• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Food

  • Print
  • Share
  • E-mail

BAM: Detection of Cyclospora and Cryptosporidium

Return to BAM table of contents

October 2004

Bacteriological Analytical Manual
Chapter 19 A.
Detection of Cyclospora and Cryptosporidium from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR) and Microscopic analysis

Authors: Palmer A. Orlandi, Christian Frazar, Laurenda Carter, and Dan-My T. Chu


Table of Contents

  1. Materials and Equipment
  2. Reagents
  3. Optional Reagents, Supplies, and Equipment
  4. Wash Procedure for Fresh Produce
    1. Isolation of Cyclospora from Fresh Produce Washes
    2. Isolation of Cryptosporidium spp. from Fresh Produce Washes
  5. Isolation of Parasitic Contaminants from Juices, Cider, and Milk
    1. Isolation of Cyclospora from Juices, Cider, and Milk
    2. Isolation of Cryptosporidium spp. from Juices, Cider, and Milk
  6. Isolation of Parasitic Contaminants from Large Volumes of Water
  7. Slide Preparation and Microscopic Analysis-Cyclospora cayetanensis
    1. Sample Preparation
    2. Microscopy
  8. Slide Preparation and Microscopic Analysis-Cryptosporidium spp.
  9. PCR Analysis
    1. DNA Primers
    2. General Sample Preparations for Primary PCR Amplification
    3. Conventional Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp.
    4. OPTIONAL-Real Time Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp. using the Roche LightCycler® System
    5. Nested PCR Amplification for the Differential Identification of Cryptosporidium spp.
    6. Agarose Gel Electrophoresis
    7. Restriction Fragment Length Polymorphism (RFLP) Analysis of Cryptosporidium spp. Nested PCR Amplicons to Determine the Presence and Differentiation of C. hominis and C. parvum
  10. References

List of Tables

  1. Table 1       Parameters for Epifluorescence Microscopy
  2. Table 2       DNA Primer Sequences for Cyclospora-specific PCR Amplification
  3. Table 3       DNA Primer Sequences for Cryptosporidium Genus-specific PCR Amplification
  4. Table 4       General PCR Conditions for Primary PCR Amplification
  5. Table 5       Controls for PCR Amplifications
  6. Table 6       PCR Thermal Cycling Parameters for Cyclospora and Eimeria spp. Detection
  7. Table 7       PCR Thermal Cycling Parameters for Cryptosporidium spp.
  8. Table 8       Assay Conditions for the Conventional Nested Multiplex PCR Amplification of Cyclospora and Eimeria spp.
  9. Table 9       Assay Conditions for the Real-time Nested Multiplex PCR Amplification of Cyclospora and Eimeria spp.
  10. Table 10     LightCycler® Thermal Cycling Parameters for Real-time Multiplex PCR Amplification of Cyclospora and Eimeria spp.
  11. Table 11     Expected Results for Real-time Multiplex PCR Amplification of Cyclospora and Eimeria spp. by Melting Curve Analysis
  12. Table 12     Assay Conditions for the Nested Amplification of Cryptosporidium spp.
  13. Table 13     Evaluation of nested PCR Amplification and RFLP Analysis to Differentiate Cryptosporidium spp.  

  1. Materials and Equipment
    1. BagPage®+ filter bags (400 ml) and Bag Clips (Interscience, St Nom, France)
    2. Envirochek™ sampling capsule, 1 µm nominal (Pall Gelman Laboratory)
    3. Rocker platform
    4. Rotary shaker
    5. Rotating wheel
    6. 150 ml analytical filter units (Nalgene, Cat No. 130-4045)
    7. 25 mm disposable filter funnels (Whatman Biosciences)
    8. Dynal L10 tubes Prod. No. 740-03)
    9. Dynal MPC®-1 (Prod. No 120.01)
    10. Dynal MPC®-S (Prod. No 120.20)
    11. Vacuum manifold (Vac-Man® Laboratory Vacuum Manifold 20-sample capacity; Promega)
    12. FTA Filters, Classic Card of 960circle pre-printed card formats (Whatman Biosciences)
    13. Photo laminating sheets (Scotch®)
    14. Conical 250 ml centrifuge tubes
    15. Sorvall RT7 Plus refrigerated centrifuge or equivalent (to centrifuge 250 ml conical centrifuge tubes)
    16. Epi-illuminated Fluorescence Microscope-equipped with the following: UV 1A filter block (excitation Filter, EX 365/10; Dichroic mirror, DM 440; Barrier Filter, BA-400; or equivalent. Optics for differential interference contrast (DIC). For Cryptosporidium spp.: appropriate filter for viewing fluorescein isothiocyanate (FITC) conjugated oocysts. (Table 1)
    17. Glass microscope slides and cover slips
    18. Blotting paper
    19. Heating block for incubation at 56°C
    20. Single punch (6 mm diameter) hole puncher
    21. Thin-walled 0.65 ml PCR tube (PGC)
    22. ART pipette tips (Molecular BioProducts)
    23. PTC-200 DNA Engine (MJ Research) or comparable thermal cycler.
    24. Horizontal gel electrophoresis apparatus and power supply.
    25. Polaroid camera or digital imaging system to capture ethidium bromide-stained gels
    26. Polaroid Type 667 film
    27. UV Transilluminator
  2. Reagents
    1. Water
      1. Deionized water (for washing produce [dH2O])
      2. Sterile deionized water (for PCR procedure)
    2. Envirochek™ elution buffer (0.01M Tris, pH 7.4 ; 0.001 M EDTA; 1% SDS)
    3. Silicone vacuum grease
    4. Albumin, bovine (BSA) (Sigma, A-7030)
    5. Celite (Sigma, C-8656)
    6. Polyvinyl polypyrrolidone (PVPP) (Sigma, P-6755)
    7. NET buffer: 0.1 M Tris, pH 8.0, 0.15M NaCl, 0.001M EDTA
    8. NET-BSA buffer-NET buffer containing 1% (w/v) BSA
    9. 20% celite in NET-BSA buffer (w/v)
    10. 10% PVPP (w/v) in dH2O
    11. Dynabeads anti-Cryptosporidium Kit (Dynal Biotech Inc, USA)
    12. Hydrofluor Combo Detection Kit for Cryptosporidium and Giardia (Strategic Diagnostics, Inc.)
    13. 0.1 N HCl
    14. 0.1 N NaOH
    15. Immersion oil
    16. Clear fingernail polish, slide compound, paraffin wax or equivalent
    17. FTA Purification Buffer (Whatman Biosciences)
    18. FTA filter wash buffer: 0.01 M Tris, Ph 8.0; 0.1 mM EDTA
    19. DNA Primers-See Table 1 in PCR Section
    20. HotStartTaq™ Master Mix Kit (Qiagen)
    21. 0.5x Tris-acetate-EDTA buffer (0.5x TAE)
    22. Molecular biology-grade agarose (BioRad)
    23. Ethidium bromide
    24. 6x gel loading solution
    25. 100 bp and 25 bp DNA ladders (Invitrogen)
    26. Vsp I restriction endonuclease (Promega)
    27. Dra II restriction endonuclease (Hoffman-La Roche)
    28. NuSieve® 3:1 agarose (Biowhitaker Molecular Applications)
  3. Optional Reagents, Supplies, and Equipment
    1. LightCycler®-FastStart DNA Master SYBR Green I kit (Roche Diagnostics)
    2. LightCycler® Capillaries (Roche Diagnostics)
    3. LightCycler® System (Roche Diagnostics)
  4. Wash Procedure for Fresh Produce
    This procedure can be used to analyze for potential contaminants on fresh leafy produce (lettuce, herbs, etc) and berries (e.g. raspberries) and may be applicable to other fresh produce.
    1. Place produce to be analyzed (10-25 g of fresh leafy produce or 50g of fresh berries) in a BagPage®+ filter bag, add 100 ml dH2O and seal with Bag Clip.
    2. Place on rocker platform and gently agitate for 30 minutes at room temperature, inverting the bag after 15 minutes.
    3. Decant supernatant from the BagPage®+ filter bag into clean 50 ml conical centrifuge tubes and centrifuge for 20 minutes at 2,000xg.
    1. Isolation of Cyclospora from Fresh Produce Washes
      1. Aspirate supernatants (without disturbing debris pellets) to a volume not to exceed 45 ml when combined.
      2. Suspend pellets in remaining supernatants and combine.
      3. Add 2.5 ml 20% (w/v) celite in NET-BSA suspension (ensure that celite is thoroughly suspended prior to its addition to sample washes). Mix samples on a rotating wheel at room temperature for 15 minutes.
      4. Add 1.0 ml of 10% PVPP suspension (w/v). Mix samples on a rotating wheel at room temperature for 15 minutes.
      5. Prepare a 150 ml analytical filter unit by removing the membrane filter (0.45 µm or 0.2 µm) but retaining the grade 4 filter backing. Attach to a vacuum source.
      6. Pre-wet the analytical filter with a small volume (~10ml) of NET buffer.
      7. Decant celite/PVPP-containing sample wash into a prepared 150 ml analytical filter unit and vacuum filter. Ensure that the liquid passes through the filter septum to remove particulates and the celite particles from the suspension as it is filtered. The adsorbant celite should prevent filter clogging.
      8. Rinse the container with 10 ml NET to recover as much of the residual celite-containing sample and decant into the filter unit. Then rinse the celite and particulate material trap onto the filter with an additional 10 ml volume of NET.
      9. Prior to FTA filtration in step 4l, save ~10% of the filtered sample for microscopic examination.
      10. Prepare filter funnel unit(s) containing FTA filter disk and attach to vacuum manifold.
      11. Under vacuum, pre-wet the FTA filter assembly.
      12. Slowly decant filtrate from step 4i into filter funnel unit while under vacuum until entire sample has passed through FTA filter.
      13. In succession while filter funnel unit is still attached to vacuum manifold, rinse filter twice with 10 ml of FTA purification buffer and twice with 10 ml of FTA filter wash buffer.
      14. Remove filter funnel unit from vacuum manifold, disassemble unit and dry FTA filter disk on 56°C heating block.
    2. Isolation of Cryptosporidium spp. from Fresh Produce Washes
      1. Aspirate supernatants (without disturbing debris pellets) to a volume not to exceed 10 ml when combined.
      2. Suspend pellets in remaining supernatants and combine. NOTE: pellet volume should not exceed 0.5 ml packed volume as it will interfere with subsequent steps that employ immunomagnetic adsorption of Cryptosporidium oocysts.
      3. Follow directions accompanying Dynabead anti-Cryptosporidium Kit for immunomagnetic separation (IMS) of Cryptosporidium oocysts from fresh produce washes using recommend tubes and magnetic capturing devices.
      4. Elute captured Cryptosporidium oocysts in a 0.1 ml volume of 0.1N HCl for 5 minutes a room temperature.
      5. Neutralize acid eluates with 0.01 ml 1N NaOH. Save ~10% of the sample for microscopic examination.
      6. Dilute with 10 ml NET buffer.
      7. Proceed as in Section 4A, steps j-n.
  5. Isolation of Parasitic Contaminants from Juices, Cider and Milk
    This procedure can be used to analyze for contaminants in liquid samples such as orange juice, apple juice, apple cider, milk and milk products.
    1. Isolation of Cyclospora from Juices, Cider and Milk
      1. Adjust a 25 ml aliquot of liquid sample to pH 8.0.
      2. Add an equal volume of NET buffer and mix well.
      3. Proceed as in Section 4A, steps c-n
    2. Isolation of Cryptosporidium spp. from Juices, Cider and Milk
      A 10 ml volume of cider, juice or milk product is directly sampled by IMS using the Dynabead anti-Cryptosporidium Kit along with the recommend tubes and magnetic capturing devices as in Section 4B, steps c-f.
  6. Isolation of Parasitic Contaminants from Large Volumes of Water
    This procedure is designed to isolate contaminants from a designated water source (stream, river, reservoir, standing water, runoff, etc).
    1. Place a single Envirochek™ sampling capsule in line with the water source to be sampled. Ensure that the flow rate does not exceed the standards established by the manufacturer.
    2. Collect a water sample from 10 L of flow through.
    3. Remove contaminants captured by the filter using 125 ml of elution buffer. Filters should be treated with elution buffer, sealed and agitated on a rotating wheel (moderate speed) for at least 5-10 minutes following the manufacturer's recommendations. Decant filter rinse into a 250 ml conical centrifuge tube.
    4. Repeat step 6c and combine filter rinses.
    5. Centrifuge the sample at 1,500-2,000 x g for 20 minutes allowing the centrifuge to coast to a stop (do not use the brake)
    6. Proceed as described in Sections 4A and 4B for the isolation of Cyclospora and Cryptosporidium spp. respectively.
  7. Slide Preparation and Microscopic Analysis – Cyclospora cayetanensis

    Cyclospora oocysts emit a cobalt blue autofluorescence with the UV-1A emission filter or blue-green with broader emission spectra filters under ultraviolet illumination. Prepare slides in duplicate and examine slides under ultraviolet illumination as described below.

    Laboratories should use a microscope reticle capable of measuring organism in the 8-10 µm range to verify oocyst size when organisms are recovered. Compare morphological characteristics of presumptive oocysts to those in a known standard.

    1. Slide Preparation

      Centrifuge the volume set aside for microscopic analysis (Section 4A, step i), at 1,500 x g for 10-15 min at 4°C. Aspirate supernatant to within 0.5 ml of debris pellet. Uniformly suspend pellet material by gentle, repeated pipetting.

      1. Apply silicone vacuum grease to edge of cover slip
      2. Place 10 µl of suspended debris to a clean glass microscope slide and prepare a wet mount using pre-greased cover slip 
    2. Microscopy
      1. Examine slide under UV light at 400X magnification. Cyclospora oocysts autofluoresce cobalt blue. Examine slide at multiple planes under UV. Occasionally, debris in slide preparations make it difficult to only view the slide on one plane.
      2. Switch from epifluorescence microscopy to bright field microscopy or differential interference contrast microscopy. Determine oocyst size of any presumptive oocysts at 1000X magnification. Compare to standards. Confirm internal structures of presumptive Cyclospora oocysts as compared to a standard.
      3. Seal cover slips to the glass slides of presumptive positives with fingernail polish, slide compound or paraffin wax.
      4. Document presumed positive samples with photographs taken at multiple planes.
  8. Slide Preparation and Microscopic Analysis & Cryptosporidium spp.

    Microscopic examination of produce washings and other liquid samples for the presence of Cryptosporidium spp. oocysts will be conducted using commercially available immuno-magnetic bead separation (IMS) kits and immunofluorescence labeling kits.

    1. An aliquot (~10µl) of the IMS-derived sample Section 4B, step e, is FITC-labeled using the Hydrofluor Combo Detection Kit for Cryptosporidium and Giardia (Ensys Inc., Research Triangle Park, NC) per the manufacturer's instructions and examined in conventional DIC and epifluorescence mode. 
    Table 1: Parameters for Epifluorescence Microscopy

    INCIDENT LIGHT
    Light Source-Mercury Vapor
    200W, 100W, or 50W
    Excitation FilterDichroic FilterBarrier FilterRed Suppression Filter
    KP500TK510K510 or K530BG38
    FITCTK510K530BG38
    D. Tungsten-Halogen 50 and 100 W
    KP500TK510K510 or K530BG38
    FITCTK510K530BG38
    Taken from protocol provided with HYDROLFUOR-Combo Detection Kit for Giardia cysts and Cryptosporidium oocysts (Ensys Inc., Research Triangle Park, NC)
  9. PCR Analysis

    The molecular detection of Cyclospora spp. and Cryptosporidium spp. is independently accomplished using nested PCR protocols. The differential identification of Cyclospora cayetanensis from other closely related non-human pathogenic parasites (i.e. Eimeria spp.) employs a nested multiplex PCR assay. This assay can be accomplished using either a conventional thermal cycler with heated lid or a real-time PCR platform using the Roche LightCycler®.

    The detection of Cryptosporidium spp. also involves nested PCR amplification. However, differentiation and speciation of Cryptosporidium spp. requires further analysis by a restriction fragment length polymorphism (RFLP) assay. Please note the following: C. parvum genotype I has been renamed C. hominis; C. parvum genotype II (bovine strain) is now referred to as C. parvum

    1. DNA Primers

      Table 2: DNA Primer Sequences for Cyclospora-specific PCR Amplification
      Primer
      Designation
      Primer SpecificityPrimer Sequence
      (5'-3')
      Amplicon
      Size (bp)
      Designated
      Application
      F1E (forward)Cyclospora and Eimeria spp.TACCCAATGAAAACAGTTT636Primary Amplification
      R2B (reverse)CAGGAGAAGCCAAGGTAGG
       
      CC719 (forward)C. cayetanensisGTAGCCTTCCGCGCTTCG298Nested Amplification
       
      PLDC661 (forward)C. cercopitheci, C. colobi, C. papionisCTGTCGTGGTCATCGTCCGC361Nested Amplification
       
      ESSP841 (forward)Eimeria spp.GTTCTATTTTGTTGGTTTCTAGGACCA174Nested Amplification
       
      CRP999 (reverse)Cyclospora and Eimeria spp.CGTCTTCAAACCCCCTACTGTCG Nested Amplification
      All primer sequences were derived from the published sequences for the 18S rRNA genes of the respective organisms.

      Table 3: DNA Primer Sequences for Cryptosporidium Genus-specific PCR Amplification
      Primer
      Designation
      Primer SpecificityPrimer Sequence
      (5'-3')
      Amplicon
      Size (bp)
      Designated
      Application
      ExCry1 (forward)Cryptosporidium spp.GCCAGTAGTCATATGCTTGTCTC844Primary Amplification
      ExCry2 (reverse)ACTGTTAAATAGAAATGCCCCC
       
      NesCry3 (forward)Cryptosporidium spp.GCGAAAAAACTCGACTTTATGGAAGGG590-593Nested Amplification
      NesCry4 (reverse)GGAGTATTCAAGGCATATGCCTGC
      All primer sequences were derived from the published sequences for the 18S rRNA genes of the respective organisms.
       
    2. General Sample Preparations for Primary PCR Amplifications
      1. Punch marked triplicate areas (6 mm diameter) from dried FTA filter disk using a single punch hole-puncher. Decontamination of the hole-puncher is not necessary as cross contamination between samples from the hole-puncher has been found to be negligible. However, the individual researcher may wish to swab the punch with ethanol between sample disks if it is deemed appropriate.
      2. Insert filter punches snuggly into bottom of 0.65 ml thin-walled PCR tubes.
      3. Dispense 50 µl HotStartTaq™ Master Mix into each PCR tube.
      4. Prepare reagent master mix (see Table 4) with the appropriate forward and reverse DNA primers (see Tables 2 and 3) and dispense into each PCR tube.
      5. All PCR analyses must include positive and negative controls (see Table 5).
      6. Mix tubes with gentle tapping.
      7. Follow the appropriate thermal cycling protocol (Table 6 and 7) for primary PCR amplification.

        Table 4: General PCR Conditions for Primary PCR Amplification
        ComponentVolume (µl)*Final Concentration
        FTA Filter Disk (DNA Template)  
        HotStartTaq™ Master Mix50.0
        Reagent Master Mix
        MgCl2, 25 mM2.02.0
        Forward Primer, 10 µM2.00.2 µM
        Reverse Primer, 10 µM2.00.2 µM
        Sterile deionized water44.00 
        *100 µl total volume
        Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200 µM of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
        Final MgCl2 concentration is that contributed by both the HotStartTaq™ Master Mix and 25 mM MgCl2stock

        Table 5: Controls for PCR amplifications
        Control TypeCondition/Organism
        Negative Control-1Reagent blank-no filter
        Negative Control-2Reagent blank + unspotted, washed filter
         
        Positive Controls:
        Cyclospora Analysis:
        C. cayetanensis
        ‡¶Cyclospora spp. (NHP)
        *Eimeria spp.
         
        Cryptosporidium Analysis:
        C. hominis (formerly know as C. parvum genotype 1)
        C. parvum, (formerly know as C. parvum genotype II (Bovine)
        C. baileyi
        C. serpentis
        Whenever possible, positive control FTA filters should be spotted with at least 103 organisms
        Non-human primate-derived Cyclospora spp.
        Not routinely available.
        *Most available Eimeria spp. are suitable.

        Table 6: PCR Thermal Cycling Parameters for Cyclospora and Eimeria spp.
         StepNumber of CyclesTemperature and Time
        Primary PCRInitial Activation195°C; 15 min
        Amplification35Denaturation: 94°C; 30 sec
        Annealing: 53°C; 30 sec
        Extension: 72°C; 90 sec
        Final Extension172°C; 10 min
         
        Nested Multiplex PCRInitial Activation195°C; 15 min
        Amplification25Denaturation: 94°C; 15 sec
        Annealing: 66°C; 15 sec
        This is a stringent, 2-step amplification program (simultaneous annealing and extension at 66°C). Likewise, it does not require a final extension step.

        Table 7: PCR Thermal Cycling Parameters for Cryptosporidium spp.
         StepNumber of CyclesTemperature and Time
        Primary PCRInitial Activation195°C; 15 min
        Amplification40Denaturation: 94°C; 45 sec
        Annealing: 53°C; 75 sec
        Extension: 72°C; 45 sec
        Final Extension172°C; 7 min
         
        Nested PCRInitial Activation195°C; 15 min
        Amplification35Denaturation: 94°C; 25 sec
        Annealing: 65°C; 25 sec
        Extension: 72°C; 25 sec
        Final Extension172°C; 7 min
         
    3. Conventional Nested Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp.
      1. Dispense 25 µl of HotStartTaq™ Master Mix into each PCR tube.
      2. Prepare reagent master mix (Table 8) and dispense into all tubes
      3. Complete reaction samples with the addition of the desired volume (1-3 µl) of primary amplicon solution.
      4. Be sure to include all positive and negative controls as in the primary amplification reactions.
      5. Mix tubes with gentle tapping.
      6. Follow the appropriate thermal cycling protocol listed in Table 6.
         
      Table 8: Assay Conditions for the Conventional Nested Multiplex PCR Amplification of Cyclospora and Eimeria spp.
      ComponentVolume (µl)*Final Concentration
      HotStartTaq™ Master Mix25.0
      MgCl2, 25 mM1.02.0 mM
      CC719 (forward primer), 10 µM1.00.2 µM
      PDCL661 (forward primer), 10 µM1.00.2 µM
      ESSP841 (forward primer), 10 µM1.00.2 µM
      CRP999 (reverse primer), 10 µM1.00.2 µM
      Sterile deionized water19.00 
      DNA Template (primary amplicon)1.0 
      *50 µl total volume
      Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200 µM of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
      Final MgCl2 concentration is that contributed by both the HotStartTaq™ Master Mix and 25 mM MgCl2 stock.
       
    4. OPTIONAL-Real Time Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp. using the Roche LightCycler® System
      1. Place the requisite number of glass capillaries in a pre-chilled cooling block (with accompanying centrifuge adapters)
      2. Prepare a reagent master mix (Table 9) and dispense into individual 0.65 ml PCR tubes
      3. Complete reaction samples with the addition of the 1 µl of primary amplicon solution.
      4. Be sure to include all positive and negative controls as in the primary amplification reactions.
      5. Mix tubes with gentle tapping.
      6. Dispense reaction mixture into glass capillaries, cap, and centrifuge briefly (5-10 sec at 3000 rpm) in a bench-top microcentrifuge.
      7. Transfer glass capillaries to LightCycler® carousel.
      8. Follow the appropriate thermal cycling protocol for (Table 10 ).
      9. Real time confirmation of pathogen can be made by melting curve analyis (see Table 11)
      10. For final confirmation, samples can be recovered from each glass capillary.
      11. Uncap, invervet capillary into a 0.65 ml PCR tube containing 5 µl of gel loading solution, and briefly centrifuge (5-10 sec at 3000 rpm) in a bench-top microcentrifuge.
      12. Following instruction for agarose gel electrophoresis (Part 9, Section F, steps b-f)
         
      Table 9: Assay Conditions for the Real-time Nested Multiplex PCR Amplification of Cyclospora and Eimeria spp.
      ComponentVolume (µl)*Final Concentration
      LightCycler®-FastStart DNA Master SYBR Green2.0-
      MgCl2, 25 mM1.63.0 mM
      CC719 (forward primer), 10 µM1.00.5 µM
      PDCL661 (forward primer), 10 µM1.00.5 µM
      ESSP841 (forward primer), 10 µM1.00.5 µM
      CRP999 (reverse primer), 10 µM1.00.5 µM
      Sterile deionized water11.40-
      DNA Template (primary amplicon)1.0-
      *20 µl total volume

      Table 10: LightCycler® Thermal Cycling Parameters for Real-time Multiplex PCR Amplification of Cyclospora and Eimeria spp.
      StepNumber of CyclesTemperature and TimeComments
      Hot Start195°C; 10 min 
      Amplification30Denaturation: 95°C; 15 sec 
      Annealing: 66°C; 15 secSingle Fluorescence Acquisition
       
      Melting Curve Analysis195°C; 15 sec 
      65°C; 15 sec 
      98°C; 0.1°C/secContinuous Fluorescence Acquisition


      Table 11: Expected Results for Real-time Multiplex PCR Amplification of Cyclospora and Eimeria spp. by Melting Curve Analysis
      Primer
      Designation
      Primer SpecificityPrimer Sequence
      (5'-3')
      Amplicon
      Size (bp)
      Amplicon
      Tm (°C)
      CC719C. cayetanensisGTAGCCTTCCGCGCTTCG29885°C
      PLDC661C. cercopitheci, C. colobi, C. papionisCTGTCGTGGTCATCGTCCGC36191°C
      ESSP841Eimeria spp.GTTCTATTTTGTTGGTTTCTAGGACCA17481°C
       
    5. Nested PCR Amplification for the Differential Identification of Cryptosporidium spp.
      1. Dispense 25 µl of HotStartTaq™ Master Mix into each PCR tube.
      2. Prepare reagent master mix (Table 12) and dispense into all tubes
      3. Complete reaction samples with the addition of the desired volume (1-3 µl) of primary amplicon solution.
      4. Be sure to include all positive and negative controls as in the primary amplification reactions.
      5. Mix tubes with gentle tapping.
      6. Follow the appropriate thermal cycling protocol listed in Table 7.
         
      Table 12: Assay Conditions for Nested Amplification of Cryptosporidium spp.
      ComponentVolume (µl)*Final Concentration
      HotStartTaq™ Master Mix25.0
      MgCl2, 25 mM1.02.0
      NesCry3 (forward primer), 10 µM1.00.2 µM
      NesCry4 (reverse primer), 10 µM1.00.2 µM
      Sterile deionized water21.0 
      DNA Template (primary amplicon)1.0 
      *50 µl total volume
      Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200 µM of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
      Final MgCl2 concentration is that contributed by both the HotStartTaq™ Master Mix and 25 mM MgCl2 stock
       
    6. Agarose Gel Electrophoresis
      1. Mix 10 µl of nested amplification product with 2-3 µl of gel loading solution.
      2. Load samples into wells of a 1.5% agarose gel prepared with 0.5 x TAE containing 0.2 µg/ml ethidium bromide. Include at least one lane containing 100 bp DNA ladder to approximate the size of any amplicon present.
      3. Run the gel at 125 volts (constant voltage) for at least 30 min.
      4. PCR products on the agarose gel can be visualized by using a UV transilluminator. Photograph the gel to have a permanent record of the results using a Polaroid Type 667 film (or a digital system, if you decide to include that in the material & methods).
      5. The primary amplicon from primer pair F1E/R2B for Cyclospora PCR may not be visible; therefore, only product from the nested reaction should be electrophoresed.
      6. Predicted sizes of PCR amplicons from Cyclospora spp., Eimeria spp. and Cryptosporidium spp. are listed in Tables 1 and 2
    7. Restriction Fragment Length Polymorphism (RFLP) Analysis of Cryptosporidium spp. Nested PCR Amplicons to Determine the Presence of C. parvum Oocysts and Distinguish C. hominis from C. parvum
      1. A 590 bp (genotype I) or a 593 bp product (genotype II) following nested PCR is a presumptive positive for the presence of Cryptosporidium spp.
      2. The restriction patterns resulting from the digestion of the nested amplicon with restriction endonucleases VspI and DraII will distinguish between C. parvum and C. hominis (VspI digestion) and C. parvum from C. baileyi and C. sepentis (DraII digestion). 
      3. Combine 15 µl of the Cryptosporidium nested PCR amplicon with on unit VspI, 2.0 µl of 10x enzyme buffer, and 0.2 µl BSA solution (include with enzyme). Adjust final volume to 20 µl with sterile dH2O.
         
      4. For digestion with DraII, combine 15 µl of the Cryptosporidium nested PCR amplicon with one unit DraII, 2.0 µl of 10x enzyme buffer, and adjust final volume to 20 µl. 
      5. Positive controls for C. parvum and other species of Cryptosporidium must be digested in the same manner and alongside test samples. 
      6. Incubate digestion samples for at least 2 hr at 37°C. 
      7. Analyze samples by gel electrophoresis using a 3% NuSieve gel prepared with 0.5x TAE and 0.2% ethidium bromide. 
      8. Mix 10-15 µl of nested amplification product with 2-3 µl of gel loading solution and load into wells of gel. Include at least one lane containing 25 bp DNA ladder to estimate the size of restriction fragments present. 
      9. Run the gel at 125 volts (constant voltage) for at least 45 min. 
      10. RFLP patterns can be visualized on the agarose gel by using a UV transilluminator. Photograph the gel to have a permanent record of the results using a Polaroid Type 667 film (or a digital system). 
      11. Predicted banding patterns confirmatory for the presence of Cryptosporidium spp. are listed in Table 13.
         
      Table 13: Evaluation of Nested PCR Amplification and RFLP Analysis to Differentiate Cryptosporidium spp.
      OrganismPCR AmpliconRFLP Digestion Products (bp)
      Primary (bp)Nested (bp)VspIDraII
      C. hominis (formerly C. parvum, genotype I)844593503 and 90-
      C. parvum (formerly C. parvum, genotype II) 840590--
      C. baileyi831579-295 and 284
      C. serpentis836583-298 and 284
      C. muiris----
      C. wrairii----
      Indistinguishable within an agarose gel
       
  1. References
    • Centers for Disease Control. 1997. Outbreak of cyclosporiasis--Northern Virginia- Washington D.C.-Baltimore, Maryland, Metropolitan area, 1997. Morbid. Mortal. Weekly Rep. 46:689-691.
    • Centers for Disease Control. 1998. Update: outbreak of cyclosporiasis--Ontario Canada, May 1998. Morbid. Mortal. Weekly Rep. 47:806-809.
    • Eberhard, M.L., A.J. da Silva, B.G Lilley, and N.J. Pieniazek. 1999. Morphological and molecular characterization of new Cyclospora species from Ethiopian monkeys: C. cercopitheci sp.n., C. colobi sp.n., and C. papionis sp.n. Emerg. Infect. Dis. 5:651-658.
    • Herwaldt, B.L. 2000. Cyclospora cayetanensis: a review, focusing on the outbreaks of cyclosporiasis in the 1990's. Clin. Inf. Dis. 31:1040-1057.
    • Herwaldt, B.L., M.-L. Ackers, and the Cyclospora Working Group. 1997. An outbreak in cyclosporiasis associated with imported raspberries. N. Engl. J. Med. 336:1548-1556.
    • Herwaldt, B.L., M.J. Beach and the Cyclospora Working Group.1997. The return of Cyclospora in 1997: another outbreak of cyclosporiasis in North America associated with imported raspberries. Ann. Intern. Med. 130:210-220.
    • Ho, A.Y., A.S. Lopez, M.G. Eberhart, R. Levenson, B.S. Finkel, A.J. da Silva, et al. 2002 Outbreak of cyclosporiasis associated with imported raspberries, Philadelphia, Pennsylvania, 2000. Emerg. Inf. Dis. 8:783-788.
    • Jinneman, K.C., J.H. Wetherington, W.E. Hill, A.M. Adams, J.M. Johnson, B.J. Tenge, N-L. Dang, R.L. Manger, and M.M. Wekell. 1998. Template preparation for PCR and RFLP of amplification products for the detection and identification of Cyclospora sp. and Eimeria spp. oocysts directly from raspberries. J. Food Prot., 61:1497-1503.
    • Jinneman, K.C., J.H. Wetherington, W.E. Hill, C.J. Omiescinski, A.M. Adams, J.M. Johnson, B.J. Tenge, N-L. Dang, R.L. Manger, and M.M. Wekell. 1999. An oligonucleotide-ligation assay for the differentiation between Cyclospora and Eimeria spp. polymerase chain reaction amplification products. J. Food Prot., 62:682-685.
    • Koumans, E.H.A. D.J Katz, J.M. Malecki, S. Kumar, S.P. Wahlquist, M.J. Arrowood, et al. 1998. An outbreak of cyclosporiasis in Florida in 1995: a harbinger of multistate outbreaks in 1996 and 1997. Am J. Trop. Med. Hyg. 59:235-242.
    • Lopez, A.S., D.R. Dodson, M.J. Arrowood, P.A. Orlandi, A.J. da Silva, J.W. Bier, et al. 2001. Outbreak of cyclosporiasis associated with basil in Missouri in 1999. Clin. Infec. Dis. 32 :1010-1017.
    • Lopez, F.A., J. Manglicmot, T.M. Schimidt, C.Yeh, H.V. Smith, and D.A. Relman. 1999. Molecular characterization of Cyclospora-like organisms from baboons. J. Infect. Dis. 179:670-676.
    • Orlandi, P.A. and K.A. Lampel. 2000. Extraction-free, filter-based template preparation for the rapid and sensitive PCR detection of pathogenic parasitic protozoa. J. Clin. Microbiol. 38:2271-2277.
    • Orlandi, P.A., D.-M. T. Chu, J.W. Bier, and G.J. Jackson. 2002. Parasites and the food supply. Food Technology 56:72-81.
    • Orlandi, P.A., L. Carter, A.M. Brinker, A.J. da Silva, K.A. Lampel, and S.R. Monday. 2003. Targeting single nucleotide polymorphisms in the 18S rRNA gene to differentiate Cyclospora spp. and Eimeria spp. by multiplex PCR. Appl. Environ Microbiol. Submitted for publication.
    • Ortega, Y., C.R. Roxas, R.H. Gilman, N.J. Miller, L. Cabrera, C. Taquiri, and C.R. Sterling. 1997. Isolation of Cryptosporidium parvum and Cyclospora cayetanensis from vegetables collected in markets of an endemic region in Peru. Am. J. Trop Med. Hyg. 57:683-686.
    • Ortega, Y., C.R. Sterling, R.H. Gilman, V.A. Cama, and F. Diaz. 1993. Cyclospora species-a new protozoan pathogen of humans. N. Engl. J. Med. 328:1308-1312.
    • Ortega, Y., R.H. Gilman, and C.R. Sterling. 1994. A new coccidian parasite (Apicomplexa:Eimeriidae) from humans. J. Parasitol. 80:625-629.
    • Pieniazek, N.J. and B.L. Herwaldt. 1997. Reevaluating the molecular taxonomy: is human-associated Cyclospora a mammalian Eimeria species? Emerg. Inf. Dis. 3:381-383.
    • Relman, D.A., T.M. Schmidt, A. Gajadhar, M. Sogin, J. Cross, K. Yoder, O. Sethabutr, and P. Echeverria. 1996. Molecular phylogenetic analysis of Cyclospora, the human intestinal pathogen, suggests that it is closely related to Eimeria species. J. Infect. Dis. 173:440-445.
    • Sherchand, J.B., J.H. Cross, M. Jimba, S. Sherchand, M.P. Shrestha. 1999. Study of Cyclospora cayetanensis in health care facilities, sewage water and green leafy vegetables in Nepal. Southeast Asian J. Trop. Med. Public Health 30:58-63.
    • Slifko, T.R., H.V. Smith, and J.B. Rose. 2000. Emerging parasite zoonoses associated with water and food. Int. J. Parasitol. 30:1379-1393.
    • Sturbaum, G.D., Y.R. Ortega, R.H. Gilman, C.R.Sterling, L. Cabrera, and D. Klein. 1998. Detection of Cyclospora cayetanensis in wastewater. Appl. Environ. Microbiol. 64:2284-2286.
    • Sturbaum, G.D., C. Reed, P.J. Hoover, B.H. Jost, M.M. Marshall, and C. R. Sterling. 2001. Species-specific, nested PCR-restriction fragment length polymorphism detection of single Cryptosporidium parvum oocysts. Appl. Environ. Microbiol. 67:2665-2668.
    • Wurtz, R. 1994. Cyclospora: a newly identified intestinal pathogen of humans. Clin. Inf. Dis.18:620-623.
    • Yoder, K.E., O. Sethabutr, and D.A. Relman. 1996. PCR-based detection of the intestinal pathogen Cyclospora, pp. 169-176. In D.H. Persing (ed.), PCR protocols for emerging infectious diseases, a supplement to diagnostic molecular microbiology: principles and applications. ASM Press, Washington, DC.