• Decrease font size
  • Return font size to normal
  • Increase font size
U.S. Department of Health and Human Services

Food

  • Print
  • Share
  • E-mail
-

Single Laboratory Validated Method for DNA-Barcoding for the Species Identification of Fish for FDA Regulatory Compliance

Updated September 2011

Index


Sara M. Handy and Jonathan R. Deeds
U. S. Food and Drug Administration, Office of Regulatory Science, Center for Food Safety and Applied Nutrition, College Park, Maryland 20740, USA

Natalia V. Ivanova and Paul D.N. Hebert
Canadian Centre for DNA Barcoding, Biodiversity Institute of Ontario, University of Guelph, 579 Gordon Street, Guelph, Ontario, Canada, N1G 2W1

Robert Hanner
Department of Integrative Biology, University of Guelph, 50 Stone Road East, Guelph, Ontario, Canada, N1G 2W1

Andrea Ormos and Lee A. Weigt
Laboratories of Analytical Biology, National Museum of Natural History, Smithsonian Institution, MRC 534, Washington DC 20013-7012, USA

Michelle M. Moore
U.S. Food and Drug Administration, Office of Regulatory Affairs, Pacific Regional Laboratory Northwest, Applied Technology Center, 22201 23rd Dr. SE, Bothell, Washington 98021-4421, USA

Rosalee S. Hellberg
U.S. Food and Drug Administration, Office of the Commissioner/Office of Regulatory Affairs, Pacific Regional Laboratory Southwest, 19701 Fairchild, Irvine, California 92612, USA

Haile F. Yancy
U. S. Food and Drug Administration, Office of Research, Center for Veterinary Medicine, 8401 Muirkirk Road, Laurel, Maryland 20708, USA


Abstract

A detailed single laboratory validated protocol is provided for DNA sequencing of the cytochrome c oxidase subunit I gene (COI) of seafood tissue samples for the purpose of obtaining unique, species-specific "barcodes" for species identification. These procedures include: Tissue Sampling, Tissue Lysis and DNA Extraction, Polymerase Chain Reaction (PCR) - COI Amplification, PCR Product Check, PCR Product Cleanup, Cycle Sequencing Reaction, Sequencing Reaction Cleanup, and Post Sequencing Analysis.

For FDA purposes, this SOP, which is based on a published single laboratory validation (Handy et al. 2011), is intended to replace LIB No. 4420. This LIB is no longer available online. For additional information, contact Dr. Jonathan Deeds.

 

Introduction

Seafood is one of the most highly traded commodities in the world. In the interest of public health, it is vital that both domestically processed and imported seafood is safe, wholesome, and properly labeled. Under the Federal Food, Drug, and Cosmetic (FD&C) Act, the Fair Packaging and Labeling Act (FPLA) and the Public Health Service (PHS) Act, the Food and Drug Administration (FDA) facilitates programs that include inspection, sampling, analysis, research, and education on seafood issues. These programs assist the agency with its effort to oversee food safety and economic deception. The detection of species substitution is critical because it will assist in identifying and controlling species-specific hazards and reduce economic fraud.

There are numerous potential health risks associated with misbranding seafood species. For example, in 2007 several serious illnesses resulted from the illegal importation of toxic pufferfish that had been mislabeled as monkfish to circumvent U.S. import restrictions for this product (Cohen et al. 2009). Additional examples of species-specific hazards are listed in the FDA Seafood Hazard Guide: Food and Drug Administration Fish and Fisheries Products Hazards and Controls Guidance, Fourth Edition (2011)]. To aid in the proper labeling of seafood, the FDA maintains a list of acceptable market names for seafood sold in U.S. interstate commerce The Seafood List (FDA 2010).

One challenge faced by both consumers and regulators is the detection of "seafood substitution" in the marketplace - where a low value species or a species with a potential food safety hazard is mislabeled and substituted in whole or in part for a more expensive species or for a species with no potential food safety hazard. Substituted and/or mislabeled seafood is considered to be misbranded by the FDA and is a violation of Federal law.

It is not always possible to tell by simple inspection of an aquatic product that misbranding has occurred. Processing often removes or damages diagnostic characteristics crucial for the identification of species by conventional taxonomic means. Therefore, traditional morphological methods are often insufficient to provide for species resolution.

Several years ago, the FDA produced a web-based resource known as the Regulatory Fish Encyclopedia (RFE) to aid in the identification of commercially important species of fish (Tenge et al. 1997). Organized in a series of species "pages", the RFE contains high resolution images of whole fish and their marketed product forms (e.g. fillets, steaks), as well as other taxonomic, geographic, and relevant tools for species identification. An example of an identification method listed in the RFE is protein identification by isoelectric focusing (AOAC 1980). Isoelectric focusing is a currently accepted tool employed in the identification of fish fillets for regulatory compliance, but such analysis requires subjective interpretations of gel results and the inclusion of perishable frozen tissue standards in each run. Further, the technique is not effective in the case of processed or cooked samples. The RFE was designed so that it could be expanded to include additional data and to accommodate the use of newer analytical tools as they became available. In 2007, using methods developed as part of the Barcode of Life initiative, DNA barcode sequences were generated for 172 individual authenticated fish representing 72 species from 27 families contained in the RFE and the utility of DNA barcoding for regulatory seafood identifications was demonstrated (Yancy et al. 2008a).

The Barcode of Life disclaimer icon initiative represents an ambitious effort to develop an identification system for eukaryotic life based upon the analysis of sequence diversity in short, standardized gene regions. Work is furthest advanced for members of the animal kingdom. In this case, a region of the cytochrome c oxidase subunit 1 gene (COI) has been targeted and pilot studies have shown its effectiveness in species identification. Even relatively short nucleotide sequences (100-200 bp) from the barcode region can provide accurate identifications in some cases, allowing barcodes to identify specimens whose DNA is degraded (Hajibabaei et al. 2006).

The Fish Barcode of Life campaign (FISH-BOL disclaimer icon) is a collaborative international research effort which seeks to establish a reference library of DNA barcodes for all fish species derived from voucher specimens with authoritative taxonomic identifications (Ward et al. 2009). Fishes comprise nearly half of all vertebrate species; the group includes approximately 15,700 marine and 13,700 freshwater species (FishBase disclaimer icon). Once completed, the FISH-BOL database will enable a fast, accurate, and cost-effective system for molecular identification of the world's icthyofauna. While the current FISH-BOL database contains a majority of sequences with proper authentication and traceability, this database is not currently searchable against only vouchered species with authoritative taxonomic identifications. There are plans to change this, but in the interim, FDA will only make regulatory decisions based on identifications using adequately authenticated standards.

Well-regimented, largely automated protocols for DNA barcode analysis have been developed at institutions such as The Canadian Centre for DNA Barcoding (CCDB) and the Smithsonian Institute's Laboratories for Analytical Biology (LAB). An example of a standardized fish barcoding analytical chain includes DNA extraction using a Glass-Fiber protocol (Ivanova et al. 2006) followed by PCR amplification using pre-made PCR plates (Hajibabaei et al. 2005, Ivanova & Grainger 2006) with primer cocktails that allow the amplification of barcode sequences from all fish species (Ivanova et al. 2007).

The FDA's Center for Food Safety and Applied Nutrition and Center for Veterinary Medicine, in collaboration with the University of Guelph's Biodiversity Institute of Ontario, in Canada, and the Laboratories of Analytical Biology at the Smithsonian National Museum of Natural History, Suitland, MD, USA, first provided details on protocols, reagents, and equipment required to carry out a validation study for barcode generation for fish identification in the form of FDA Laboratory Information Bulletin No. 4420 (Yancy et al. 2008b). In 2008, this protocol was evaluated by three laboratories in an inter-laboratory trial and the results of this trial were used to further refine the method. This modified version of the method was then subjected to a formal single laboratory validation (SLV) at CFSAN and published in the Journal of AOAC (Handy et al. 2011). A step by step protocol based on this published SLV study, with minor modifications, is provided below. For FDA purposes, this SOP is intended to replace LIB No. 4420.

Literature Cited

  • AOAC. (1980). Official Method 980.16 Identification of Fish Species: Thin-Layer Polyacrylamide Gel Isoelectric Focusing Method. J. AOAC 63:69 (1980); corr. 684.
  • Cohen NJ, Deeds JR, Wong, ES, Hanner RH, Yancy HF, White KD, Thompson TM, Wahl M, Pham T, Guichard FM, Huh I, Austin C, Dizikes G, Gerber S. (2009) Public health response to puffer fish (tetrodotoxin) poisoning. Journal of Food Protection 72(4):810-817.
  • FDA. (2011). Food and Drug Administration Fish and Fisheries Products Hazards and Control Guidance, Fourth Edition. (accessed 6/10/2011).
  • FDA. (2010). The Seafood List: FDA Guide to Acceptable Market Names for Food Fish Sold in Interstate Commerce. Office of Food Safety, Division of Seafood Safety, FDA Center for Food Safety and Applied Nutrition, US Department of Health and Human Services. (accessed 6/11/2011)
  • Hajibabaei M, Smith, A, Janzen, DH, Rodriguez, JJ, Whitfield, JB, Hebert, PD. (2006). A minimalist barcode can identify a specimen whose DNA is degraded. Molecular Ecology Notes 6:959-964.
  • Handy, SM, Deeds, JR, Ivanova, NV, Hebert, PDN, Hanner, R, Ormos, A, Weigt, LA, Moore, M, Yancy, HF. (2011). A single laboratory validated method for the generation of DNA barcodes for the identification of fish for regulatory compliance. J. AOAC. 94(1):201-210.
  • Ivanova N, Grainger C. (2006). Pre-made frozen PCR and sequencing plates. CCDB Advances disclaimer icon(pdf), Methods Release No. 4. Biodiversity institute of Ontario, (accessed 7/16/2010).
  • Ivanova NV, deWaard JR, Hebert PDN. (2006). An inexpensive, automation-friendly protocol for recovering high-quality DNA. Molecular Ecology Notes 6:998-1002.
  • Ivanova NV, Zemlak TS, Hanner RH, Hebert PDN. (2007). Universal primer cocktails for fish DNA barcoding. Molecular Ecology Notes, 7:544-548.
  • Tenge BJ, Dang NL, Fry FS, Savary WE, Rogers PL, Barnett JD, Hill WE, Wiskerchen JE, Wekell MM. (1997). Integration of Computer and Laboratory Techniques for Species Identification Including Development of a Regulatory Fish Encyclopedia. in Fish Inspection, Quality Control, and HACCP - A Global Focus, p. 214-226. Martin, Collette, and Slavin, (eds.), Technomic Publishing, Lancaster, PA.
  • Ward RD, Hanner R, Hebert PDN. (2009) The Campaign to DNA Barcode all Fishes, FISH-BOL. Journal of Fish Biology 74:329-356.
  • Yancy HF, Zemlak TS, Mason JA, Washington JD, Tenge BJ, Nguyen NT, Barnett JD, Savary WE, Hill WE, Moore MM, Fry FS, Randolph SC, Rogers PL and Hebert PDN. (2008a). The Potential Use of DNA Barcodes in Regulatory Science: Applications of the Regulatory Fish Encyclopedia. Journal of Food Protection 71(1):210-7.
  • Yancy HF, Fry FS, Randolph SC, Deeds JR, Ivanova NV, Grainger CM, Hanner R, Weigt LA, Driskell A, Hunt J, Ormos A, Hebert PDN. (2008b) LIB No. 4420 A Protocol for Validation of DNA-Barcoding for the Species Identification of Fish for FDA Regulatory Compliance. FDA Laboratory Information Bulletin Vol. 24.

 

FDA Standard Operating Procedure (SOP) for Generating DNA Barcodes Suitable for Species Identification of an Unknown Fish Tissue Sample

NOTE: Reference to any commercial materials, equipment, or process does not in any way constitute approval, endorsement, or recommendation by the Food and Drug Administration.

The process of generating DNA barcodes suitable for species identification from an unknown fish tissue sample can be broken down into the following steps:

  1. Tissue Sampling
  2. Tissue Lysis and DNA Extraction
  3. Polymerase Chain Reaction - COI Amplification
  4. PCR Cleanup
  5. Cycle Sequencing Reaction
  6. Sequencing Reaction Cleanup
  7. Sequencing
  8. Post Sequencing Analysis

Individual labs will likely modify this SOP based on available equipment and reagents. In addition, for steps such as tissue lysis and DNA extraction, several commercial kits are available that may be acceptable. Any deviations from the described SOP will need to be proven to provide acceptable results. Performance criteria for individual steps are provided to aid in this process.

A detailed SOP based on the single laboratory validation study detailed in Handy et al. (2011), with some modifications, is provided below.

Modifications from Handy et al. (2011) are noted.

 

1.  TISSUE SAMPLING

(Note: Only necessary if a subset is needed for long term storage, e.g. reserve samples. If no reserve sample is required, proceed to Step 2.)

1A. Reagents and Consumables

  1. Reagent Alcohol, Histological (EtOH 96%); Fisher Scientific Catalog No. A962-4
  2. Nalgene 2.0ml Cryogenic vial: Fisher Scientific Catalog No. 033377D

1B. Protocol for Tissue Sampling

Goal: Sample unknown fish tissues in a manner that prevents cross-contamination between samples, or the introduction of foreign DNA.

Criteria for Success: After sequencing, have a chromatogram that gives single peaks for each base as evidenced by the AB1 file.

Several tissues are suitable for DNA extraction from fishes. These include:

  • Musculature (preferred): remove one or more cubes (5-7 mm) of lateral muscle (skin removed).
  • Fin clips: remove fin rays and membrane from the pectoral or pelvic fin. Use these tissues only if the fish needs to be kept alive.
  • Eye: remove the right eye from extremely small specimens such as larvae.

Each fish or fish fillet sampled should be bagged and labeled separately. Tissue samples should be removed with a scalpel and forceps that are flame sterilized after each sample is processed. New (sterile) tubes should be used for each sample. Tissues should be frozen at -20°C or preserved in fresh 95% ethanol and stored in a cool place, preferably in a freezer, until DNA is extracted. For long term storage of critical samples (e.g. reference standards, investigation reserve samples, etc.), tissues should be stored at -80°C.

 

2.  TISSUE LYSIS AND DNA EXTRACTION

Goal: Extract DNA acceptable for use in PCR.

Criteria for Success: Obtain ≥5 ng/µL of DNA for all samples (Note: this was the lowest quantity used for the SLV, lower quantities may work) measured on a Nanodrop ND 1000 Spectrophotometer (Thermo-scientific, Wilmington, DE) with a 260 nm/280 nm ratio of ~ 1.8. In addition, a negative control with no added DNA should give a reading of ~0 ng/µL.

DNeasy Blood & Tissue Kit Qiagen Catalog No. 69504 (50) or 69506 (250)

2A. Reagents and Consumables
  1. Collection Tubes (2 ml)
  2. Buffer ATL
  3. Buffer AL
  4. Buffer AW1 (concentrate)
  5. Buffer AW2 (concentrate)
  6. Buffer AE 22 ml 2 x 60 ml
  7. Proteinase K 1.25 ml 6 ml
  8. Pipets and pipet tips (see below for recommendations)
  9. Vortexer
  10. Ethanol (96-100%)
  11. Microcentrifuge tubes (1.5 ml)
  12. Microcentrifuge with rotor for 1.5 ml and 2.0 ml tubes
  13. Thermomixer, shaking water bath, rocking platform or dry block heater for heating microcentrifuge tubes at 56°C

2B. Protocol for Tissue Sampling

Preparation of Buffer AW1, AW2, and AL

  1. Buffer AW1 and Buffer AW2 are supplied as concentrates. Before using for the first time, add the appropriate volume of ethanol (96-100%) as indicated on the bottle and shake thoroughly. Buffer AW1 and Buffer AW2 are stable for at least 1 year after the addition of ethanol when stored closed at room temperature (15- 25°C).
  2. Buffer AL and ethanol (96-100%) are added in the same step. Buffer AL and ethanol can be premixed and added together in one step to save time when processing multiple samples.
  3. Add 90 ml ethanol (96-100%) to the bottle containing 86 ml Buffer AL or 260 ml ethanol to the bottle containing 247 ml Buffer AL and shake thoroughly. Mark the bottle to indicate that ethanol has been added. (Please note that, for purification of DNA from animal blood, Buffer AL must be used without ethanol. Buffer AL can be purchased separately if the same kit will be used for purification of DNA from animal blood.) Buffer AL is stable for 1 year after the addition of ethanol when stored closed at room temperature.

Important points before starting

  • If using the DNeasy Blood & Tissue Kit for the first time, read "Important Notes" (Qiagen Handbook, page 15 disclaimer icon)
  • All centrifugation steps are carried out at room temperature (15-25°C) in a microcentrifuge.
  • Vortexing should be performed by pulse-vortexing for 5-10 s.

Things to do before starting

  • Buffer ATL and Buffer AL may form precipitates upon storage. If necessary, warm to 56°C until the precipitates have fully dissolved.
  • Buffer AW1 and Buffer AW2 are supplied as concentrates. Before using for the first time, add the appropriate amount of ethanol (96-100%) as indicated on the bottle to obtain a working solution.
  • Preheat a thermomixer, shaking water bath, rocking platform, or dry block heater to 56°C for use in step 2.

Protocols for Tissue Lysis and DNA Extraction

  1. Cut ~10 mg* tissue, and place in a 1.5 ml sterile microcentrifuge tube. Include a negative extraction control with each set of extractions. The negative extraction control is treated exactly the same as sample tubes except that it does not contain any fish tissue. Note*: Tissue does not need to be accurately weighted but it is essential to only take a small amount of tissue with this extraction kit to obtain the optimal DNA yields for PCR.
  2. Add 50 µl of buffer ATL and 5.56 µl proteinase K. Mix thoroughly by vortexing, and incubate at 56°C until the tissue is completely lysed. Vortex occasionally during incubation to disperse the sample, or place in a thermomixer, shaking water bath, or on a rocking platform. Lysis time varies depending on the type of tissue processed. Lysis is usually complete in 1-3 h. If it is more convenient, samples can be lysed overnight; this will not affect them adversely. After incubation the lysate may appear viscous, but should not be gelatinous as it may clog the DNeasy Mini spin column. If the lysate appears very gelatinous, see the "Troubleshooting Guide", page 47, for recommendations.
  3. Vortex for 15 s. Add 55.6 µl Buffer AL to the sample, and mix thoroughly by vortexing. Then add 55.6 µl ethanol (96-100%), and mix again thoroughly by vortexing. It is essential that the sample, Buffer AL, and ethanol are mixed immediately and thoroughly by vortexing or pipetting to yield a homogeneous solution. Buffer AL and ethanol can be premixed and added together in one step to save time when processing multiple samples. Note: A white precipitate may form on addition of Buffer AL and ethanol. This precipitate does not interfere with the DNeasy procedure.
  4. Pipet the mixture from step 3 (including any precipitate) into the DNeasy Mini spin column placed in a 2 ml collection tube (provided). Centrifuge at 6000 × g (8000 rpm) for 1 min. Discard flow-through and collection tube. Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 140 µl Buffer AW1, and centrifuge for 1 min at 6,000 × g (8,000 rpm). Discard flow-through and collection tube.
  5. Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 140 µl Buffer AW2, and centrifuge for 3 min at 20,000 × g (14,000 rpm) to dry the DNeasy membrane. Discard flow-through and collection tube. Note: It is important to dry the membrane of the DNeasy Mini spin column, since residual ethanol may interfere with subsequent reactions. This centrifugation step ensures that no residual ethanol will be carried over during the following elution. Following the centrifugation step, remove the DNeasy Mini spin column carefully so that the column does not come into contact with the flow-through, since this will result in carryover of ethanol. If carryover of ethanol occurs, empty the collection tube, then reuse it in another centrifugation for 1 min at 20,000 × g (14,000 rpm). Conversely, samples can be dried at 37°C for 30 minutes to remove excess alcohol and also to facilitate DNA elution.
  6. Place the DNeasy Mini spin column in a clean 1.5 ml microcentrifuge tube (not provided), and pipet 50 µl Buffer AE (warmed to 37°C) directly onto the DNeasy membrane. Incubate at room temperature for 1 min, and then centrifuge for 1 min at 6,000 × g (8,000 rpm) to elute.

 

3.  POLYMERASE CHAIN REACTION – COI AMPLIFICATION

Goal: To amplify ~700 bases starting near the 5' end of the COI mitochondrial gene suitable for sequencing.

Criteria for Success: A sample that produces a single band of ~700 bases in size as visualized on a pre-cast agarose gel. Each set of reactions also requires two negative controls, one which consists of the PCR cocktail with no additional DNA template added and another with an addition of the extraction negative control. These samples have to be negative on the agarose gel (no band produced).

3A. Consumables & Equipment
  1. Molecular grade water (dd H2O); e.g., Invitrogen Catalog No. 10977023
  2. D - (+) - Trehalose dihydrate; e.g., Sigma Catalog No. 90210-50g (BioChemika)
  3. 10× PCR Buffer, minus Mg; e.g., Invitrogen Catalog No. 10966-034
  4. 50 mM Magnesium Chloride; e.g., Invitrogen Catalog No. 10966-034
  5. Deoxynucleotide Solution Mix; New England Biolabs Catalog No. N0447L
  6. Oligonucleotide Primers; Integrated DNA Technologies, USA.
  7. Platinum Taq DNA Polymerase; Invitrogen Catalog No. 10966-034
  8. Pipetter 2-20 µl volume; e.g. Rainin classic pipet; Catalog No. PR-20 (tips- GP-20F)
  9. Pipetter 20-200 µl volume; e.g., Rainin classic pipet; Catalog No. PR-200 (tips- GP-200F)
  10. Pipetter 0.1-2 µl volume; e.g., Rainin classic pipet; Catalog No. PR-2 (tips- GP-10F)
  11. 8-Channel pipetter 0.5-10 µl volume; e.g., Rainin classic pipet; Catalog No. L8-10 (tips- GP-10F)
  12. 8-Channel pipetter 20-200 µl volume; e.g., Rainin classic pipet; Catalog No. L8-200 (tips- GP-10F)
  13. Thermocycler; e.g., Eppendorf Mastercycler® ep gradient S Thermocycler; Eppendorf Catalog No. 950010045
  14. Adhesive PCR film; e.g., Thermo-scientific AB0558
  15. 8 well strip tubes; e.g., Applied Biosystems N801-0838
  16. 96-well PCR plate; e.g., Catalog No. MPS-499 from Phenix Research
  17. Gel Doc gel documentation system; Bio-Rad
  18. Pre-cast agarose gel; e.g., 2% E-Gel® 96 Invitrogen Catalog No. G7008-02
  19. E-Base® Integrated power supply; Invitrogen Catalog No. EB-M03
  20. AirClean® Systems Ductless PCR Workstation Fisher Scientific Catalog No. 209 36 099 3859
  21. Positive Control fish DNA* (if required). Note*: Any purified fish DNA from previous analyses can be used as a positive control. An SOP for producing positive control DNA will be provided separately.

3B. Polymerase Chain Reaction Recipe

Tailed M13 COI primers (modified from Baldwin et al. 2009):

FISHCOILBC_ts:

CACGACGTTGTAAAACGACTCAACYAATCAYAAAGATATYGGCAC

FISHCOIHBC_ts:

GGATAACAATTTCACACAGGACTTCYGGGTGRCCRAARAATCA

Table 1. PCR Reagents

Reagents Each well (µl)96-well plate (µl)
1.10% trehalose6.250625.0
2.dd H2O2.000200.0
3.10X buffer1.250125.0
4.50 nM MgCl20.62562.5
5.10µM primer A0.12512.5
6.10µM primer B0.12512.5
7.10mM dNTPs0.0626.2
8.Platinum Taq (5 U/µl)0.0606.0
 Total10.501050.00

3C. Protocols for Polymerase Chain Reaction (example for a 96 well plate)

  1. Add all 8 reagents to a single 1.5-2 ml microcentrifuge tube in the volumes listed under the "96 well plate".
  2. This forms the "cocktail" of reagents for the PCR reaction. Vortex the cocktail vigorously or mix well by pipetting (Note: vortexing will cause liquid to be trapped on the cap of the tube. Before proceeding to the next step make sure that this liquid is returned to the rest of the cocktail by a 15 second spin in a mini centrifuge).
  3. Aliquot 130 µl of cocktail into each well of an 8 well strip tube using the single-channel 200 µl pipette. Use the same tip for each transfer in this step.
  4. Transfer 10.5 µl of cocktail from the last row to the empty wells in each row of the 96-well plate using the 8-channel 200 µl pipette. Use the same tips for each transfer in this step.
  5. Aliquot 1 µl of DNA template to each well of the 96-well plate.
  6. Place the plate in a thermocycler block with a plastic mat on top of the plate and close the lid of the thermocycler. Note: the plastic mat is only required by some thermocyclers. Start the program: Thermal conditions are 94°C for 2 min, 35 cycles of 94°C for 30 sec, 55°C for 40 sec, and 72°C for 1 min, with a final extension at 72°C for 10 min.

3D. PCR Product Check

  1. NOTE: This section is written for an E-Base® 48 or 96 well system. If labs have gel systems other than the one listed, follow manufacturer's instructions. Samples should be run for 5-6 min in a 1-2% agarose gel.)
  1. Plug the Mother E-Base into an electrical outlet. Press and release the 'pwg/prg' (power/program) button on the base to select program EG. Select a run time of 6 min by pressing the 'time' button.
  2. Remove gel from the package and remove plastic comb from the gel. Slide gel into the two electrode connections on the Mother E-Base.
  3. Load 16 µl of dd H2O into each well.
  4. Load 4 µl of each PCR product into a different well.
  5. To begin electrophoresis, press the 'pwd/prg' button. The red light should change to green.
  6. At the end of run (signaled with a flashing red light and rapid beeping), press and release the power button.
  7. Remove the gel cassette from the base and capture a digital image of the gel with the Bio-Rad Gel Doc system.
  8. Arrange lanes and manipulate image as necessary using the Invitrogen E-Editor software.

 

4.  PCR CLEANUP

Goal: To produce an amplicon free of extra dNTPs and excess primers that might interfere with the sequencing reaction.

Criteria for Success: Examine the PCR thermocycler to ensure that the run has completed at the correct temperatures and there are no error messages.

4A. Consumables & Equipment

  1. ExoSAP-IT- USB Corporation; Cleveland, OH Cat. No. 78201
  2. Thermocycler; e.g., Eppendorf Mastercycler® ep gradient S Thermocycler; Eppendorf Catalog No. 950010045

4B. Protocols for PCR Cleanup

  1. Add 2 µl of ExoSAP-IT to 5 µl of PCR product
  2. Incubate this mixture at 37°C for 15 min followed by 80°C for 15 min in a thermocycler.

Note: products can be measured on a Nanodrop ND 1000 Spectrophotometer to quantify DNA at this step. Negative controls should read ~0 ng/ul

 

5.  CYCLE SEQUENCING REACTION

Goal: To attach fluorescently labeled ddNTPs using PCR-amplified template DNA.

Criteria for success: Examine the thermocycler to ensure that the run has completed at the correct temperatures and there are no error messages.

5A. Consumables & Equipment

  1. Molecular grade water (dd H2O); e.g., Invitrogen Catalog No. 10977023
  2. D - (+) - Trehalose dihydrate; e.g., Sigma Catalog No. T9531-100g
  3. BigDye® Terminator v3.1 Cycle Sequencing Kit; Applied Biosystems Catalog No. 4337457
  4. 5X Sequencing Buffer (400 nm Tris-HCl pH 9.0 + 10 mM MgCl2); included in BigDye Terminator v.3.1 Cycle Sequencing Kit
  5. Oligonucleotide Primer; Integrated DNA technologies, USA
  6. Pipetter 2-20 µl volume; e.g., Rainin classic pipet; Catalog No. PR-20 (tips- GP-20F)
  7. Pipetter 20-200 µl volume; e.g., Rainin classic pipet; Catalog No. PR-200 (tips- GP-200F)
  8. Pipetter 0.1-2 µl volume; e.g., Rainin classic pipet; Catalog No. PR-2 (tips- GP-10F)
  9. 8-Channel pipetter 05-10 µl volume; e.g., Rainin classic pipet; Catalog No. L8-10 (tips- GP-10F)
  10. 8-Channel pipetter 20-200 µl volume; e.g., Rainin classic pipet; Catalog No. L8-200 (tips- GP-10F)
  11. Semi skirted 96 well sequencing plate; e.g., Phenix Research MPS-3590
  12. AirClean® Systems Ductless PCR Workstation; Fisher Scientific Catalog No. 36 099 3859
  13. 8 well strip tubes; e.g., Applied Biosystems N801-0838
  14. Thermocycler; e.g., Eppendorf Mastercycler® ep gradient S Thermocycler; Eppendorf Catalog No. 950010045

5B. Cycle Sequencing Reaction Recipe

Table 2. Cycle Sequencing Reaction Recipe

#ReagentsEach well (µl)96-well (µl)
1.Primer M13F (or M13 R)1104
2.5X SEQ buffer*1.875195
3.BigDye0.2526
4.dd H2O0.87591
5.10% Trehalose5520
 Subtotal9936
 DNA template1n/a
 Total10n/a

*Note: 5X Sequencing buffer is: 400 mM Tris-HCl pH 9.0, 10 mM MgCl2 or 5X ABI sequencing buffer.

M13 Primers (Steffens et al. 1993)

M13F (-29) CACGACGTTGTAAAACGAC

M13R       GGATAACAATTTCACACAGG

5C. Protocols for Cycle Sequencing

  1. Add reagents 1-5 to a single 1.5 ml microcentrifuge tube in the volumes listed under the "96 well plate". This forms the "cocktail" of reagents for the PCR reaction Repeat this step using the other primer. The end result is 2 cocktails, one containing the forward primer and the other containing the reverse primer. Note: BigDye is light sensitive and should remain in the freezer except when in use. Never leave it out for longer than a few minutes.
  2. Vortex the cocktail vigorously. Note: Vortexing will cause liquid to be trapped on the cap of the tube. Before proceeding to the next step make sure that the liquid has been returned to the rest of the cocktail by quick spin in a mini-centrifuge.
  3. Aliquot 130 µl of cocktail into each well of an 8 well strip tube using the single-channel 200 µl pipette. Use the same tip for each transfer in this step. Use the same tip only for those transfers involving a single cocktail (i.e. before transferring the second cocktail you must change the tip).
  4. Transfer 9.0 µl of cocktail from the last row into each row of the 96-well plate using the 8-channel 10 µl pipette for both cocktails. Use the same tip only for those transfers involving a single cocktail (i.e. before transferring the second cocktail you must change the tip).
  5. Aliquot 1-1.5 µl of PCR product into each well of the 96-well plate. Use the 10 µl 8- channel pipette to do this row by row. Note: change the tips after each row.
  6. Seal the 96-well plate.
  7. Place the plate in a thermocycler block.
  8. Start the program Seq3.1: 96°C for 2 min, 30 cycles of 96°C for 30 sec, 55°C for 15 sec and 60°C for 4 min, followed by a 4°C hold.
  9. After the program has finished, stop the thermocycler and store the plates at 4°C in a dark box to avoid degradation of the light-sensitive sequencing products.

 

6.  SEQUENCING REACTION CLEANUP

Goal: To remove unincorporated dye terminators and salts from sequencing reactions so that they will not interfere with the base pair determination of the fragment.

Criteria for success: A 96-well sequencing plate containing 10-15 µl of cleaned sequencing reaction product after centrifugation. Success of unincorporated dye removal* cannot be assessed until Step 8: Post-Sequencing Analysis.

*Note: Incomplete unincorporated dye removal will cause "dye blobs" to appear in the raw ABI file chromatograms that will interfere with proper base assignments, and therefore reduce the quality of the processed DNA sequence. Several websites exist that are devoted to the troubleshooting of DNA sequencing. This is a helpful example disclaimer icon from Etonbio.com

6A. Consumables & Equipment:

  1. Edge Bio PERFORMA DTR V3 96-well short plate kit; Edge Bio Catalog No. 89939. Note: for lower sample numbers, Edge Bio PERFORMA DTR gel filtration cartridges (Edge Bio Catalog No. 42453) can be used in combination with a microcentrifuge capable of 850 × g.
  2. Centrifuge capable of spinning 96-well plates at 850 × g; e.g., Sorvall Evolution RC, Thermo-scientific
  3. Semi skirted 96 well sequencing plate; e.g., Phenix Research MPS-3590
  4. 8-Channel pipetter 0.5-10 µl; e.g., Fisher Scientific Catalog No. 13-688-507
  5. 1-10 µl filter tips; e.g., Fisher Scientific Catalog No. CS004807
  6. Flat bottom waste plate; Costar Catalog No. 9017 (Note: Included in the Edge Bio kit No. 42453)
  7. Hi-Di™ Formamide; Applied Biosystems Catalog No. 4311320

6B. Protocols for Sequencing Cleanup:

  1. Prep an Edge Bio PERFORMA DTR V3 96-well short plate by first removing the bottom adhesive tape, followed by the top. Take care to keep the plate horizontal to avoid losing any gel.
  2. Stack the V3 96-well short plate on top of a 96 well waste plate.
  3. Place the stacked plates (2) on a cushioned centrifuge carrier.
  4. Centrifuge for 3 minutes at 850 × g.
  5. Remove from centrifuge and discard excess water from waste plate.
  6. Carefully Transfer products directly into the prepped Edge Bio PERFORMA DTR V3 96-well short plate. Note: Pipet slowly, and do not touch the sides of the wells.
  7. Place V3 96-well short plate on top of a 96-well semi-skirted capillary plate containing 10 µl of Hi-Di™ Formamide in each well, and then back into a waste plate.
  8. Place the stacked plates (3) on a cushioned centrifuge carrier, taking care that they will spin without hindrance.
  9. Centrifuge for 2 minutes at 850 × g. Note: Instead of 5 minutes as the manufacturer suggests, because of specific instructions from Applied Biosystems.
  10. Retain eluate in 96-well semi-skirted plate and discard the V3 96-well short plate. Note: Some residual liquid (3-5 µL) will come through even in the empty wells according to the manufacturer so that the final volume in the wells will be 10-20µl.

6B. (alternate) Protocols for Sequencing Cleanup:

  1. Centrifuge the Performa Gel Filtration Cartridge for 3 minutes at 850 × g in a microcentrifuge.
  2. Transfer the cartridge to the provided 1.5-ml microcentrifuge tube and add the sample to the packed column. Be sure the fluid runs into the gel.
  3. Close the cap and centrifuge for 3 minutes at 850 × g. Retain eluate.
  4. Transfer 10 µl of eluate to a 96-well semi-skirted capillary plate containing 10 µl of Hi-Di™ Formamide in each well. Spin plate down in a centrifuge before loading on sequencer.

 

7.  SEQUENCING

Goal: Determine the accurate base pair composition of the COI amplicon.

Criteria for Success: Generation of an AB1 file suitable for post sequencing analysis, though determination of the accurate base pair composition cannot be assessed until successful completion of Step 8: Post-Sequencing Analysis.

7A. Consumables & Equipment:

  1. Pop-7™ Polymer* for 3730xl DNA Analyzers; Applied Biosystems Catalog No. 4335611
  2. 3730xl DNA Analyzer Capillary Array, 50 cm; Applied Biosystems Catalog No. 4331246
  3. Running Buffer, 10× for 3730xl DNA Analyzers; Applied Biosystems Catalog No. 4335613

*Note: Pop-6™ Polymer; Applied Biosystems Catalog No. 402837 was also found to provide acceptable results for barcode analysis (Handy et al. 2011).

7B. Protocols for Sequencing:

  1. Samples can now be put directly on the ABI 3730 sequencer. Note: Other types of sequencers can be used successfully but this was the instrument used in the SLV of the barcoding method. Follow instructions for particular sequencer in your individual laboratory.
  2. Import the plate record, and run the instrument using protocol default_50cm and the analysis protocol 3730BDTv3-KB-DeNovo_v5.2.

 

8.  POST SEQUENCING ANALYSIS

Goal: To process the sequence from the AB1 file into a usable unit for comparison with sequences from a database of authenticated standards.

Criteria for Success: Bi-directional sequences, of at least 500 bp in length, with <2% ambiguous bases in the contig, or a single read with a 98% HQ (98% high quality bases).

8A. Consumables & Equipment:

  1. Geneious Pro; Biomatters Ltd., Auckland, New Zealand
  2. Degenerate bony fish barcoding sequence, FISHREF08a:
    CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACAGCCCTAAGCCTACTAAT
    TCGAGCTGAACTAAGCCAACCTGGCGCCCTTCTAGGGGACGACCAAATTTATAATGTAAT
    CGTAACTGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGG
    CTTTGGAAACTGACTAATCCCCCTAATGATTGGGGCCCCCGACATGGCCTTCCCTCGAAT
    AAACAACATAAGCTTTTGACTTCTTCCCCCTTCTTTCCTTCTTCTCCTAGCATCCTCTGG
    AGTTGAAGCCGGGGCCGGAACAGGATGAACAGTTTACCCCCCTCTAGCAGGAAACCTAGC
    CCACGCAGGAGCCTCTGTAGACCTAACAATTTTCTCCCTTCATCTAGCAGGAATYTCCTC
    AATTCTAGGGGCAATTAACTTTATTACAACAATTCTTAACATGAAACCCCCAGCCATTTC
    ACAATACCAAACACCCCTATTTGTTTGAGCTGTCCTAATTACAGCCGTCCTTCTTCTTCT
    ATCCCTCCCAGTCCTTGCTGCTGGCATTACAATGCTTCTCACAGACCGAAACCTAAACAC
    AACCTTCTTTGACCCTGCAGGAGGAGGAGACCCCATTCTGTACCAACACCTATTC
    

8B. Protocols for Post Sequencing Analysis:

  1. Create folder in Geneious Pro*, and name it with appropriate regulatory (e.g. FACTS) sample number. *Note: This is a deviation from the published SLV method where a combination of programs were used for this step. Other types of editing software may also provide acceptable results but in the end an unknown sequence with either >500 bases of bidirectional coverage with <2% ambiguous bases or single reads >500 bases with >98% high quality must be obtained for use in neighbor joining trees.
  2. Import AB1 files generated by the sequencer into the newly created folder.
  3. Import Fish reference sequence FISHREF08a (in fasta format) into the folder.
  4. Highlight all AB1 files and the Fish reference sequence and then click "Assembly".
    1. Under Data
      1. Choose "Assemble to reference" and be sure the reference sequence is in the tab.
      2. Assemble by a delimiter used in the sample name (e.g., "_") that allows the two parts of the bidirectional sequence to be combined.
    2. Under Method
      1. Set the sensitivity to Highest Sensitivity/Slow
      2. Set the Fine Tuning to Maximum (Slowest)
    3. Under Trim Sequences
      1. Have Trim sequences clicked. (Under options have: "remove new trimmed regions from sequences" clicked)
      2. Have Trim primers clicked
      3. Allow 5 mismatches
      4. Minimum Match Length set to 5
      5. Error Probability Limit set at 0.05
      6. Click Trim 5' End
      7. Click Trim 3' End
      8. Click on Maximum length after trim set to 655
      9. Click OK
    4. Under Results
      1. Change Assembly Name to the "name of the regulatory sample " Assembly
      2. Click Save Assembly report, save in sub-folder, save contigs
  5. In the assembly file, select the Minimum Sequence Length heading to sort sequences by length. If any sequences are under 500 bp and < 98 %HQ, repeat the assembly step on the AB1 files without these sequences.
  6. Highlight all assembled files, right click and choose "Generate Consensus sequence"
    1. Threshold set at Highest Quality
    2. Assign Quality set on Total (which is the sum of the quality of contributing bases minus non-contributing bases)
    3. Click Trim to reference sequence.
    4. Click OK
  7. After an assembly file and consensus file are created for the sample
    1. Check the ambiguities by examining the consensus file and looking at the tab for ambiguities (must be less then 2%). Note: In order to determine the percent ambiguities, divide the number of ambiguities listed in the tab by the post-trim length of the sequence and then multiply by 100.
    2. For any samples that are left as single reads – be sure the sample has a 98%HQ (98% high quality bases) or better.
  8. Import the appropriate FDA Reference Standard Sequence Library alignment fasta file*.

    * The FDA Reference Standard Sequence Library will be provided to FDA Office of Regulatory Affairs (ORA) field analysts through the FDA Intranet CFSAN site. This database will be updated as more standards are added to the library. The database will be dated to distinguish it from previous versions. Analysts should check periodically to assure they are using the current database. In the event of any critical changes, CFSAN will notify ORA analysts directly. The Sequence Library will also be available through the public CFSAN website. In the event that a sequence from an unknown tissue sample does not match any sequence in the FDA database, the sequence can be screened against other publically available sources such as GenBank and BOLD disclaimer icon. These identifications should be considered presumptive unless the sequences were derived from specimens with proper authoritative taxonomic identification. FDA will only make regulatory decisions based on identifications using adequately authenticated standards. Inclusion of sequences from publically available databases should be noted in the analytical worksheet.
    1. Click on the small box in the upper left hand corner of the Geneious Pro folder next to the tab "name" to organize the files based on type.
    2. Highlight the FDA fish database alignment and the organized consensus sequences
  9. Form an alignment with both the FDA fish database alignment and the consensus sequences of the unknowns by clicking the alignment button.
  10. Align sequences in Geneious using the "Muscle Alignment" tab with default settings.
  11. Using this file, construct a UPGMA tree* (using Geneious treebuilder) with a Jukes-Cantor genetic distance model (no resampling). Note: (A neighbor-joining tree would also be appropriate but with variable sequence lengths the branches may be less smooth.)

    *Note: UPGMA or neighbor-joining analysis with distance thresholds, using a generalized cutoff of 2% sequence divergence, can be used in most cases to successfully delimit commercial species. More elaborate statistical methods to define species boundaries are also available (Kerr et al. 2009). For example, a character-based approach was recently used to successfully distinguish some of the closely related commercial species of tuna (Lowenstein et al. 2009). The most common application of DNA Barcode analysis at FDA involves the confirmation of product labeling according to their acceptable market names, found in the FDA Seafood List (FDA 2010). For this application, 2% sequence divergence is typically sufficient to provide resolution. Note, if 2 sequences are >2% divergent and the sequence quality standards provided here are followed, they are likely not the same species, but select examples exist where 2 closely related but distinct species have <2 % sequence divergence in this region of the COI gene. In some cases they can still be distinguished with this method, in other cases they cannot. Few examples exist in the FDA Seafood List where 2 closely related species that cannot be distinguished with this method have different approved market names.
  12. After examination of the tree, select appropriate species to include in a smaller subset (these should include several of the most closely related species, which MUSCLE will put in close proximity to each other, and whatever the product was labeled as if the product was misbranded). Click on the Alignment View tab (to the right of the Tree View tab), select the samples to include in the subset and click on the Extract button. Select the option "Extract region as alignment".
  13. Using the extracted file, construct a UPGMA or neighbor-joining tree (using Geneious treebuilder) with a Jukes-Cantor genetic distance model (with no resampling). To save and print the tree, make sure the Tree View tab is selected, then go to File, Save as Image File and save as a PDF, under More Options select "Print all labels". Include this tree* in the FDA analytical worksheet. Resampling can be done to verify statistical support if desired.

    *Note: The trees will only contain the latin scientific name for each standard. Please consult the FDA Seafood List or the FDA Reference Standard Sequence Library. for additional information, such as FDA acceptable market name, common scientific name, vernacular names, etc.
  14. In the alignment window, extract the unknown sample and the most closely related species into a new alignment by highlighting the two sequences and clicking on the "Extract" button (or by right-clicking to select "Extract regions"). Choose the "Extract region as alignment" option. The new alignment will appear in your Geneious folder. Scroll to the right to find the "% Pairwise Identity" heading. Include this number in the results section of FDA analytical worksheet as well as the % pairwise identity for the unknown sample and the species it was labeled as (generated in the same way) if this is different that the most closely related species from above.

Literature Cited

  • ABI. (2007). User Bulletin Part number 4362968 Rev. B.
  • Baldwin, CC, Mounts JH, Smith DG, Weigt LA. (2009). Genetic identification and color descriptions of early life-history stages of Belizean Phaeoptyx and Astrapogon (Teleostei: Apogonidae) with comments on identification of adult Phaeoptyx. Zootaxa 1-22.
  • Ewing B, Hillier L, Wendl MC, and Green P. (1998). Base-calling of automated sequencer traces using Phred. I. Accuracy assessment. Genome Research 8: 175-185.
  • FDA. (2010). The Seafood List: FDA Guide to Acceptable Market Names for Food Fish Sold in Interstate Commerce. Office of Food Safety, Division of Seafood Safety, FDA Center for Food Safety and Applied Nutrition, US Department of Health and Human Services. [Accessed 9/7/2011]
  • Handy, SM, Deeds, JR, Ivanova, NV, Hebert, PDN, Hanner, R., Ormos, A, Weigt, L.A., Moore, M.M., Yancy, H.F. (2011). A single laboratory validated method for the generation of DNA barcodes for the identification of fish for regulatory compliance. J. AOAC 94(1): 201-210. [Abstract and full text disclaimer icon]
  • Kerr, K, Birks, S, Kalyakin, M, Red'kin, Y, Koblik, E, Hebert, PDN. (2009). Filling the gap – COI barcode resolution in eastern Palearctic birds. Frontiers in Zoology 6: 29.
  • Lowenstein J H, Amato G, Kolokotronis S-O. (2009). The real maccoyii: Identifying tuna sushi with DNA barcodes - contrasting characteristic attributes and genetic distances. PLoS One 4(11): e7866.
  • Steffens DL, Sutter SL, Roemer SC. (1993). An alternate universal forward primer for improved automated DNA sequencing of M13. Biotechniques 15(4): 580-582.

 

-
-