Food

BAM: Diarrheagenic Escherichia coli

 

February 2011, updated June 2016

Bacteriological Analytical Manual
Chapter 4A
Diarrheagenic Escherichia coli

Authors: Peter Feng, Stephen D. Weagant (ret.), Karen Jinneman

Revision History:

  • August 2016: The Lightcycler method has been archived and replaced with the AB 7500 Fast platform.  Extensive Modifications to Section K: Screening method for E. coli Serotype O157:H7/STEC from Foods; Section L: Equipment and Materials; Section M: Media and Reagents, Section N: Sample Preparation and Enrichment Procedure, and Section O: Real-time PCR Screening.
  • November 2015: Section R: The 13-plex Luminex suspension array: STEC Molecular Serotyping and Virulence Profiling Protocol replaces the 11-plex STEC Molecular Serotyping Protocol, which will be archived, when reagents for the 13-plex assay becomes available. The new Luminex based suspension array can now identify 11 clinically relevant STEC O serogroups and detect two STEC adherence factor genes: eae and aggR.
  • July 2014: Section N: A new sample preparation for leafy produce (except cilantro and parsley) has been added; the sample preparation for cilantro and parsley has been modified.
  • July, 2013: Section R: STEC Molecular Serotyping Protocol: Luminex-based suspension array to identify 11 STEC O serogroups has been added.
  • December 2012: Section R: The testing for non-O157 STEC has been changed from optional to required. All samples that are PCR positive for Stx1 and Stx2 but negative for uidA, must be followed up with additional testing to isolate the STEC organism. In Section R.1.a. the SHIBAM agar has been added to facilitate the isolation of STEC from enrichment samples.
  • February 2011: Section M: Addition of primers in Table 2; Section Q: addition of 5P Multiplex PCR for confirmation of O157:H7 isolates
  • July 2009: Section M modified to include the real-time PCR screening method

Escherichia coli is one of the predominant species of facultative anaerobes in the human gut and usually harmless to the host; however, a group of pathogenic E. coli has emerged that causes diarrheal disease in humans. Referred to as Diarrheagenic E. coli (28) or commonly as pathogenic E. coli, these groups are classified based on their unique virulence factors and can only be identified by these traits. Hence, analysis for pathogenic E. coli often requires that the isolates be first identified as E. coli before testing for virulence markers. The pathogenic groups includes enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), diffusely adherent E. coli (DAEC) and perhaps others that are not yet well characterized (21, 28). Of these, only the first 4 groups have been implicated in food or water borne illness. Some properties and symptoms of these 4 subgroups are discussed below and summarized in Table 1.

ETEC is recognized as the causative agent of travelers' diarrhea and illness is characterized by watery diarrhea with little or no fever. ETEC infections occurs commonly in under-developed countries but, in the U.S., it has been implicated in sporadic waterborne outbreaks as well as due to the consumption of soft cheeses, Mexican-style foods and raw vegetables. Pathogenesis of ETEC is due to the production of any of several enterotoxins. ETEC may produce a heat-labile enterotoxin (LT) that is very similar in size (86 kDa), sequence, antigenicity, and function to the cholera toxin (CT). ETEC may also produce a heat stable toxin (ST) that is of low molecular size (4 kDa) and resistant to boiling for 30 min. There are several variants of ST, of which ST1a or STp is found in E. coli isolated from both humans and animals, while ST1b or STh is predominant in human isolates only. The infective dose of ETEC for adults has been estimated to be at least 108 cells; but the young, the elderly and the infirm may be susceptible to lower levels. Because of its high infectious dose, analysis for ETEC is usually not performed unless high levels of E. coli have been found in a food. Also, if ETEC is detected, levels should also be enumerated to assess the potential hazard of the contaminated food. Production of LT can be detected by Y-1 adrenal cell assays (28) or serologically by commercial reverse passive latex agglutination assay and ELISA (see Appendix 1). The production of ST can also be detected by ELISA or by infant mouse assay (35). Both LT and ST genes have also been sequenced and PCR (37, 41) and gene probe assays (see chapter 24) are available. Analysis of colonies on plating media using gene probe/colony hybridization also allows enumeration of ETEC in foods.

EIEC closely resemble Shigella and causes an invasive, dysenteric form of diarrhea in humans (7). Like Shigella, there are no known animal reservoirs; hence the primary source for EIEC appears to be infected humans. Although the infective dose of Shigella is low and in the range of 10 to few hundred cells, volunteer feeding studies showed that at least 106 EIEC organisms are required to cause illness in healthy adults. Unlike typical E. coli, EIEC are non-motile, do not decarboxylate lysine and do not ferment lactose, so they are anaerogenic. Pathogenicity of EIEC is primarily due its ability to invade and destroy colonic tissue. The invasion phenotype, encoded by a high molecular weight plasmid, can be detected by invasion assays using HeLa or Hep-2 tissue culture cells (7, 25) or by PCR and probes specific for invasion genes (see chapter 24).

EPEC causes a profuse watery diarrheal disease and it is a leading cause of infantile diarrhea in developing countries. EPEC outbreaks have been linked to the consumption of contaminated drinking water as well as some meat products. Through volunteer feeding studies the infectious dose of EPEC in healthy adults has been estimated to be 106 organisms. Pathogenesis of EPEC involves intimin protein (encoded by eae gene) that causes attachment and effacing lesions (14); but it also involves a plasmid-encoded protein referred to as EPEC adherence factor (EAF) that enables localized adherence of bacteria to intestinal cells (36). Production of EAF can be demonstrated in Hep-2 cells and the presence of eae gene can be tested by PCR assays (28).

EHEC are recognized as the primary cause of hemorrhagic colitis (HC) or bloody diarrhea, which can progress to the potentially fatal hemolytic uremic syndrome (HUS). EHEC are typified by the production of verotoxin or Shiga toxins (Stx). Although Stx1 and Stx2 are most often implicated in human illness, several variants of Stx1 and Stx2 exist. There are many serotypes of Stx-producing E. coli (STEC), but only those that have been clinically associated with HC are designated as EHEC. Of these, O157:H7 is the prototypic EHEC and most often implicated in illness worldwide (3, 13, 19, 28). The infectious dose for O157:H7 is estimated to be 10 - 100 cells; but no information is available for other EHEC serotypes. EHEC infections are mostly food or water borne and have implicated undercooked ground beef (3, 13), raw milk (31), cold sandwiches (19), water (34), unpasteurized apple juice (2) and sprouts and vegetables (4, 17). EHEC O157:H7 are phenotypically distinct from E. coli in that they exhibit slow or no fermentation of sorbitol and do not have glucuronidase activity (see chapter 4. LST-MUG for details); hence, these traits are often used to isolate this pathogen from foods. The production of Stx1 and Stx2 can be tested by cytotoxicity assays on vero or HeLa tissue culture cells or by commercially available ELISA or RPLA kits (see Appendix 1). Gene probes (see chapter 24) and PCR assays specific for stx1 and stx2 and other trait EHEC markers are also available (12, 15) (and see below).

Table 1. Some properties and symptoms associated with pathogenic E. coli subgroups.
Properties/Symptoms ETEC EPEC EHEC EIEC
Toxin LT/STa - Shiga or Vero toxin
(Stx or VT)
-
Invasive - - - +
Intimin - + + -
Enterohemolysin - - + -
Stool Watery Watery, Bloody Watery, very bloody Mucoid, bloody
Fever Low + - +
Fecal leukocytes - - - +
Intestine involved Small Small Colon Colon, lower small
Serology Various O26, O111 & others O157:H7, O26, O111 & others Various
IDb High High Low High

a LT, labile toxin; ST, stable toxin.
b ID, infective dose.

Isolation and Identification of Pathogenic Escherichia coli
- Except EHEC of serotype O157:H7

Since pathogenic E. coli are identified based on its unique virulence properties, the analytical procedure for these pathogens in foods generally requires the isolation and identification of the organisms as E. coli before testing for the specific virulence traits. Following is a general procedure for enrichment and isolation of pathogenic E. coli from food (25).

A. Equipment and materials

  1. Balance, ≥ 2 kg with 0.1 g sensitivity
  2. Blender, Waring or equivalent model with low speed operation at 8000 rpm, with 1 liter glass or metal jar
  3. Incubators, 35 ± 0.5°C and 44 ± 1°C
  4. Petri dishes 20 × 150 mm
  5. Pipets, Pasteur
  6. pH test paper, range 6.0-8.0

B. Media

  1. Tryptone phosphate (TP) broth (M162)
  2. Brain heart infusion (BHI) broth (M24)
  3. Levine's eosin-methylene blue (L-EMB) agar (M80)
  4. MacConkey agar (M91)
  5. Triple sugar iron (TSI) agar (M149)
  6. Blood agar base (BAB) (M21)
  7. Tryptone (tryptophane) broth (M164)
  8. Bromcresol purple broth (M26) supplemented individually with 0.5% (w/v) of each: glucose, adonitol, cellobiose, sorbitol, arabinose, mannitol, and lactose
  9. Urea broth (M171)
  10. Lysine decarboxylase broth, Falkow (M87).
  11. Potassium cyanide (KCN) broth (M126)
  12. MR-VP broth (M104)
  13. Indole nitrite medium (tryptic nitrate) (M66)
  14. Acetate agar (M3)
  15. Mucate broth (M105)
  16. Mucate control broth (M106)
  17. Malonate broth (M92)
  18. Koser's citrate broth (M72)

C. Reagents, inorganic, organic, and biological

  1. Sodium bicarbonate solution, 10%, aqueous (sterile) (R70)
  2. ONPG (o-nitrophenyl-β-D-galactopyranoside) disks (R53)
  3. Phosphate buffered saline solution, (sterile) (PBS) (R60), or Butterfield's Phosphate-buffered dilution water (BPBW) (R11).
  4. Kovac's reagent (R38)
  5. VP reagents (R89)
  6. Oxidase test reagent (R54)
  7. Nitrite detection reagents (R48)
  8. Mineral oil, heavy sterile (R46)
  9. Gram stain reagents (R32)

D. Enumeration.

Refrigerate samples promptly after receipt. Do not freeze except to hold frozen products until just prior to analysis. Analyze samples as soon as possible. If enumeration is required, prepare a homogenate of 25 g in 225 mL of PBS or BPBW. Perform decimal dilutions (in PBS or BPBW) from the homogenate and direct plate onto MacConkey agar to yield isolated colonies. After incubating the plates for 20 h at 35°C, perform colony lifts and hybridization with specific gene probes for virulence genes (see chapter 24). This enumeration procedure is most effective if E. coli constitutes at least 10% of the microbial growth on isolation agars and it is present at a level of >1,000 cells/g.

E. Enrichment for Pathogenic E. coli

The approach recommended here permits qualitative determination of the presence of pathogenic E. coli. Aseptically weigh 25 g of sample into 225 ml of BHI broth (dilution factor of 1:10). If necessary, sample size may deviate from 25 g depending on availability of the sample, as long as the diluent is adjusted proportionally. Blend or stomach briefly. Incubate the homogenate for 10 min at room temperature with periodic shaking then allow the sample to settle by gravity for 10 min. Decant medium carefully into a sterile container and incubate for 3 h at 35°C to resuscitate injured cells. Transfer contents to 225 mL double strength TP broth in a sterile container and incubate 20 h at 44.0 ± 0.2°C. After incubation, streak to L-EMB and MacConkey agars. Incubate these agars for 20 h at 35°C.

F. Selection.

Typical lactose-fermenting colonies on L-EMB agar appear dark centered and flat, with or without metallic sheen. Typical colonies on MacConkey agar appear brick red. Lactose non-fermenting biotypes on both agars produce colorless or slightly pink colonies.

NOTE: EIEC do not ferment lactose and there may also be atypical non-lactose fermenting strains in the other pathogenic E. coli groups; therefore, as many as 20 colonies (10 typical and 10 atypical) should be picked for further characterization.

G. Conventional Biochemical Screening and identification (8, 30)

Use the procedures described in Chapter 4 for biochemical and morphological identification of E. coli. However, because many enteric bacteria can also grow in the TP enrichment broth, plus anaerogenic, non-motile and slow or lactose non-fermenting strains of E. coli must also be considered, additional tests may need to be performed. Some of these new or modified reactions are discussed here.

  1. Primary screening. Transfer suspicious colonies to TSI agar, BAB slant, tryptone broth, arabinose broth, and urea broth. Incubate 20 h at 35°C. Reject H2S-positive, urease-positive, arabinose non-fermenting, and indole-negative strains. To test for the ONPG reaction, suspend growth from TSI in 0.85% saline to give detectable turbidity. Add an ONPG-impregnated disk and incubate 6 h at 35°C. Yellow color indicates positive reaction. Reject ONPG-negative, aerogenic cultures. Some Alkalescens-Dispar strains (i.e., anaerogenic Escherichia) are ONPG-negative.
  2. Secondary screening (48 h incubation at 35°C unless otherwise specified). To identify cultures, test additional reactions shown in Table 1, Chapter 4, to subdivide Escherichia spp. Since it is not known whether these additional species are of pathogenic significance to humans, strains giving typical reactions for E. coli should be further investigated. To differentiate E. coli from Shigella, examine anaerogenic, non-motile, slow lactose fermenters for lysine decarboxylase, mucate, and acetate reactions. Shigella sonnei, which may grow in the same enrichment conditions, is anaerogenic and non-motile. It also produces a negative indole reaction and shows slow or non-fermentation of lactose. The biochemical-physiological characteristics of E. coli are summarized in Table 2, chapter 4.
  3. Alternatively, use API20E or the automated VITEK biochemical assay to identify the organism as E. coli.

H. Tests for Enterotoxigenic E. coli (ETEC)

When E. coli levels in foods exceed 104 cells/g, perform enumeration for ETEC by colony hybridization analysis using DNA probes for LT and ST (Chapter 24). If biological activity assays are necessary, LT can be detected by the Y-l tissue culture test (28) and ST can be detected by the infant mouse test (28) (For detailed procedures of these assays, see Chapter 4, BAM, Edition 8, Revision A /1998). There are also commercially available RPLA and ELISA tests to detect LT and ST toxins as well as PCR assays (41).

I. Tests for Enteroinvasive E. coli (EIEC)

If an isolate is suspected to be EIEC, the invasive potential of the isolates may be tested by the Sereny test or the Guinea pig keratoconjunctivitis assay (28) (For detailed procedures on Sereny test, see Chapter 4, BAM, Edition 8, Revision A /1998). Invasive potential of the isolates can also be determined by the HeLa tissue culture cell assay as described (25), or with the in vitro staining technique using acridine orange to stain intracellular bacteria in HeLa monolayers (26). Alternatively, since the invA gene sequence of EIEC closely resembles that of Shigella, DNA probe and PCR assays for inv gene of Shigella will also work for EIEC.

Caution: Since both EIEC and Shigella will give positive probe and PCR reactions, it is critical that the organisms are identified first as E. coli.

J. Tests for Enteropathogenic E. coli (EPEC)

EPEC strains are identified based on 3 key traits: attachment and effacing lesion (A/E), localized adherence on cells and the lack of Shiga toxin (Stx) production. This last trait is also used to distinguished strains of EPEC from EHEC. Phenotypically, A/E and localized adherence are tested using Hep-2 or HeLa tissue cells. Absence of Stx can be determined using tests outlined for EHEC (see below). There are also PCR and probes for the EAF plasmid that encodes for localized adherence and the eae gene that encodes for the intimin that causes the A/E phenotype. Caution: There are several variants of eae gene and some EPEC strains carry eae variants identical to EHEC serotypes; hence, these tests will detect strains from both pathogenic groups. For specific virulence assays for EPEC, see Nataro and Kaper, 1998 (28) for detailed procedures.

K. Screening method for E. coli Serotype O157:H7 from Foods

In the previous eBAM, food samples may be screened for O157:H7 using either the SmartCycler II or LightCycler® 2.0 platforms (17, 18, 42). These methods used modified Buffered Peptone Water with pyruvate (mBPWp), which contained several anti-microbial reagents that effectively suppressed normal flora growth and non-target competitors, yet allowed the growth of viable O157:H7 cells (including other STEC) and is capable of detecting <1 cfu/g in foods. Improved recovery of pathogenic E. coli from difficult matrices such as salad mixes and sprouts was achieved with the mBPWp enrichment (32, 38).

The real-time PCR assay configured for the SmartCycler II platform (17, 18, 42), is specific for the stx1 and stx2 genes and the +93 single nucleotide polymorphism in the uidA gene that encode for the β-D-glucuronidase (GUD) enzyme (11). The +93 SNP is highly conserved in O157:H7 and O157:H- strains that produce Stx and is an accurate identification marker for O157:H7 strains (9). The stx1 and stx2 markers on the real-time PCR assays also enabled the detection of other STEC strains, some of which are known human pathogens (see Section R).

Since these assays had been implemented, some have noted that occasionally, the +93 uidA target does not come up as positive or are very late positives (high Ct values), especially in samples that contained high generic E. coli levels. Generic E. coli do not have the +93 uidA SNP, so will not be detected by the +93 uidA probe, but it does have the uidA gene, and so will be amplified by the PCR primers. We speculate that high levels of generic E. coli in the sample may be depleting the reagents and thereby affecting the outcomes of some of the delicate targets, like the uidA SNP. To rectify this problem, primers specific for the wzy gene of the O157 antigen was used as an alternative to the +93 uidA SNP for testing for O157:H7. The O157 wzy primers were combined with the same stx1 and stx2 primers and the assay was also formatted to use the AB7500 platform, which has high-throughput capacity. Although the O157 wzy primers will detect all O157 serogroup strains, including non-H7 strains that are not STEC or pathogenic, many of these strains may be suppressed by the selective enrichment medium and therefore, not impact the outcome of the PCR assay. The premise of detecting both stx and O157 markers in a sample is a fairly good indication that O157:H7 strains may be present. The AB7500 assay was validated for various foods by the FERN labs.

With the approval of the BAM Council and the FDA MMVA, the LightCycler method in Chap. 4a was archived and replaced with the ABI7500 assay, which also has the capability for high-throughput analytical testing.

It should be cautioned, that when using multiplex PCR assays to test mixed culture samples, such as food or environmental enrichment broths, it is not unusual to see instances where the various targets detected are not from a single strain, but from different isolates. Hence, is critical that PCR positive samples are confirmed to show that all targets (stx and O157) are within the same isolate. Confirmation, involves plating PCR-positive samples onto differential agars to isolate the strain and test it by biochemical, serological and genetic assays. If PCR results are positive for stx only, follow the procedure in Section R. for STEC isolation. It is advisable that isolates are tested again by PCR for stx1 and stx2 genes to confirm their toxigenic potential.

NOTE: If users do not have access to real-time PCR equipment, follow procedure in Section P for cultural enrichment and isolation.

L. Equipment and materials

  1. Balance, 1-500 g with 0.1 g sensitivity
  2. Sterile glass jars for enrichment
  3. Optional: Stomacher with appropriate plastic bags for 250 ml vol.
  4. Large resealable plastic bags to accommodate 200 g of product (for analysis of leafy produce)
  5. Incubators: 36°C ± 1°C and 42°C ± 1°C
  6. Petri dishes 20 × 150 mm
  7. Microcentrifuge tubes (0.5 to 2.0 mL)
  8. Conical centrifuge tubes (50.0 mL)
  9. Micropipettors (e.g., 0.5-20 µL, 20-200 µL, 200-1000 µL)
  10. Microcentrifuge (capable of spinning at 15000 × g)
  11. Pipets (1 to 10 ml volume)
  12. Pipet tips (0.2 to 1000 µl volume) (aerosol resistant tips)
  13. Vortex Mixer
  14. Filter Paper
  15. Waterbath or heat block capable of maintaining 100°C.
  16. SmartCycler II PCR thermolcycler (Cepheid, Sunnyvale, CA) capable of performing cycling parameters described below and simultaneous real-time sequence detection for FAM, TET, Texas Red and Cy5 dyes.
  17. SmartCycler PCR reaction tubes (minimum reaction volume of 25 µl) and racks compatible with PCR thermolcycler
  18. Applied Biosystems 7500 Fast Real-time PCR thermocycler (SDS version 1.4) (Applied Biosystems, Thermo-Fisher Scientific Brand)
  19. AB 7500 Fast Plates (AB# 4346906)
  20. Optical Adhesive Film for 7500 Fast Plates (AB# 4311971)
  21. 8-well strips; alternative tp plates (AB# 4311971)
  22. Appropriate ABI 7500 Fast Plate Holder (specific for 96-well tray or 8-strip well tubes)
  23. Ice bucket and ice
  24. Sterile tongs
  25. Gloves

M. Media and Reagents

  1. Modified Buffered Peptone water with pyruvate (mBPWp) and Acriflavin-Cefsulodin-Vancomycin (ACV) Supplement (M192a)
  2. STEC/O157 primers and probes listed in Tables 2 and 3 are specific to real-time PCR platform being used.
    1. Primers - 10 µM working solution of each primer listed in Table 2 or 3. Stock and Working solutions can be prepared from commercially synthesized primers with basic desalt purification (Fisher/Genosys or equivalent) by rehydrating with sterile distilled water to appropriate concentrations. Store at -20°C to ‑70°C in a non-frost-free freezer.
    2. Probes - 10 µM working solution of each probe listed in Tables 2 or 3. Dual Hybridization Probes should be purchased as RP HPLC-purified and labeled as indicated in Tables 2 and 3. Stock and working solutions can be prepared from commercially synthesized probes with molecular grade sterile distilled water. Working solutions should be aliquoted in small amounts and stored frozen (-20 to -70°C) and away from light until use to avoid fluorophore degradation.

    3. Exogenous Internal Amplification Control (IAC)

      Smart Cycler Platform: (IAC) Full length sequence as described in U.S. Patent Application 0060166232: cgcatgtggt cacagccctg acgaagctgt catcaagttc ataatgacat cgatatgggt gccgttcgag cagtttagcc ctaaatcacc ctaccggcag acgtatgtca cattcaccag ggagacgcat gagattggat gctgttgtgc gccctcaaca atgtaacgaa tggctgcatc gtctcgcgaa tattgtcgta ccatcatctg acttggctca tgtctgcaag aggcttcgca ctgggctttatg

      Prepare a stock solution of the IAC DNA sequence from commercially synthesized product and titer to a stock solution where a known amount will reliably provide a Ct between 25-35 PCR cycles.

      NOTE: Alternatively the primers, probes and IAC internal control assay components are also available as a lyophilized bead product for use on the SmartCycler II orIAC full length template (BioGX, Birmingham, AL).

      Table 2. Primer/probe sequences for use on SmartCycler II platform.
      Primers1 GenBank # Bases 5' → 3' Sequence
      Stx1F934 M19473 26 gTg gCA TTA ATA CTg AAT TgT CAT CA
      Stx1R1042 M19473 21 gCg TAA TCC CAC ggA CTC TTC
      Stx2F1218 X07865 24 gAT gTT TAT ggC ggT TTT ATT TgC
      Stx2R1300 X07865 26 Tgg AAA ACT CAA TTT TAC CTT Tag CA
      UidAF241 AF305917 21 CAg TCT ggA TCg CgA AAA CTg
      UidAR383 AF305917 22 ACC AgA CgT TgC CCA CAT AAT T
      IAC55F2   17 ATg ggT gCC gTT CgA gc
      IAC186R2,3   19 Cga gaC gAT gCa gCC aTT C
      Probes1 GenBank # Bases 5' → 3' Sequence
      stx1P990 M19473 31 TxRd-TgA TgA gTT TCC TTC TAT gTg TCC ggC AgA T-BHQ2
      stx2P1249 X07865 25 6FAM-TCT gTT AAT gCA ATg gCg gCg gAT T-BHQ1
      UidAP266 AF305917 15 TET-ATT gAg CAg CgT Tgg-MGB/NFQ
      ICP-Cy52   26 Cy5- TCT CAT gCg TCT CCC Tgg TgA ATg Tg-BHQ2

      1 Primer/Probe name composed of target gene (stx1, stx2 or uidA), forward primer (F), reverse primer (R) or probe (P), 5' base position of oligonucleotide in the respective gene sequence specified in column 2
      2,3 IAC primers and probes are covered by U.S. Patent Application 0060166232 and sited in: Nordstrom, et al. 2007. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Appl. Environ. Microbiol. 73:5840-5847 (14); and Angelo DePaola, et al. 2010. Bacterial and Viral Pathogens in Live Oysters: 2007 United States Market Survey. Appl. Environ. Microbiol. 76:2754-2768 (15).

      AB 7500 Fast Platform: TaqMan® Exogenous Internal Positive Control (Applied Biosystems, Carlsbad, CA. #4308323)

      Table 3. Primer and probe sequences for use on the AB 7500 Fast platform.
      Primers1 GenBank # Bases 5' 3' Sequence
      stx1F934 M19473 26 gTg gCA TTA ATA CTg AAT TgT CAT CA
      stx1R1042 M19473 21 gCg TAA TCC CAC ggA CTC TTC
      Stx2F1218 X07865 24 gAT gTT TAT ggC ggT TTT ATT TgC
      Stx2R1300 X07865 26 Tgg AAA ACT CAA TTT TAC CTT Tag CA
      wzyF1831 AF061251 24 CTC gAT AAA TTg CgC ATT CTA TTC
      wzyR1936 AF061251 23 CAA TAC ggA gAg AAA Agg ACC AA
      Probes1 GenBank # Bases 5' 3' Sequence
      stx1P990 M19473 31 Cy5-TgA TgA gTT TCC TTC TAT gTg TCC ggC AgA T-BHQ2
      stx2P1249 X07865 25 TAMRA-TCT gTT AAT gCA ATg gCg gCg gAT T-BHQ2
      wzyP1881 AF305917 25 6FAM - ACT TAg Tgg CTg ggA ATg CAT Cgg C – BHQ1
      1 Primer/Probe name composed of target gene (stx1, stx2 or uidA), forward primer (F), reverse primer (R) or probe (610LC, 670LC, 705LC, or FL P), 5' base position of oligonucleotide in the respective gene sequence specified in column 2.
  3. Real-time PCR additional reagents depending on real-time platform being used:
    1. SmartCycler II Platform - OmniMix-HS or SmartMix HM PCR Reagent Beads (Cepheid, Sunnyvale, CA. Also available through Fisher).
    2. AB 7500 Fast Platform - Express qPCR Supermix Universal Taq (Invitrogen, Carlsbad, CA. #11785200)
  4. Tellurite Cefixime – Sorbitol MacConkey Agar (TC-SMAC) (M194)
  5. Chromogenic selective agar:
    R&F® E. coli O157:H7 agar (R&F Laboratories, Downers Grove, IL), prepared according to manufacturer instructions. Rainbow® Agar O157 (BIOLOG, Hayward, CA) prepared according to manufacturer instructions for high background flora (contains 10 mg/L novobiocin plus 0.8 mg/L potassium tellurite).
  6. Levine's Eosin-Methylene Blue (L-EMB) agar (M80) (Section R only)
  7. Trypticase Soy Agar with Yeast Extract (TSAYE) (M153).
  8. Butterfield's Phosphate Buffer (R11) (pH 7.2 ± 0.2. Sterilize by autoclaving)
  9. Sterile distilled water, molecular grade water or equivalent
  10. Physiological saline (0.85% NaCl)
  11. Kovac's Reagent (R38)
  12. ColiComplete Discs - fluorogenic MUG substrate for GUD and chromogenic X-gal for GAL (BioControl, Bellevue, WA)
  13. Anti-O157 and anti-H7 latex reagent (ThermoScientific Remel 4, Lenexa, KS, or equivalent)
  14. API20E or VITEK GNI (BioMerieux, St. Louis, MO).
  15. STEC heart infusion washed blood agar with Mitomycin-C (SHIBAM) (M195)

N. Sample Preparation and Enrichment Procedure

  1. Sample Preparation
    1. Leafy Produce (except cilantro and parsley) – to 200g of sample, add 450 ml of 1× mBPWp. Do not blend or stomach.
    2. Cilantro and parsley –  to 25g of sample, add 225 ml of 1× mBPWp. Do not blend or stomach.
    3. Juice, milk or other turbid beverage samples – aseptically centrifuge 200 ml of sample at 10,000 × g for 10 min. After decanting the supernatant, resuspend the pellet material in 225 ml of mBPWp.
    4. Bottled water or other non-turbid liquids – weigh 125 ml into 125 ml of 2× mBPWp. Also, use this approach with liquids in which a visible pellet would not be produced after centrifugation.
    5. All other foods – weigh 25 g of food into 225 ml of mBPWp. Blend or stomach briefly as necessary.
  2. Enrichment
    Incubate homogenate at 37°C ± 1°C static for 5 hours, then add 1ml each of the ACV supplements per 225 ml of mBPWp (see Section M2) and incubate at 42°C ± 1 °C static overnight (18-24 h).

Enrichment Control Strains - 465-97 USDA (stx1-, stx2- uidA+). Alternatively, use ATCC43890 (stx1+, stx2-, uidA+), ATCC 43888 (stx1-, stx2- uidA+) or equivalent if 465-97 is not available. NOTE: these strains do not have both stx genes and should not be used as controls in PCR.

OPTIONAL: When O157:H7 contamination is suspected, particularly in foods with high levels of competing microbial flora, such as sprouts or raw meats, the use of immunomagnetic separation (IMS) prior to screening can be helpful. Several IMS procedures are available, including Dynabeads® anti-E.coli O157 (ThermoFisher Scientific, Waltham, MA) and Pathatrix Immunocapture system E.coli O157 kit (ThermoFisher Scientific, Waltham, MA) and some of these have been tested on selected foods. Perform IMS on the 5 hr or overnight enrichment (depending on the IMS system used). From the final IMS bead suspension (approximately 100 µl), plate and assay by real-time PCR as described below in section O. For specific details on performing IMS on enrichment samples, contact: Karen Jinneman, FDA-PRLNW (karen.jinneman@fda.hhs.gov)

O. Real-time PCR Screening

Real-time PCR assembly and data analysis protocols are described below for two instrument platforms; SmartCycler II and AB 7500 Fast. Contact: Karen Jinneman, FDA-PRLNW (karen.jinneman@fda.hhs.gov)
Use of other platforms and protocols must first be validated. Alternately, if equipment and/or reagents are not available for real-time PCR screening of enrichment broths, refer to section P for cultural analysis of all enrichments.

  1. DNA Template Preparation:
    1. Transfer 1ml of overnight enrichment to a microcentrifuge tube and centrifuge 12,000 × g for 3 min.
    2. Remove supernatant and completely resuspend pellet in 1 ml 0.85% NaCl.
    3. Centrifuge 12,000 × g for 3 min.
    4. Remove supernatant and completely resuspend pellet in 1 ml sterile water.
    5. Place in waterbath or heat block capable of maintaining 100°C for 10 min.
    6. Centrifuge 12,000 × g for 1 minute, remove and save supernatant as DNA template (This may be frozen, minimum -20 °C, for future PCR tests).
    7. Make a 1:10 dilution of this template and use 1 µl for testing by real time-PCR.
    8. For pure cultures (including control cultures), 1 ml of broth culture or colony growth from agar plate suspended in 0.85% saline maybe prepared as in steps a-g above. Templates may be frozen at minimum -20°C for future use.
  2. PCR Controls:
    1. For a positive PCR control include template prepared from E. coli O157:H7, such as ATCC strain 43895 (EDL 933) or ATCC strain 43894 both possessing all three gene targets (stx1+, stx2+ and uidA+).
    2. If no internal amplification control is incorporated into the reaction, prepare a reaction tube including 1 µl of a 1:10 dilution of EDL 933 control template and 1 µl of a 1:10 dilution of the food sample enrichment template.
    3. Always include a no template (water) negative control tube in every run.
  3. Smart Cycler II - Reaction assembly and data analysis protocol:
    1. Prepare a PCR Master Mix from the reaction components and final concentrations for STEC/O157 listed in Table 4. Keep all thawed reagents and reactions on ice. Alternatively a PCR Master Mix may be prepared by following package insert for STEC/O157 CSR bead and OmmiMix HS or SmartMix HM bead.
    2. Add 24 µl of Master Mix to each SmartCycler tube and cap loosely.
    3. Add 1 µl of sample or control template and snap cap tightly.
    4. Briefly centrifuge to bring all liquid to bottom of tube and place in thermalcycler.
    5. Create a "run" on SmartCycler II. Give each run a unique run name, select Dye set FTTC25, select 2-step PCR protocol as described below and assign appropriate sites on SC block.
      Step Criteria
      Initial Activation 60 sec at 95°C
      40 cycles 10 sec at 94°C, (optics off)
      40 sec at 63°C, (optics on)
    Table 4. Smart Cycler II Protocol Amplification Reaction Components1
    Volume/rxn Component Final Concentration
    qsi to 25 µl 2 Sterile Distilled Water  
    0.625 µl Primer stx1F934 (10 µM Work Solution) 0.25 µM
    0.625 µl Primer stx1R1042 (10 µM Work Solution) 0.25 µM
    0.625 µl Primer stx2F1218 (10 µM Work Solution) 0.25 µM
    0.375 µl Primer IAC55F (10 µM Work Solution) 0.15 µM
    0.625 µl Primer stx2R1300 (10 µM Work Solution) 0.25 µM
    0.625 µl Primer uidAF241 (10 µM Work Solution) 0.25 µM
    0.625 µl Primer uidAR383 (10 µM Work Solution) 0.25 µM
    0.375 µl Primer IAC186R (10 µM Work Solution) 0.15 µM
    0.375µl Probe stx1PTxRd990 (10 µM Work Solution) 0.15 µM
    0.0625 µl Probe stx2PFAM1249 (10 µM Work Solution) 0.025 µM
    0.25 µl Probe uidAPTET-MGB266 (10 µM Work Solution) 0.1 µM
    0.375 µl Probe ICPCy5 (10 µM Work Solution) 0.15 µM
      IAC Template DNA3  
    0.5 bead OmniMix-HS or SmartMix-HS  
    1-5 µl Template (Sample or control)  
    1 All primers, probes, and IC DNA primers and probes are lyophilized in the STEC/O157 CSR Bead
    2 Appropriate amount of sterile distilled water is added depending on sample template volume being used.
    3 Full length (252 bp) internal control nucleic acid molecule as described in U.S. Patent Application 0060166232. The amount of IAC template needs to be adjusted based on the prepared stock concentration to report Cycle threshold at about 25-35 PCR cycles when no inhibition is present in the reaction.

     

    Qualitative data analysis
    On the SmartCycler II Instrument, set the following Analysis Settings for FAM, TET, TxRd and Cy5 channels (32). Update analysis settings if they are changed before recording results.

    NOTE: Internal Control (IC) cycle threshold (Ct) is CSR Lot specific (Ct = 25-35). If Ct is consistently not present for the IC (Cy5, channel 4) target in the negative control tube only at 15 fsu, contact method authors. Lot specific recommendations for Cy5 manual threshold setting may be issued.

    1. Usage: Assay
    2. Curve Analysis: Primary
    3. Threshold Setting: Manual
    4. Manual Threshold Fluorescence Units: 15.0
    5. Auto Min Cycle: 5
    6. Auto Max Cycle: 10
    7. Valid Min Cycle: 3
    8. Valid Max. Cycle: 60
    9. Background subtraction: ON
    10. Boxcar Avg. Cycles: 0
    11. Background Min. Cycle: 5
    12. Background Max. Cycle: 40

    Primary fluorescence curves that cross the threshold will be recorded as "POS" and the cycle number when it crossed the threshold will be displayed in the Results Table view (Figure 1A). Negative results are shown as "NEG". The FAM, TET, TxRd and Cy5 channels correlate to stx2, +93 uidA, stx1 and IC targets, respectively. Results can also be viewed graphically. For example, Figure 1B is a graphical view for the four channels for isolate E. coli O157:H7 strain EDL 933 that carries all 3 targets.

    Figure 1. Example of result output from Smart Cycler II. A. Results viewed in table form, B. Graphical representation of results.

    A. Results table view
    Example of result output from Smart Cycler II. Results viewed in table form

    B. Results graphical view
    Example of result output from Smart Cycler II. A. Graphical representation of results

    1. AB 7500 Fast (SDS ver.1.4)
      1. Reaction Assembly:
        1. Prepare a Master Mix containing all of the components and final concentrations for STEC O157 listed in Table 5 (below).
        2. Aliquot 28 µl or Master Mix to each reaction tube.
        3. Add 2µl sample or control template for a final volume to 30 µl
        4. Cap tubes or seal plate carefully to avoid we-to-well contact.
        5. Briefly centrifuge 8-strip tubes or 96-well plates in appropriate instrument to bring contents to bottom of tube.
        6. Place tubes into AB 7500 Fast Instrument. NOTE: Ensure appropriate tube is used for 96-well plate or 8-strip well.
          Table 5. AB 7500 Fast E. coli O157/STEC Reaction Components
          Volume/rxn Component Final Concentration
          0.75 µl Primer stx1F934 (10 µM Work Solution) 0.25 µM
          0.75 µl Primer stx1R1042 (10 µM Work Solution) 0.25 µM
          0.75 µl Primer stx2F1218 (10 µM Work Solution) 0.25 µM
          0.75 µl Primer stx2R1300 (10 µM Work Solution) 0.25 µM
          0.90 µl Primer wzyF1831 (10 µM Work Solution) 0.25 µM
          0.90 µl Primer wzyR1936 (10 µM Work Solution) 0.25 µM
          0.60 µl Probe stx1P990 Cy5  (10 µM Work Solution) 0.20 µ M
          0.45 µl Probe stx2P1249 TAMRA (10 µM Work Solution) 0.15 µM
          0.45 µl Probe wzyP1881 FAM (10 µM Work Solution) 0.15 µM
          3.00 µl Internal Positive Control Primer/Probe Mix1  
          0.60 µl IPC DNA1  
          15 µl Express qPCR Supermix Universal2  
          0.06 µl ROX dye2  
          3.04 µl Molecular Grade Water  
          2.0 µl Template (Sample or control)  
          30 µl Total Reaction Volume  
          1 Included in TaqMan® Exogenous Internal Positive Control Kit (Applied Biosystems, Carlsbad, CA. #4308323).
          2 Included in Express qPCR Supermix Universal Taq (Invitrogen, Calrsbad, CA. #11785200).
        7. Create new document on AB 7500 Fast (SDS ver. 1.4).
          1. Give each run a unique name
          2. Define run parameters including
            Assay: Standard Curve (Absolute Quantitation)
            Container: 96-Well Clear
            Run Mode: Fast 7500
          3. From the select detectors window highlight and add appropriate detectors for the E. coli assay as follows. Note assigning color assists in quick visual interpretation of results. (If detectors have not already been created, make it use the "New Detector" option in the new document wizard on the AB7500 instrument.)
            Parameter Settings for Detectors
            Target Name Reporter Quencher Color
            stx1 Cy5 (none) Red
            stx2 TAMRA (none) Blue
            wzy FAM (none) Green
            IPC VIC (none) Black
          4. Select ROX as the Passive Reference dye then "Finish" to create the document.
          5. The next screens will be used to set up sample plate.
          6. In the "Plate" tab, highlight sites to be used, right-click and use well inspector to associate all four detectors with each site.
          7. Highlight individual sample sites and type in sample information.
          8. After sample information is entered, click on "Instrument tab".
          9. Input the instrument settings for the E. coli O157/STEC assay to the following: Stage 1: 95.0 °C; 1 min
            Stage 2: 45 cycles
                  Step 1: 94°C; 10 sec
                  Step 2: 63°C; 40 sec
            Sample Volume: 30 µL
            Run Mode: Fast 7500
            Date Collection: Stage 2, Step 2, (63.0@0:40)
          10. When finalized, "Start" run.
          11. When prompted, click the "Save and Continue" button.
          12. Save SDS file as per local laboratory protocol. Run time is approximately 1 h.

           

          Qualitative data analysis and viewing results on the AB 7500 fast

          1. From the "Results" tab, select "Analysis". then from the dropdown menu then "Analysis Settings"
          2. Set "Analysis Settings" for all detectors to:
            Manual Ct Threshold of 0.05
            Manual Baseline is set to cycles 3 and 15 and click the "OK" button.
          3. "Analyze" the run from the "Analyze" option on the "Analysis" dropdown menu.
          4. View the Ct results on the Results Plate, by selecting "Display" and then "Ct" from the "Analysis" dropdown menus.image3"Report" tab view.

         


        Figure 1. Example of result output from AB7500 Fast. a. "Plate tab V=view, b. "Component" tab view, c. "Amplification Plot" view, and d. "Report" view.

        "Plate" tab view.

        BAM Chapter 4A: AB7500 Plate tab view Figure a

        "Component tab" view.

        BAM Chapter 4A: AB7500 Plate tab view Figure b

        "Amplification Plot" view

        BAM Chapter 4A: AB7500 Plate tab view Figure c

        "Report" view.

        BAM Chapter 4A: AB7500 Plate tab view Figure d

        Interpretation of real-time PCR Results (Smart Cycler II and AB17500)
        Ensure that for each run the PCR positive control is positive for all gene specific targets; IC may be positive or negative for a valid result and PCR negative control is negative for all specific gene targets and positive for IC component. Interpret samples as follows:

        Negative samples:
        All three targets – stx1, stx2, and +93 uidA SNP or O157 (wzy)depending on instrument platform used are "negative" (no Ct value) and the internal control (IC) is positive, indicating that the reactions worked correctly. Sample is negative, no further analysis is needed.

        Probable positive O157 samples:
        NOTE: With the SmartCycler assay, if the +93 uidA SNP or O157 target (wzy) is positive by itself or in combination with positive stx1, stx2 or both. Go to sec. P for culture isolation and confirmation of E. coli O157: H7. Be aware that there are O157 non-H7 strains that will also be positive with the O157 target (wzy), but these will be negative with the +93 uidA SNP.

        NOTE: With the SmarCycler assay, if the +93 uidA SNP target (wzy) is negative but either or both stx1 and stx2 are positive, it is possible that the +93 uidA SNP target was not effectively amplified above background, perhaps due to high generic E. coli levels in the sample. Continue with section P for isolation of E. coli O157:H7 in parallel with isolation of non-O157 STEC as described in section R.

        Probable positive STEC samples:
        If the +93 uidA SNP target or the O157 target (wzy) are is negative but stx1 and stx2 are positive, the sample may contain a non-O157 STEC. See sec. R, for additional information and isolation procedure.

        NOTE: It is possible to have an IC negative when one or more gene targets are positive, as the amplification of the target genes may out-compete the IC for available reagents. In those cases, the analysis is still valid as long as the amplification of the target gene has crossed the threshold to indicate successful PCR. Continue to section P or R for isolation of O157:H7 or STEC, respectively. However, if all the target genes are negative as well as the spiked food control or IC, it invalidates the PCR analysis. Troubleshoot the reaction and rerun the assay or streak enrichments as decribed in section P.


        The Screening method for E. coli Serotype O157:H7/STEC from Foods on the Light Cycler 2.0 Instrument Platform is available here. (NOTE: Archived Content)


    P. Cultural Isolation and Presumptive Isolate Screening.

    For overnight enrichment samples that are found probable positive by the real-time PCR assay, cultural confirmation is required. Similarly, for samples that have not been screened by real-time PCR follow these procedures for culture isolation.

    1. Isolation procedure.
      1. Serially dilute the overnight sample enrichment in Butterfield's phosphate buffer (R11) and spread-plate appropriate dilutions (usually 0.05 mL of 10-2 and 10-4 dilutions should yield approximately 100-300 isolated colonies) in duplicate onto TC-SMAC and one chromogenic agar (Rainbow® Agar O157 or R&F® E. coli O157:H7 agar). Optionally, a streak plate may also be included.
      2. Incubate plates at 37°C ± 1°C for 18 - 24 h. On TC-SMAC. typical O157:H7 colonies are colorless or neutral/gray with a smoky center and 1-2 mm in diameter. Sorbitol-fermenting bacteria such as most E. coli appear as pink to red colonies. On Rainbow® Agar O157 or R&F® E. coli O157:H7 agar, E. coli O157H7 colonies should appear as black to blue-black colonies.

        Figure 3. Appearance of typical E. coli O157:H7 on TC-SMAC, Rainbow® Agar O157 and R&F® E. coli O157:H7 agars.

        Typical E. coli O157:H7 colonies on selective agars (TC-SMAC, Rainbow Agar O157, R&F E. coli O157:H7

      3. Screen typical colonies by picking a portion of each isolated suspect colony from the isolation agar and testing for O157 antigen by latex agglutination (Remel kit).
      4. Pick all typical colonies that screen positive (up to 10, if >10 are present) from isolation agars and streak onto TSAYE plates to check for purity.
      5. Place a ColiComplete (CC) disc (BioControl, Bellevue, WA) in the heaviest streak area on the TSAYE plate. Prepare a similar TSAYE plate using a known MUG-positive E. coli strain as positive control. Incubate the plates 18-24 h at 37°C ± 1°C. CC has a chromogenic assay for galactopyranosidase (X-gal) and a fluorogenic assay for glucuronidase (MUG) on the same disc. The positive control should show blue color on and around the disc (indicative for coliforms) and blue fluorescence around the disc under long wave UV (365 nm) light (indicative of E. coli). Strains of O157:H7 are X-gal (+) but MUG (-).

        Figure 4. Results of ColiComplete (CC) disc for E. coli and E. coli O157:H7

        E. coli and E. coli O157:H7 are X-gal positive and produce a blue color surrounding the CC disc
        Appearance of CC disc under UV (365nm) light. E. coli O157:H7 is glucuronidaseare (MUG) negative with no flouresence, other E. coli are MUG positive and fluoresce. (L - E coli O157:H7, R - E. coli)

      6. Spot Indole Test: Spot growth from TSAYE plate to a filter wetted with Kovac's reagent. E. coli O157:H7 are indole positive.

        Figure 5. Indole positive result of typical E. coli O157:H7.

        E. coli O157:H7 Reaction on Rapid Indole Test

    Q. Isolate Confirmation Tests

    1. For typical colonies shown to be X-gal positive, MUG negative and indole positive, perform the following confirmation tests from the isolated colony on TSAYE.
      1. Confirm the presence of the O157 and H7 antigens using commercial antisera and following manufacturer's instructions. RIM E. coli O157:H7 Latex Test (Thermo-Scientific, Remel, Lenexa, KS, 800-255-6730) or equivalent, gives satisfactory results.

        NOTE: If the isolate is O157 and H7 positive, it is evidence that the isolate is of the O157:H7 serotype. But if the isolate is O157 (+) but H7 (-), proceed with confirmation steps below, as it may be a non-motile variant (O157:NM), hence needs to be tested by PCR to determine its toxigenic potential. The isolate can also be subcultured to blood agar to induce motility and the H7 reaction retested.

        Caution: Be sure to test the isolate with the control latex provided with the kit, to rule out the possibility of autoagglutinating strains of E. coli that will react with both reagents. Also, do not use H7 latex reagent without testing 1st with the O157 reagent as other non-O157 E. coli serotypes can also carry the H7 antigen.

        Figure 6. Typical E. coli O157:H7 latex agglutination result.

        Typical E. coli O157:H7 latex agglutination result. Arrows point to O157 antigen, H7 antigen, and Control latex

      2. Test O157 and H7 positive strains with API20E or VITEK to identify as E. coli.

        NOTE: An isolate that is sorbitol (-), indole (+), MUG (-), serologically (+) for O157 and H7 and is identified as E. coli is a confirmed positive for E. coli O157:H7.

      3. Isolates that have been confirmed to be O157:H7 as well as isolates that are O157 (+) but H7 (-), need to be retested to verify their toxigenic potential. There are several assays that can be used: the real-time PCR assay (Smart Cycler II or LightCycler 2.0) used in screening the enrichment and 2 conventional PCR assays. One of these PCR assays is detailed in LIB 3811 and detects only stx1 and stx2 (11). When using the LIB 3811, increase annealing temperature to 59°C and reduce extension time to 1 min. The other is 5P multiplex PCR that simultaneously assays for stx1, stx2, the +93 uidA SNP as well as 2 other O157:H7 virulence factors: the enterohemolysin (ehxA) genes and gamma (γ) intimin (eae) allele, which is found mostly in O157:H7 and few other serotypes (12). The 5P protocol is described below. For additional details, contact Peter Feng, CFSAN,(240-402-1650).

        5P Multiplex PCR for confirmation of O157:H7 isolates

        1. The primer sequences and the expected sizes of the amplicons from 5P PCR are shown in Table 7.
        2. For positive control, use DNA from an O157:H7 strain, such as EDL933 or any other O157:H7 strain that is known to carry all 5 gene targets.
        3. Prepare a 10× primer master mix containing 2000 nM concentrations of each of the 10 primers. Primer master mix may be stored frozen at -20°C. Use 5 µL per 50 µL reaction volume volume to yield a final use concentration of 200 nM for each primer.
        4. Use growth from the TSAYE plate in step Q.1 to prepare DNA templates for PCR analysis. Prepare DNA template by resuspending a colony or a small loopful of growth from TSAYE in 100 µl of water. Mix and heat for 5 min in a boiling water bath. Spin in a microcentrifuge to pellet debris. Use 2 µL of supernatant per reaction. Templates may be stored frozen at -20°C.
        5. The 50 µL PCR mix contain 1× Taq Polymerase buffer (Qiagen, Valencia, CA), 3 mM MgCl2, 250 µM of dNTP, 2 µL of crude DNA template, 1× primer master mix, 3.75 U of HotStarTaq (Qiagen) and sterile water. The PCR conditions are: 95ºC for 15 min; then 25 cycles, each cycle consisting of: 95ºC for 1 min, 56ºC for 1 min and 72ºC for 1 min and a 72ºC for 5 min final extension. Examine amplicons on agarose gel (1%) electrophoresis in 1× TBE (Tris-borate-EDTA) buffer pH 8.2. Expected results are shown in Fig. 1.7

        Table 7. 5P PCR primer sequences and expected amplicon sizes

        Gene Primer Sequence Amplicon
        stx1 LP30 5' - CAGTTAATGTGGTGGCGAAGG - 3' 348 bp
          LP31 5' - CACCAGACAATGTAACCGCTG - 3'  
        stx2 LP43 5' - ATCCTATTCCCGGGAGTTTACG - 3' 584 bp
          LP44 5' - GCGTCATCGTATACACAGGAGC - 3'  
         
        +93 uidA PT-2 5' - GCGAAAACTGTGGAATTGGG - 3' 252 bp
          PT-3 5' - TGATGCTCCATCACTTCCTG - 3'  
         
        γ - eaeA AE22 5'- ATTACCATCCACACAGACGGT - 3' 397 bp
          AE20-2 5'- ACAGCGTGGTTGGATCAACCT - 3'  
         
        ehxA MFS1Fb 5'- GTTTATTCTGGGGCAGGCTC - 3' 166 bp
          MFS1R 5'- CTTCACGTCACCATACATAT - 3'  

        Figure 7. Agarose gel of 5P PCR amplicons. The samples are:
        1. O157:H7 and 2. generic E. coli (negative control).

        Agarose gel of 5P PCR amplicons. The samples are:  1. O157:H7 and 2. generic E. coli (negative control)

        NOTE: The 2 conventional PCR assays use stx primer sequences that are distinct from those used in the real-time PCR and therefore, confer added verification that the isolate carries stx genes.

        NOTE: An O157:H7 and O157:NM isolate that carry stx are considered pathogenic. However, an O157:NM strain that does not carry stx or other EHEC virulence factors is probably non-pathogenic. There are many E. coli O157 serotypes that carry other than H7 antigen (ie: H3, H12, H16, H38, H45, etc), and these often do not carry EHEC virulence factors. But, NM variants of these have been isolated (10).

      4. Further isolate strain characterization should be done by Pulsed Field Gel Electrophoresis (PFGE). Use standardized PulseNet PFGE protocols to subtype all E. coli O157:H7 and O157:NM strains (1).

    R. Screening method for non-O157 STEC

    Both the stx1 and stx2 genes and allelic forms of these genes are carried by ~ 300 STEC serotypes, but many of these have not been implicated in illness and may be found in the intestinal flora of healthy humans. Be aware that the real-time PCR assay, described in section O, will detect these STEC strains as well. So, a +93 uidA (-) but stx1 and/or stx2 (+) real-time PCR result is only indicative that the sample possibly contains an STEC, but should not be interpreted that it is a pathogenic STEC.

    As a group, EHEC, are a subset of STEC and comprised of pathogenic strains, of which O157:H7 is the prototypic strain (seropathotype A) (20). There are several well known EHEC strains that have caused illness worldwide, ie: O26, O111, O121, O103, O145, O45, etc (seropathotype B).  In the past, FDA regulatory position has focused only on O157:H7, however, the presence of any pathogenic STEC in products regulated by the agency are of concern, so it is essential to isolate the STEC for additional testing to discern EHEC from STEC strains that have not been implicated in illness and may not be pathogenic. The following section describes isolation and confirmation procedures for non-O157 STEC and provides follow up guidance when STEC are detected.

    NOTE: The enrichment procedure and real-time PCR screening assay described in sections N and O have also been validated for detection and recovery of other non-O157 STEC as well. Refer to sections K-O for necessary equipment, media and reagents, sample preparation, enrichment and real-time PCR screening procedures.

    1. Isolation procedure.

      For overnight enrichment samples that are found probable positive for STEC (Positive for one or both of the stx gene targets) by the real-time PCR assay, cultural confirmation is required. Similarly, for samples that have not been screened by real-time PCR due to lack of instrumentation, follow these procedures for culture isolation.

      1. Serially dilute the overnight sample enrichment in Butterfield's phosphate buffer (R11) and spread-plate appropriate dilutions (usually 0.05 mL of 10-2 and 10-4 dilutions should yield approximately 100-300 isolated colonies) in duplicate onto L-EMB agar (M80) and a chromogenic agar as described in section P. Optionally, a streak plate may also be included.

        An additional agar, STEC heart infusion washed blood agar with Mitomycin-C (SHIBAM) (M195), could also be included (Lin et al., 2012). SHIBAM combines modifications to Beutin’s Washed Sheep's Blood Agar from Sugiyama et al. (2001), (addition of Mitomycin C) and Kimura et al. (1999), (optimal washed blood and base agar) to better isolate shiga toxin producing E. coli. Most STECs produce enterohemolysin and appear hemolytic on SHIBAM plates and are easily distinguishable from background microbiota (Fig. 9). Be aware that some E. coli produce α-hemolysin, which is distinct from the STEC enterohemolysin. On blood agar plates, colonies of E. coli strains that produce α-hemolysin show a large clear zone of hemolysis (Fig. 10, right), which is distinct from that of enterohemolysin (Fig. 9). SHIBAM may be prepared (M195) or purchased from Hardy Diagnostics (Catalog #A146).

      2. Incubate plates at 37°C ± 1°C for 18 - 24 h. On L-EMB, typical E. coli colonies appear as dark centered and flat, with or without a metallic sheen.  On SHIBAM, STEC colonies will appear grey to off-white and flat, with or without a clear zone of hemolysis ranging from narrow to several mm. (Figure 9).
      3. Pick typical E. coli colonies from L-EMB and hemolytic colonies on SHIBAM (up to 10 total) and streak plate onto TSAYE with CC (see Section P.1.e.). E. coli will be X-gal (+), but may be MUG (+) or (-).

        NOTE: There are some atypical E. coli that do not ferment lactose and will not give typical colonies on lactose based medium like L-EMB and appear X-gal (-) with CC. Eg: some STEC O121:H19 have shown this phenotype. If the rt-PCR screening assay is positive for stx genes, but typical colonies from differential agars have not been confirmed as STEC, it is advisable to pick a few atypical colonies as well from L-EMB and streak to TSAYE + CC. Regardless, of X-gal and MUG reactions, test isolates with indole spot test and by real-time PCR for the stx genes. Continue with confirmation tests in section R.2.

      4. Test X-gal positive isolates with the Spot Indole Test (Section P.1.f.).

         

        Figure 8. Typical apperance of E. coli colonies on L-EMB agar

        Typical apperance of E. coli colonies on L-EMB agar

         

        Figure 9. Typical appearance of hemolytic STEC on SHIBAM among background microbial flora from cilantro. Photo taken illuminated on light box to highlight hemolysis.

        BAM 4A. Figure 9. Typical appearance of hemolytic STEC on SHIBAM among background microbial flora from cilantro. Photo taken illuminated on light box to highlight hemolysis.

         

        Figure 10. Typical appearance of a hemolytic O45 STEC strain (left) and a non-pathogenic E. coli (ATCC 8739) (right) on SHIBAM. Photos taken illuminated on light box to highlight hemolysis. Please note: ATCC 25922 is hemolytic on SHIBAM (most likely due to α-hemolysin).

        Typical appearance of a hemolytic O45 STEC strain on SHIBAM.Typical appearance of a non-pathogenic E. coli (ATCC 8739) on SHIBAM.

         

        Figure 11. Example of hemolysis on SHIBAM caused by an E. coli strain carrying the alpha-(α)hemolysin (α-hly) gene. Note that the zone of hemolysis is wider than that seen with strains that carry the enterohemolysin gene (Figures 9 and 10). α-hemolysin is often found in uropathogenic E. coli and in certain ETEC, EPEC and STEC strains.

        Figure 11.  Example of hemolysis on SHIBAM caused by an E. coli strain carrying the alpha-(α)hemolysin (α-hly) gene.

    2. Isolate Confirmation Tests

      Confirm isolates that appear as typical E. coli on L-EMB or hemolytic (or otherwise typical in appearance) on SHIBAM and are X-gal (+), MUG (+) or (-) and indole positive.

      1. Identify the isolates as E. coli using API20E or VITEK, following manufacturer instructions.
      2. Isolates identified as E. coli need to be retested for toxigenic potential (see section Q.1.c.).  Once an STEC is isolated, do additional testing for virulence factors and for major serogroups of concern using the Luminex assay (see 3 below). 
      3. Further isolate strain characterization can be done by Pulsed Field Gel Electrophoresis (PFGE). Use standardized PulseNet PFGE protocols (1).
    3. STEC of selected O types have caused severe illnesses, so it is important to identify strains from these O serogroups. EHEC strains also require adherence factors in order to cause severe illness, and therefore, essential to test for adherence factor genes as well to better assess pathogenic potential. The 13-plex Luminex suspension array was developed to identify 11 of the most clinically relevant STEC O serogroups (O26, O45, O91, O103, O104, O111, O113, O121, O128, O145, and O157), and detect the presence of two adherence factor genes (eae and aggR). Isolates that have been confirmed to be E. coli that contain the stx1 and/or stx2 genes should be analyzed by the STEC Molecular Serotyping and Virulence Profiling Protocol, FDA, 2015 (add link to .pdf file of protocol).
    4. New: 13-plex STEC Molecular Serotyping and Virulence Profiling Protocol, FDA, 2015, "Luminex-based Suspension Array to Identify STEC O serogroups O26, O45, O91, O103, O104, O111, O113, O121, O128, O145, O157, eae, and aggR". (PDF, 1.2 Mb).  For information on this method, contact: Andrew Lin (SAN-DO).
    5. Archived Method: 11-plex STEC Molecular Serotyping Protocol, FDA, 2013 "Luminex-based Suspension Array to Identify STEC O serogroups O26, O45, O91, O103, O104, O111, O113, O121, O128, O145, and O157", has been replaced with the 13-plex shown on #4, above.  The 11-plex method has been archived. ( PDF; 2.0Mb).
    6. NOTE: Aside from O types and adherence factors, other information may be needed to determine the health risk of STEC isolates. Contact Peter Feng, CFSAN (240-402-1650) to determine whether the isolates need to be sent for further risk analysis.

    References

    1. Centers for Disease Control and Prevention. 2007. PNL05. Standard Operating Procedure for PulseNet PFGE of E. coli O157:H7, Salmonella serotypes and Shigella sonnei.
    2. Centers for Disease Control and Prevention. 1996. Outbreak of Escherichia coli O157:H7 infections associated with drinking unpasteurized commercial apple juice. Morbid. Mortal. Weekly Rep. 45:44.
    3. Centers for Disease Control and Prevention. 1993. Update: Multistate outbreak of Escherichia coli O157:H7 infections from hamburgers-Western United States, 1992-1993. Morbid. Mortal. Weekly Rep. 42:258-263.
    4. Como-Sebetti, K., K. S. Reagan, S. Alaire, K. Parrott, C. M. Simonds, S. Hrabowy et al. 1997. Outbreaks of Escherichia coli O157:H7 infection associated with eating alfalfa sprouts- Michigan and Virginia, June-July 1997. Morbid. Mortal. Weekly Rep. 46:741-744.
    5. Doyle, M.P. and J.L. Schoeni. 1987. Isolation of Escherichia coli O157:H7 from retail fresh meats and poultry. Appl. Environ. Microbiol. 53:2394-2396.
    6. Doyle, M. P. and V. V. Padhye. 1989. Escherichia coli, p. 235-277. In M. P. Doyle (ed.), Foodborne Bacterial Pathogens, Marcel Dekker, Inc. New York, NY.
    7. DuPont H.L., S.B. Formal, R.B. Hornick, M.J. Snyder, J.P. Libonati, D.G. Sheahan, E.H. LaBrec and J.P. Kalas. 1971. Pathogenesis of Escherichia coli diarrhea. N. Engl. J. Med. 285:1-9.
    8. Ewing, W.H. 1986. Edwards and Ewing's Identification of Enterobacteriaceae, 4th ed. Elsevier, New York.
    9. Feng, P. 1993. Identification of Escherichia coli serotype O157:H7 by DNA probe specific for an allele of uidA gene. Mol. Cell. Probes 7:151-154.
    10. Feng, P., P.I. Fields, B. Swaminathan, and T.S. Whittam. 1996. Characterization of non-motile variants of Escherichia coli O157 and other serotypes by using an antiflagellin monoclonal antibody. J. Clin. Microbiol. 34:2856-2859.
    11. Feng, P. and K.A. Lampel. 1994. Genetic Analysis of uidA Expression in Enterohaemorrhagic Escherichia coli Serotype O157:H7. Microbiology. 140 (Pt 8):2101-7.
    12. Feng P. and S.R. Monday. 2000. Multiplex PCR for detection of trait and virulence factors in enterohemorrhagic Escherichia coli serotypes. Mol. Cell. Probes. 14:333-337.
    13. Griffin, P.M. and R.V. Tauxe. 1991. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli and the associated hemolytic uremic syndrome. Epidemiol. Rev. 13:60-98.
    14. Hicks, S., G. Frankel, J. B. Kaper, G. Dougan, and A. D. Phillips. 1998. Role of intimin and bundle-forming pili in enteropathogenic Escherichia coli adhesion to pediatric intestinal tissue in vitro. Infect. Immun. 66:1570-1578.
    15. Hill, W.E, K.C. Jinneman, P.A. Trost, J.L Bryant, J. Bond and M.M. Wekell. 1993. Multiplex polymerase chain reaction detection of Shiga-like toxin genes in Escherichia coli. FDA LIB 3811.
    16. Itoh, Y., Y. Sugita-Konishi, F. Kasuga, M. Iwaki, Y. Hara-Kuda, N. Saito, Y. Noguchi, H. Konuma, and S. Kumagai. 1998. Enterohemorrhagic Escherichia coli O157:H7 present in radish sprouts. Appl. Environ. Microbiol. 64:1532-1535.
    17. Jinneman, K.C., K.J. Yoshitomi and S. D. Weagant. 2003. Multiplex Real-Time PCR Method to Identify Shiga Toxins, stx1 and stx2 and E. coli O157:H7 Serogroup. Appl. Environ. Microbiol. 69: 6327-6333.
    18. Jinneman, K.C., K.J. Yoshitomi, and S.D. Weagant. 2003. Multiplex real-time PCR protocol for the identification of shiga toxins, stx1 and stx2, and E. coli O157:H7/H- serogroup. Laboratory Information Bulletin. #4299.
    19. Karmali, M. A. 1989. Infection by verotoxin-producing Escherichia coli. Clin Microbiol. Rev. 2:15-38.
    20. Karmali MA, Mascarenhas M, Shen S, Ziebell K, Johnson S, Reid-Smith R, Isaac-Renton J, Clark C, Rahn K, Kaper JB. 2003. Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J. Clin. Microbiol. 41(11):4930-40.
    21. Levine, M. M. 1987. Escherichia coli that cause diarrhea: enterotoxigenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 155:377-389.13.
    22. Light Cycler 2.0. Operator Manual.
    23.  McGowan, K. L., E. Wickersham, and N. A. Strockbine. 1989. Escherichia coli O157:H7 from water. (Letter). Lancet. I:967-968.
    24. Mehlman, I. J. 1984. Coliforms, fecal coliforms, Escherichia coli and enteropathogenic E. coli.p. 265-285. In M. L. Speck (ed.), Compendium of Methods for the Microbiological Examination of Foods, 2nd ed. American Public Health Assoc. Washington, D.C.
    25. Mehlman I.J., A. Romero, J.C. Atkinson, C. Aulisio, A.C. Sanders, W. Campbell, J. Cholenski, J. Ferreira, E. Forney, K. O'Brian, M. Palmieri, and S. Weagant. 1982. Detection of invasiveness of mammalian cells by Escherichia coli: collaborative study. J Assoc.Off. Anal. Chem. 65:602-7.
    26. Miliotis, M. D. and P. Feng. 1993. In Vitro staining technique for determining invasiveness in foodbrone pathogens. FDA LIB 3754.
    27. Monday, S.R., A. Beisaw and P.C.H. Feng. 2007. Identification of Shiga toxigenic seropathotypes A and B by multiplex PCR. Mol. Cell. Probes 21:308-311.
    28. Nataro, J. P. and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:132-201.
    29. Neill, M. A., P. I. Tarr, D. N. Taylor, and A. F. Trofa. 1994. Escherichia coli, p. 169-213. In Y. H. Hui, J. R. Gorham, K. D. Murell, and D. O. Cliver (ed.), Foodborne Disease Handbook, Marcel Dekker, Inc. New York, NY.
    30. Orskov, F. 1984. Escherichia, p. 420-423. In N. R. Krieg and J. G. Holt (ed.) Bergey's Manual of systematic Bacteriology, vol. 1 Williams and Wilkins Co., Baltimore, MD.
    31. Riley, L.W., R. S. Remis, S.D. Helgerson, H.B. McGee, J.G. Wells, B. R. Davis, R. J. Herbert, G.S. Olcott, L.M. Johnson, N. T. Hargett, P.A. Blake, and M. L. Cohen. 1983. Hemorrhagic colitis associated with a rare Escherichia coli serotype O157:H7. N. Engl. J. Med. 308:681-685.
    32. Smart Cycler Operator Manual. 1999. USA.
    33. Sowers, E.G., J.G. Wells, and N.A. Strockbine. 1996. Evaluation of commercial latex reagents for identification of O157 and H7 antigens of Escherichia coli. J. Clin. Microbiol. 34:1286-1289.
    34. Swerdlow, D. L., B. A. Woodruff, R. C. Brady, P. M. Griffin, S. Tippen, H. D. Donnell, Jr., E. Geldreich, B. J. Payne, A. Neyer, J. G. Wells, K. D. Greene, M. Bright, N. Bean, and P. A. Blake. 1992. A waterborne outbreak in Missouri of Escherichia coli O157:H7 associated with bloody diarrhea and death. Ann. Intern. Med. 117:812-819.
    35. Thompson M.R., H. Brandwein, M. LaBine-Racke, and R.A. Giannella. 1984. Simple and reliable enzyme-linked immunosorbent assay with monoclonal antibodies for detection of Escherichia coli heat-stable enterotoxins. J. Clin. Microbiol. 20:59-64.
    36. Tobe, T., T. Hayashi, C-G. Han, G. K. Schoolnik, E. Ohtsubo, and C. Sasakawa. 1999. Complete DNA sequence and structural analysis of the enteropathogenic Escherichia coli adherence factor. Infect. Immun. 67:5455-5462.
    37. Tsen, H-Y., W-R. Chi, and C-K. Lin. 1996. Use of novel polymerase chain reaction primers for the specific detection of heat-labile toxin I, heat-stable toxin I and II enterotoxigenic Escherichia coli in milk. J. Clin. Microbiol. 59:795-802.
    38. Weagant, S.D. and A.J. Bound. 2001. Comparison of Methods for Enrichment and Isolation of Escherichia coli O157:H7 from Artificially Contaminated Salad Mixes. Laboratory Information Bulletin, LIB 4258, Aug. 2001.
    39. Weagant, S.D. and A.J. Bound. 2001. Evaluation of techniques for enrichment and isolation of Escherichia coli O157:H7 from artificially contaminated sprouts. International Journal of Food Microbiology, 71:87-92.
    40. Weagant, S. D., J. L. Bryant, and K. C. Jinneman. 1995. An improved rapid technique for isolation of Escherichia coli O157:H7 for foods. J. Food Prot. 58:7-12.
    41. Weagant, S. D., K. C. Jinneman, and J. H. Wetherington. 2000. Use of multiplex polymerase chain reaction for identification of enterotoxigenic Escherichia coli. FDA LIB 4227.
    42. Yoshitomi, K.J., K.C. Jinneman, and S.D. Weagant. 2003. Optimization of 3'-Minor Groove Binder-DNA probe for the rapid detection of Escherichia coli O157:H7 using real-time PCR. Mol. and Cell. Probes. 17:275-280.
    43. Beutin, L., Zimmermann, S., Gleier, K. (1996) Rapid Detection and Isolation of Shiga-Like Toxin (Verocytotoxin)- Producing Escherichia coli by Direct Testing of Individual Enterohemolytic Colonies from Washed Sheep Blood Agar Plates in the VTEC-RPLA Assay. J. Clin. Micro., 34, 2812-2814.
    44. Kimura, N., A. Kozaki, T. Sasaki, and A. Komatsubara. 1999. Basic Study of Beutin’s Washed Sheep Blood Agar Plate Used for Selective Screening of Verocytotoxin-producing/Enterohemorrhagic Escherichia coli (VTEC/EHEC). Kansenshogaku Zasshi., 73:318-327.
    45. Lin, A., L. Nguyen, J. A. Kase, I. Son, and C. R. Lauzon. 2012. Isolation of STECs from Fresh Produce using STEC Heart Infusion Washed Blood Agar with Mitomycin-C. FDA Laboratory Information Bulletin. #4519. 
    46. Sugiyama, K., K. Inoue, and R. Sakazaki. 2001. Mitomycin-supplemented washed blood agar for the isolation of Shiga toxin-producing Escherichia coli other than O157:H7. Lett. Appl. Micro., 33: 193-195.

    Hypertext Source: Bacteriological Analytical Manual, 8th Edition, Revision A, 1998. Chapter 4.

     

 

BAM Resources

Page Last Updated: 11/23/2016
Note: If you need help accessing information in different file formats, see Instructions for Downloading Viewers and Players.
Language Assistance Available: Español | 繁體中文 | Tiếng Việt | 한국어 | Tagalog | Русский | العربية | Kreyòl Ayisyen | Français | Polski | Português | Italiano | Deutsch | 日本語 | فارسی | English