green, or brownish green. Some colonies only have a green center with a white/yellow border. Presumptive Cronobacter colonies on R&F agar appear blue to black, or blue to grey with the red background. The red background can appear purplish red with different strain or under different light conditions. Cronobacter does not change the color of R&F agar, but in the presence of background microflora which change the color of R&F agar from red to yellow, Cronobacter colonies appear blue to green (Figure 4b).

    1. Biochemical confirmation

      Cultures for biochemical identification must be no older than 24 h. With a sterile inoculating loop, pick one presumptive Cronobacter colony from each DFI agar and R&F agar plate and confirm using Rapid ID 32 E or VITEK 2.0 biochemical identification system according to the manufacturer's instructions. For positive identification with Rapid ID 32 E, the oxidase test must be included.

    2. PCR confirmation

      Prepare DNA of presumptive positive colonies on DFI and R&F agar plates. Add a small amount of colony material to 150 µL of PCR grade dH2O contained in a 1.5 mL plastic centrifuge tube and boil for 5 min in a boiling water bath. Chill the tubes in ice and centrifuge at 10,000 × g for 2 min. Use 1 µL of this lysed material as DNA template for the real-time PCR assay with any of the mentioned PCR protocols above.

  7. Optional: enumeration of Cronobacter

    Use the three-tube Most Probably Number (MPN) procedure (BAM Manual, Appendix 2; Most Probable Number Determination from Serial Dilutions; ). Aseptically weigh out in triplicate, 100 g, 10 g and 1 g of the powdered infant formula and add to 2 liter, 250 mL and 125 mL size Erlenmeyer flasks, respectively and proceed with sample preparation, culture isolation and identification. Calculate MPN of Cronobacter cells/g of sample based on the number of "tubes" at each dilution in which the presence of Cronobacter was confirmed.

  8. Flowchart of the complete procedure

    Figure 5. Flowchart of the complete procedure


  1.  Chen, Y., K.E. Noe, S. Thompson, C.A. Elems, E.A. Brown, K.A. Lampel, and T.S. Hammack. 2011. Evaluation of a revised FDA method for the detection of Cronobacter in powdered infant formula: Collaborative study. J. Food Prot. In Press.
  2.  Chen, Y., T.S. Hammack, K.Y. Song, and K.A. Lampel. 2009. Evaluation of a revised U.S. Food and Drug Administration method for the detection and isolation of Enterobacter sakazakii in powdered infant formula: precollaborative study. J. AOAC Int. 92:862-872.
  3.  Chen, Y., K.Y. Song, E.W. Brown and K.A. Lampel. 2010. Development of an improved protocol for the isolation and detection of Enterobacter sakazakii (Cronobacter) from powdered infant formula. J. Food Prot. 73:1016-1022.
  4.  Deer, D.M., K.A. Lampel, and N. Gonzalez-Escalona. 2010. A versatile internal control for use as DNA in real-time PCR and as RNA in real-time reverse transcription PCR assays. Lett. Appl. Microbiol. 50:366-372.
  5.  Druggan, P. and C.Iversen. 2009. Culture media for the isolation of Cronobacter spp. Int. J. Food Microbiol. 136:169-178.
  6.  Farmer J.J., III, M.A. Asbury, F.W. Hickman. The Enterobacteriaceae Study Group and D.J. Brenner. 1980. Enterobacter sakazakii: A new species of "Enterobacteriaceae" isolated from clinical specimens. Intl. J. Syst. Evol. Microbiol. 30:569-584.
  7.  Iversen, C., N. Mullane, B. McCardell, B.D. Tall, A. Lehner, S. Fanning, R. Stephan, and H. Joosten. 2008. Cronobacter gen. nov., a new genus to accommodate the biogroups of Enterobacter sakazakii, and proposal of Cronobacter sakazakii gen. nov., comb. nov., Cronobacter malonaticus sp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., Cronobacter dublinensis sp. nov., Cronobacter genomospecies 1, and of three subspecies, Cronobacter dublinensis subsp. dublinensis subsp. nov., Cronobacter blinensis subsp. lausannensis subsp. nov. and Cronobacter dublinensis subsp. lactaridi subsp. nov. Int. J. Syst. Evol. Microbiol. 58:1442-1447.
  8.  Lai, K.K. 2001. Enterobacter sakazakii infections among neonates, infants, children, and adults. Case reports and a review of the literature. Medicine (Baltimore). 80:113-122.
  9.  Nazarowec-White, M. and J.M. Farber. 1997. Enterobacter sakazakii: a review. Int. J. Food Microbiol. 34:103-113.
  10.  Restaino, L., E.W. Frampton, W.C. Lionberg, and R.J. Becker. 2006. A chromogenic plating medium for the isolation and identification of Enterobacter sakazakii from foods, food ingredients, and environmental sources. J. Food Prot. 69:315-322.
  11.  Urmenyi, A.M. and A.W. Franklin. 1961. Neonatal death from pigmented coliform infection. Lancet. 1:313-315.
  12.  World Health Organization. Enterobacter sakazakii and other microorganisms in powdered infant formula: meeting report.disclaimer icon 2004.


Table A. Inclusivity Testing Results for Cronobacter

Original Lab Original ID Organism Source Country Origin DFIa R&Fb RAPID ID 32E Real-Time PCR
UCDc/UZHd/NRCe E265 C. malonaticus milk powder Malaysia Positive Positive Cronobacter Positive
ILSIf F6-036 C. sakazakii Environment
(Milk powder)
Malaysia Positive Positive Cronobacter Positive
ILSI F6-038 C. sakazakii Environment
(Milk powder)
Holland Positive Positive Cronobacter Positive
ILSI F6-040 C. sakazakii Environment
(Milk powder)
Holland Positive Positive Cronobacter Positive
UCD/UZH/NRC E464 C. dublinensis Environment
(Milk powder)
Zimbabwe Positive Positive Cronobacter Positive
ATCC 29544;
NCTC 11467
C. sakazakii human (throat) unknown Positive Positive Cronobacter Positive
FDAi 607 C. sakazakii unknown unknown Positive Positive Cronobacter Positive
UCD/UZH/NRC E515 C. dublinensis water Switzerland Positive Positive Cronobacter Positive
ATCC ATCC 12868 C. sakazakii unknown unknown Positive Positive Cronobacter Positive
ATCC ATCC 51329 C. muytjensii unknown unknown Positive Positive Cronobacter Positive
HCSCj; FDA SK90 C. sakazakii clinical
(children's hospital)
Canada Positive Positive Cronobacter Positive
UCD/UZH/NRC E632 C. sakazakii food USA Positive Positive Cronobacter Positive
HCSC HPB 2848 C. sakazakii clinical Canada Positive Positive Cronobacter Positive
HCSC HPB 2873 C. sakazakii clinical Canada Positive Positive Cronobacter Positive
HCSC HPB 2874 C. sakazakii clinical Canada Positive Positive Cronobacter Positive
UCD/UZH/NRC H. Muytjens
(Prague 72 26248)
C. sakazakii unknown Czech Republic Positive Positive Cronobacter Positive
UCD/UZH/NRC H. Muytjens 52 C. malonaticus milk powder Australia Positive Positive Cronobacter Positive
UCD/UZH/NRC H. Muytjens 58 C. sakazakii milk powder Belgium Positive Positive Cronobacter Positive
UCD/UZH/NRC H. Muytjens 15 C. sakazakii milk powder Denmark Positive Positive Cronobacter Positive
UCD/UZH/NRC H. Muytjens 8 C. sakazakii milk powder France Positive Positive Non-Cronobacter Positive
UCD/UZH/NRC H. Muytjens 35 C. sakazakii milk powder Russia Positive Positive Cronobacter Positive
UCD/UZH/NRC H. Muytjens 26 C. sakazakii milk powder Russia Positive Positive Cronobacter Positive
UCD/UZH/NRC H. Muytjens
(Nijmegen 15)
C. sakazakii neonate Holland Positive Positive Cronobacter Positive
UCD/UZH/NRC H. Muytjens
(Nijmegen 21)
C. sakazakii neonate Holland Positive Positive Cronobacter Positive
CDCk CDC 5960-70 C. dublinensis human (blood) USA Positive Positive Cronobacter Positive
CDC CDC 3523-75 C. malonaticus human (bone marrow) USA Positive Positive Cronobacter Positive
NCTC NCTC 9238 C. sakazakii human
(abdominal pus)
UK Positive Positive Cronobacter Positive
NCTC NCTC 9529 C. genomospecies water UK Positive Positive Cronobacter Positive
ATCC ATCC BAA893 C. sakazakii unknown USA Positive Positive Cronobacter Positive
ATCC ATCC BAA894 C. sakazakii unknown USA Positive Positive Cronobacter Positive
CDC CDC 996-77 C. sakazakii human (spinal fluid) USA Positive Positive Cronobacter Positive
CDC CDC 1058-77 C. malonaticus human (breast abscess) USA Positive Positive Cronobacter Positive
CDC CDC 407-77 C. sakazakii human (sputum) USA Positive Positive Cronobacter Positive
CDC CDC 3128-77 C. sakazakii human (sputum) USA Positive Positive Cronobacter Positive
CDC CDC 9369-75 C. sakazakii unknown USA Positive Positive Cronobacter Positive
UZH z3032 C. turicensis neonate (meningitis) Switzerland Positive Positive Cronobacter Positive
C. sakazakii human Canada Positive Positive Cronobacter Positive
ILSI; RADl F6-029 C. sakazakii neonate Holland Positive Positive Cronobacter Positive
ILSI 01-10-2001; F6-034 C. sakazakii clinical USA Positive Positive Cronobacter Positive
ILSI 8397; F6-043 C. sakazakii clinical USA Positive Positive Cronobacter Positive
CDC 289-81;
C. malonaticus clinical USA Positive Positive Cronobacter Positive
CDC 1716-77;
C. sakazakii human (blood) USA Positive Positive Cronobacter Positive
H. Muytjens 7
C. sakazakii milk powder Uruguay Positive Positive Cronobacter Positive
UCD CFS112 C. sakazakii milk powder Ireland Positive Positive Cronobacter Positive
UCD CFS349N C. sakazakii milk powder New Zealand Positive Positive Cronobacter Positive
UCD CFS352N C. sakazakii milk powder New Zealand Positive Positive Cronobacter Positive
UCD ES187 C. dublinensis milk powder Ireland Positive Positive Cronobacter Positive
CDC CDC 9363-75 C. sakazakii stool USA Positive Positive Non-Cronobacter Positive
CDC CDC 4963-71 C. sakazakii stool USA Positive Positive Cronobacter Positive
CDC CDC 1895-73 C. malonaticus human (faeces) USA Positive Positive Cronobacter Positive
RFm ES626 C. sakazakii rice flour USA Positive Positive Cronobacter Positive

a Positive of DFI shows green colony as Cronobacter
b Positive of R&F shows blue-green-black colony as Cronobacter
c UCD: S. Fanning, Centre for Food Safety, University College Dublin, Belfield, Dublin 4, Ireland
d UZH: R. Stefan, Institute for Food Safety, University of Zurich, Winterthurerstrasse 270, CH-8057, Switzerland
e NRC: Nestlé Research Centre, Vers-Chez-les-Blanc, Lausanne, CH-1000, Switzerland
f ILSI: R. Ivy, Food Safety Lab, Cornell University, 412 Stocking Hall, Ithaca, NY, USA
g ATCC: American Type Culture Collection, Manassas, VA, USA
h NCTC: National Collection of Type Cultures, London, UK
i FDA: R. Buchanan, FDA-CFSAN, College Park, MD, USA
j HCSC: F. Pagotto, Health Products and Food branch, Health Canada
k CDC: Center for Disease Control, Atlanta, GA, USA
l RAD: Department of Medical Microbiology, University of Nijmegen, Radboud, Netherlands
m RF: L. Restaino, R&F Laboratories, Downers Grove, IL, USA disclaimer icon

Table B. Exclusivity Testing Results for Cronobacter

Original Lab Strain ID Organism Source DFIa R&Fb RAPID ID 32E Real-Time PCR
ATCCc 13047 Enterobacter cloacae spinal fluid Negative Negative non-Cronobacter Negative
ATCC 13048 Enterobacter aerogenes sputum Negative Negative non-Cronobacter Negative
ATCC 13182 Klebsiella oxytoca Pharyngeal tonsil Negative Negative non-Cronobacter Negative
ATCC 13880 Serratia marcescens pond water Negative Negative non-Cronobacter Negative
ATCC 14485 Streptococcus thermophilus unknown No growth No growth non-Cronobacter Negative
ATCC 14807 Bacillus subtilis soil Negative Negative non-Cronobacter Negative
ATCC 15469 Edwardsiella tarda faeces Negative Negative non-Cronobacter Negative
ATCC 23055 Acinetobacter calcoaceticus unknown Negative Negative non-Cronobacter Negative
ATCC 23216 Leclercia adecarboxylata drinking water Negative Negative non-Cronobacter Negative
ATCC 25830 Morganella morganii patient with summer diarrhea Negative Negative non-Cronobacter Negative
ATCC 25922 Escherichia coli clinical isolate Negative Negative non-Cronobacter Negative
ATCC 27028 Citrobacter koseri blood culture Negative Negative non-Cronobacter Negative
ATCC 27982 Pantoea agglomerans IV fluid Negative Negative non-Cronobacter Negative
ATCC 29013 Klebsiella pneumoniae blood Negative Negative non-Cronobacter Negative
ATCC 29944 Providencia rettgeri unknown Negative Negative non-Cronobacter Negative
ATCC 27853 Pseudomonas fluorescens unknown Negative Negative non-Cronobacter Negative
ATCC 13472 Bacillus cereus unknown No growth No growth non-Cronobacter Negative
ATCC 33105 Serratia ficaria Calimyrna fig Negative Negative non-Cronobacter Negative
ATCC 33420 Proteus vulgaris clinical isolate Negative Negative non-Cronobacter Negative
ATCC 33650 Escherichia hermanii human toe Negative Negative non-Cronobacter Negative
ATCC 15246 Alcalgenes faecalis unknown Negative Negative non-Cronobacter Negative
ATCC 33832 Escherichia vulneris unknown Negative Negative non-Cronobacter Negative
ATCC 29212 Enterococcus faecalis unknown No growth No growth non-Cronobacter Negative
ATCC 10054 Micrococcus luteus unknown No growth No growth non-Cronobacter Negative
ATCC 51713 Buttiauzella noakiae unknown Positive Positive non-Cronobacter Negative
ATCC 25741 Pediococus acidilactici unknown No growth No growth non-Cronobacter Negative
ATCC 8090 Citrobacter freundii unknown Negative Positive non-Cronobacter Negative
ATCC 9789 Bacillus licheniformis milk No growth No growth non-Cronobacter Negative
UZHd/UCDe/NRCf E440 Enterobacter helveticus
sp. nov
milk powder Positive Positive non-Cronobacter Negative
UZH/UCD/NRC E441 Enterobacter novel species milk powder Negative Positive non-Cronobacter Negative
UZH/UCD/NRC E644 Enterobacter cloacae human (faeces) Negative Negative non-Cronobacter Negative
UZH/UCD/NRC E904; 05-01-120 Enterobacter homaechei milk powder Negative Negative non-Cronobacter Negative
ILSIg F6-026 Enterobacter asburiae environment Negative Negative non-Cronobacter Negative
ILSI F6-033 Enterobacter hormaechei milk powder Negative Negative non-Cronobacter Negative
LMGh; UZH LMG 23730 Enterobacter turicensis,
sp. nov
fruit powder Negative Negative non-Cronobacter Positive
LMG; UZH LMG 23732 Enterobacter helveticus,
sp. nov
fruit powder Positive Negative non-Cronobacter Negative
UZH 1160/04;E908 Enterobacter novel species fruit powder Positive Negative non-Cronobacter Negative
FDAi   Salmonella Cubana milk Negative Negative non-Cronobacter Negative
FDA Yp 1313 Yersinia pseudotuberculosis unknown Negative Negative non-Cronobacter Negative
FDA Ye 37 Yersinia enterocolitica unknown Negative Negative non-Cronobacter Negative
FDA 2457T Shigella flexneri clinical Negative Negative non-Cronobacter Negative
FDA   Shigella sonnei clinical Negative Negative non-Cronobacter Negative
False-positive       4 / 42 4 / 42 0 / 42 1 / 42

a Positive of DFI shows green colony as Cronobacter
b Positive of R&F shows blue-green-black colony as Cronobacter
c ATCC: American Type Culture Collection, Manassas, VA, USA
d UZH: R. Stephan, Institute for Food Safety, University of Zurich, Winterthurerstrasse 270, CH-8057, Switzerland
e UCD: S. Fanning, Centre for Food Safety, University College Dublin, Belfield, Dublin 4, Ireland
f NRC: Nestlé Research Center, Vers-Chez-les-Blanc, Lausanne, CH-1000, Switzerland
g ILSI: R. Ivy, Food Safety Lab, Cornell University, 412 Stocking Hall, Ithaca, NY, USA
h LMG: BCCM/LMG Bacteria Collection, Ghent, Belgium
i FDA: K. Lampel, FDA-CFSAN, College Park, MD, USA

Back to Top