Report to the FDA Science Board Research Planning, Program and Facilities of the Center for Veterinary Medicine August 7, 2009 Introduction The Center for Veterinary Medicine (CVM) is the arm of the U.S. Food and Drug Administration responsible for public and animal health. In carrying out this mission, CVM has a dual role in protecting and promoting the health of animals and, by doing so, protecting the safety of meat, milk, and other animal-derived products destined for the human food supply. It approves products for animals as safe and effective and enforces pertinent provisions of the Federal Food, Drug and Cosmetic Act and other relevant laws. CVM identifies its core functions as: new and generic animal drug reviews, animal feed safety, post-approval monitoring of animal drugs, feeds and animal devices, and compliance-related actions. Research in support of CVM’s mission is carried out through the Office of Research (OR) which is located on a 165-acre research campus in Laurel, Maryland. OR’s research program is planned in consultation with agency leadership to meet CVM’s regulatory science needs by: • developing and validating test methods, including methods for newly prohibited drugs, • conducting surveys of drug residues and pathogens in feeds for food animals and companion animals as well as animal-derived foods destined for human consumption, • evaluating animal diagnostic tests, • monitoring changes in antimicrobial susceptibility profiles of selected foodborne bacterial pathogens, and • providing the scientific base for CVM policies and guidelines in areas such as immunopharmacology, metabolism and residue depletion, and pharmacokinetics. The OR campus houses approximately 70 research scientists and support staff and contains laboratories, offices, large-animal housing and surgery suites, aquaculture facilities, a feed mixing facility, a quarantine facility, and pasture land. OR is organized in four major sections: the Division of Residue Chemistry, the Division of Animal Research, the Division of Animal and Food Microbiology and the National Antimicrobial Resistance Monitoring System (NARMS). The review of the CVM/OR research planning process and program contained in this report was initiated under the auspices of the FDA Science Board. Its purpose was to review CVM’s research programs, relevant facilities and the planning process that CVM has implemented for developing its Three-Year Research Plan and to make recommendations on improving the planning process and increasing the research program’s capacity in support of CVM’s mission. The charge to the Science Board subcommittee appears in full in Appendix 1. How review was conducted. The subcommittee carried out its work through telephone calls and a two-day site visit. The subcommittee held two telephone conferences prior to the site visit to discuss the charge and develop a plan of work, to review the Three-Year Research Plan and annual research reports, to acquaint the subcommittee with an overview of the CVM research program, and to plan the agenda for the site visit. The subcommittee visited the OR campus on July 15-16, 2009. During the site visit, the subcommittee met with Dr. Bernadette Dunham, the CVM Director, OR director, Dr. David White, OR deputy director, Mr. Michael Thomas, OR division directors and scientists, toured laboratories and research facilities, and met in executive session to discuss findings, conclusions and recommendations. The Division of Residue Chemistry is currently led by Dr. Phil Kijak, acting director; the Division of Animal Research is led by Dr. Jeff Ward, acting director; the Division of Animal and Food Microbiology and the National Antimicrobial Resistance Monitoring System (NARMS) are both led by Dr. Pat McDermott. General observations. The subcommittee was deeply impressed by the dedication to mission and quality science evidenced by the CVM and OR leadership and the OR scientists who participated in the site visit. The preparation for the site visit and the onsite briefings and tour were very informative and professionally done. The research campus is modern and well-maintained, providing a pleasant atmosphere for researchers and staff. The subcommittee felt an esprit de corps among the leadership team founded on mutual respect. Where it is appropriate, OR researchers strive to (and frequently succeed in) publishing research results in top tier journals in relevant disciplines. The knowledge and excellence of OR scientists are recognized by their peers outside of the CVM. For example, OR scientists now serve on the Editorial Boards of 9 scientific journals and their participation in international scientific meetings is actively sought such as the recent WHO consultation on the toxicity of melamine. The subcommittee was impressed by the changes and enhancements that OR has made to NARMS following the Science Board’s review of the program in 2007. The subcommittee has five general observations about the CVM/OR research planning process, research program and facilities which are discussed in this section and further elaborated in the three sections that follow. The general and specific observations form the factual basis in support of the subcommittee’s recommendations which constitute the final section of this report. 1. OR has a well-developed internal consultative process for developing the Three-Year Research Plan and has initiated an environmental scan to further assist in identifying emerging scientific and technological issues related to CVM’s mission; however, both activities would benefit from more active engagement with leading scientists and organizations in academia and industry. 2. Research resources and IT infrastructure are not commensurate with current responsibilities and the gap is growing. OR is dramatically under-funded with respect to the size of the regulated industry, the pace of scientific and technological change facing CVM, the unique nature of some research that OR undertakes to fill knowledge gaps related to companion animals in addition to minor uses and minor species, and benchmarked against other FDA centers. Recognition of the importance of minor use/minor species research and financial support is needed for this is an unfunded mandates and the need will continue to grow as evidenced by growth in aquaculture. 3. OR is the world’s leader in animal feed, drug, and regulatory science and US global leadership in this regulatory science is at risk. OR lacks flexibility to build capacity to advance and lead the new and emerging regulatory science questions and to address the big questions for today and tomorrow. 4. External communications beyond the scientific community are limited and therefore the overall visibility of research conducted within the OR is limited, relative to other federal laboratories, by several factors even though the research itself may be of high impact. 5. Balance in the OR research portfolio needs to be maintained – food safety, animal health, minor species, emergency response – and without additional funding this may be impossible. Emergency response, an important OR function, places unpredictable and sometimes sizable time and resource commitments on its scientists and budget. The result is sometimes substantial delays in fulfilling the research priorities identified in the Three-Year Research Plan. Research Planning Process The CVM research budget is $9.241 million under the FY 2009 omnibus appropriation, reflecting growth of almost $1 million over the 2008 actual of $8.274 million. However, this level of research funding is woefully inadequate by several benchmarks: the size of the regulated industry, CVM’s responsibility to conduct research on minor uses the minor species, the lack of any extramural research funds and in comparison to other FDA centers. Research Funding for FDA Center FY 08 Actuals FY 09 Omnibus $ FTEs %a $ FTEs % a CVM 8,274,000 56 5% 9,241,000 57 5% CDER 28,284,000 101 18% 27,096,000 102 14% CFSAN 35,020,000 143 23% 55,320,000 152 29% CBER 18,187,000 128 12% 18,825,000 128 10% CDRH 12,211,000 58 8% 18,992,000 78 10% NCTR 44,443,000 192 29% 52,511,000 198 28% OC 6,857,000 30 4% 6,985,000 40 4% ORA 1,100,000 7 1% 1,100,000 6 1% TOTALS 154,376,000 715 1.00 190,070,000 761 1.00 Data in this table was derived from the FY 2010 Congressional Justification Budget - Functional Activity Tables, pages 273-276 a% of each centers research budget compared to total Agency research budget Does not include FY 08/09 supplemental funding The primary purpose of CVM research is to support regulatory activities. Categories of research include: (1) support approvals of veterinary drugs including minor species (60%), (2) food safety issues pertaining to animal feeds, pet foods, aquaculture and antimicrobial resistance of food-borne pathogens (40%), and (3) emergency response pertaining to animal feeds, pet food, veterinary drugs, and aquaculture (15%). These allocations exceed 100% but they are what OR staff reported, reflecting the sense that emergency response is added on top of the existing research plan. The subcommittee was pleased to find that the CVM has a research planning process that helps to ensure the focus and attention of its research efforts. Yet, the subcommittee found that there were limitations to the current planning process and opportunities for further enhancement that could both improve the research enterprise at CVM and help achieve its critical animal and public health missions. Much of the research activities seem to be reactive based on input from primary drivers, i.e., ONADE and Office of Minor Use Minor Species. Input on food safety research planning is not well integrated into the CVM research planning model. Pet food safety and aquaculture food safety are major components of the CVM responsibilities but the NARMS program does not address fish and shellfish, including imports, and there are no baseline data regarding the prevalence and occurrence of Salmonella in pet foods. An important component of research planning is dissemination of results such as NARMS data to stakeholders. The public is an important stakeholder in the antimicrobial resistance issue. A mechanism should be in place to disseminate relevant research (NARMS) findings to the public. The research process of setting research priorities needs to be better connected to the needs of reviewers and compliance personnel. It would be helpful to better establish more routine and frequent interactions. In addition, the subcommittee was concerned that the process was almost exclusively internal without a formal mechanism for obtaining key stakeholder input from the regulated and associated industries such as from the veterinary pharmaceutical, aquaculture, animal feed and pet food industries. The entire research enterprise at CVM would benefit from an exchange of ideas and perspectives from the regulated communities. The emergency response research is reactive based on crises when they develop. The CVM research would be improved by establishing a formal mechanism for emergency response research planning or strategy for implementing emergency response research. While, it is difficult to achieve specific plans for emergencies, mechanisms such as scenario planning and environmental scanning can add insights and improve preparation for emergencies and unknown contingencies. CVM is blessed with some excellent researchers and scientists but, as a Center, is quite vulnerable because it lacks depth in critical positions and in subject matter experts. This vulnerability is likely to become more acute as the demand for new experts in cutting-edge science such as genomics and proteomics increases. This vulnerability is also compounded in that it may make it difficult to attain a critical mass when structuring research teams. The CVM research program could be greatly expanded and the quality of its research increased through the creation of an extramural research portfolio. When the Center obtained Critical Path Initiative funds, it was able to fund a group of extended research projects that added great value to its portfolio. In addition, such collaborations add further value through intellectual stimulation, professional development, and utilization of national assets to help focus on critical research needs. CVM research is conducted in the context of rapidly changing technology and new scientific breakthroughs. The researchers could benefit from participating in a series of high level science forums for the purpose of exchanging ideas, being exposed to new methods, considering new applications and stretching their intellect and vision toward new possibilities. These forums would be conducted to expand the horizon of regulatory research. Creativity and innovation are critical to all forms of research but especially where resources are limited. As CVM research grows in complexity and levels of sophistication, the demand to handle large data sets and analyze complex data greatly increases. The subcommittee was quite concerned that information technology and informatics support is not keeping up with research demands. The use of business applications to support unique research needs is not a useful model for researchers. Certainly, the capacity of scientific computing must be commensurate with researcher needs for special analysis and query. An essential part of research planning involves recruitment and retention of researchers themselves and the anticipation of future needs. While CVM has incorporated capacity building into their planning, more should be done to prepare for transitions, turnover, and especially recruiting the next generation of researchers and scientists with knowledge and skills reflected in tomorrow’s new science. In considering the future of CVM activities and research, globalization will more and more be a driving force. Although regulatory research is unique within CVM, there is a growing demand for similar methods development, techniques, and problem-solving internationally. Animal health is global, companies are international and food and feed safety are global goals. Thus, the subcommittee believes that there is real merit in establishing a global research consortium and a shared research portfolio where nonproprietary studies and research findings could be both shared and studies be planned to leverage global resources and experts especially with similar regulatory agencies in other countries. The subcommittee members were impressed with the commitment of research in support of minor species. This research serves the needs of many smaller industries and producers that, on their own, cannot fund this work. Although not a large part of the CVM research portfolio, the subcommittee believes that the research has had significant, yet, underappreciated return-on-investment and represents a critical investment to maintain and improve the health of many animal species and, in turn, also translates into a worthwhile public health endeavor. Research Program and Facilities The OR has an impressive record of productivity in providing important research support for the CVM. The scientific training of the research personnel is diverse and well suited to address scientific policy and regulatory issues that are relevant to the products that CVM regulates. Professional staffing at the OR, however, is below funded target levels for each of the three Office Divisions; currently a total of 5 vacancies for PhD level scientists exist within the OR. Recruitment of scientists is difficult because OR does not have the ability to directly hire scientific staff as direct hire authority is granted by series and not by office. However, the Office of Management has issued CVM-specific Open Continuous Vacancy Announcements for Biologists, Chemists, Microbiologists and Consumer Safety Officers (CSOs) which OR is taking advantage of. OR has previously had very limited involvement with screening and selecting applications for further evaluation.. This process is problematic because Human Resources staff members have little understanding of scientific terms, concepts, or methods that describe the candidates who must fill these critical positions. Such lack of scientific understanding often results in improperly screened applications with the result of severely limiting the pool of truly qualified applicants. OR would benefit tremendously if the human resource staff reviewing the OR applications received training and education regarding the needs and requirements of research scientist positions. This would greatly facilitate the hiring process for research scientist positions. Also, over time, unfilled positions create a perverse incentive not to fill them because the resources are used for instrumentation and other purposes in support of the current research program. Further, the Oak Ridge Institute for Science and Education (ORISE) program has proven to be an important resource to evaluate potential new hires on a trial basis. The rate-limiting factor of this productive program is the one-year ability to only fund one year at a time. Multi-year funding of the ORISE program would be most desirable but may require Congressional action. Another important issue affecting the OR’s ability to meet its obligations to CVM is the turnover of technical staff members to other offices within CVM. The turnover rate in scientific staff has increased from 3.4% in FY 2006 to 5.3% in FY 2008; however the turnover rate in FY 2009 has decreased to 3.7%. OR’s technical staff (BA, BS, MS) do have greater promotion potential outside of the laboratory depending on the position they are seeking (usually GS-12 vs. GS-13). Conversely, OR principal investigators are promotable to GS-15, or even Senior Biomedical Research Scientist (SBRS) based on the Agency Peer Review program which is used by all FDA centers. Scientists within the OR have excellent collaborative relationships with the University of Maryland, and both the USDA-ARS and CDC (through the NARMS program). These interactions have clearly allowed OR to leverage their existing resources effectively and the OR is encouraged to expand their network of collaborations with more academic institutions and international partners. Within the CVM, individual collaborations between scientists and reviewers among separate Offices (ONADE, OCS; ORA; CFSAN) appear to be excellent, yet formal consultations to communicate research needs occur only once a year. Collaborative research efforts with other governmental agencies such as the USDA-FSIS, the USGS, and the FWS exist, but the visibility of these collaborations is not great and the degree to which these collaborations influence research prioritization is not clear. The research facilities of OR are unique in that they provide the only large food animal research facilities in the Food and Drug Administration. Facilities for the conduct of large animal studies and aquaculture research are certified by the American Association for Accreditation of Animal Research and are appropriate for the mission of the research center. Laboratory spaces are sufficient to meet the current mission, but will require some renovations to keep pace with new technologies. Funding for major instrumental purchases has not been provided to OR as a line item; recent capital instrument purchases have been made through the use of salary-lapse monies. As the OR fills senior scientist vacancies and as these scientists initiate research programs, the opportunities to use salary-lapse dollars for instrument purchases will evaporate. The OR will be severely hampered in its ability to quickly and definitively respond to regulatory, animal safety, and food safety issues without the ability to plan for, and procure, the necessary scientific instrumentation. An immediate need within the OR facility is office space. An understandable reluctance to house post-doctoral and technical staff in laboratories has resulted in double and sometimes triple occupancy of offices constructed for single occupancy. On a short term basis, the willingness of staff to be accommodating is admirable, but on a long-term basis the ability to recruit and retain professional staff will be hindered by inadequate office area. The overall visibility of research conducted within the OR is limited, relative to other federal laboratories, by several factors even though the research itself may be of high impact. First, a portion of the research is targeted towards specific data needs of reviewers within ONADE or the Office of Surveillance and Compliance; some of these data will not be appropriate for publication. In some instances, OR projects will result in drug applications being carried forward and ultimately approved, but with little visibility to the OR. Secondly, research in support of regulatory actions that is conducted with proprietary compounds, devices, animals, or animal products cannot be published. Although the impact(s) of these research efforts may be profound for agricultural practices or the availability of agricultural products, the research itself will be invisible to the scientific community and the public in general. Finally, a large portion of the research is applied towards specific regulatory questions that may be fairly narrow and thus attract a narrow scientific audience. Recognizing these limitations, and time limitations on OR scientists caused by requests to participate in the regulatory review processes (either through data interpretation or requests for literature reviews), publication productivity within OR does not appear to be a concern. Research results are submitted to, and published in, quality journals appropriate for the science. Recognition of OR scientists outside of the CVM is exemplified by their inclusion on the Editorial Boards of 9 scientific journals and their participation in several international regulatory bodies. Pivotal regulatory studies completed within the OR are Good Laboratory Practices (GLP) compliant and an in-house Quality Assurance unit ensures confidence with respect to the integrity of data generated within the OR. Thus, the OR has established an infrastructure with which to maintain its reputation as a world leader in regulatory research and regulatory problem solving. Continuation and extension of this reputation will necessarily include greater input on research priorities and regulatory questions from academia, international bodies that use CVM regulations as a framework for their own regulatory decisions, and regulated industries. Due to the broad regulatory mission of the CVM, the Office of Research must stay current with respect to emerging technologies developed by regulated industries while concurrently maintaining expert competencies in established technologies. The capacity to meet these requirements is dependent upon program growth in emerging areas such as nano-technology, proteomics, genomics, and metabolomics. Critical for CVM’s mission, OR scientists must continue to be innovative and to creatively approach the regulatory problems that new technologies present. The capacity to continue such innovation is typically met by the infusion of new ideas through scientific exchange and through the selection of top-tier job applicants. Recent public health scares associated with melamine contamination of pet and livestock feeds illustrates CVM’s requirement to apply quick, innovative, and decisive science to animal health and food safety problems. The continued capacity to mount rapid responses to unforeseen problems is dependent upon the OR having a critical mass of well trained scientists who understand emerging technologies and who are equipped to deal with them. Response to Recommendations from Previous Reviews CVM-FDA underwent two Science Board reviews in 2007 that included components of activity relative to OR’s mission: 1.) April 2007 Subcommittee review of the “National Antimicrobial Resistance Monitoring System (NARMS) program,” and 2.) November 2007 Subcommittee on Science and Technology review “FDA Science and Mission at Risk.” As a component of the present CVM-OR review, we assessed CVM’s responses to these two reviews relative to areas pertinent to the mission of OR. NARMS Review: This program is a collaboration between CVM, USDA and CDC, with CVM’s responsibility being retail meats sampling. The main findings of the 2007 review related to concerns with sampling strategies, the need to conduct more extensive research studies, collaborate with international partners, and most importantly, improve data harmonization across the three federal partners and insure timely reporting. Considering budget constraints, CVM has responded admirably relative to its role in retail meat sampling. The present committee reiterated the need to increase number of states sampled, as well as consider sampling imported seafood and increasing the breadth of microbes assessed. A number of high-quality research programs have been conducted by CVM based on NARMS related projects, including method validation, assessing fluoroquinolone resistance in Campylobacter in poultry, and exciting work involved in characterizing the Salmonella genome and plasmid determinants of resistance as well as development of rapid detection bacterial DNA microarrays. These later projects are state of the art and pertinent to both OR’s food safety and animal health portfolios. A major focus of the original review was IT considerations involved in collecting, collating, integrating and accessing NARMS data. Significant progress has been made in integrating these data sets across agencies and improving user interface to serve the regulatory and science needs of CVM users. Importantly, functionality has increased to the point that ONADE antimicrobial drug reviewers can query susceptibility data in the process of reviewing new animal drug applications. This accomplishment epitomizes the utility of OR to the other traditional drug review and enforcement areas of CVM. Finally, a primary concern of the 2007 review was the excessive delay involved in including NARMS data in yearly reports. This delay has been drastically reduced from four to one years, although efforts should be made to reduce this even further to insure timely publication of these important results. In summary, CVM did an excellent job of responding to the major elements of this 2007 NARMS review. Science and Mission at Risk Review: This broad-based Science Board review assessed science and research across all of FDA including CVM, generating both general recommendations applicable to all Centers as well as CVM specific ones. The primary findings across FDA applicable to CVM related to the need to improve and take a leadership role on the science base of food safety, need for enhanced recruitment and retention of scientists, need for an independent CVM science officer and science review board to report back to the Chief Scientist in the FDA Commissioner’s office, drastic improvement in IT infrastructure across all Centers including CVM, and infusion of new funds above existing baseline budgets, a finding the subcommittee found especially applicable to CVM. A number of these items require financial resources to adequately address and/or actions in the Commissioner’s Office to establish the necessary infrastructure to implement (e.g. IT coordination, establishment of center-based Board of External Scientific Counselors - BESC). With changes in administration occurring in 2008, delay in implementation of some suggestions were inevitable. CVM has made excellent progress on addressing many of these issues. CVM has identified a Chief Science Officer and discussions have begun across Divisions to identify science-oriented activities. A BESC for CVM has not been established, however action by the new FDA Chief Scientist could facilitate this. Throughout our review of CVM-OR, it became clear that such an external advisory board would serve them well relative to providing external input into OR research activities, peer review of research plans, project progress and scientists career advancement. This goal should be a top priority in future years. Another area where significant progress has been made relates to improvement in IT infrastructure. NARMS IT issues were discussed above. CVM review functions will be moved from a paper to digital format, a process anticipated to be complete within two years. Because of the IT focus on record digitization and NARMS database management, efforts have not been specifically focused on OR IT needs peculiar to their research environment (e.g. chemistry, aquaculture, etc). Efforts need to be made to address these needs as the new IT infrastructure is implemented. Finally, as IT systems are put in place, efforts to strengthen bioinformatics support to analyze these data using cutting edge approaches should be strongly encouraged. The key CVM-specific recommendations in the 2007 review related to bolstering CVM scientific capability in areas of emerging product development and novel food safety contaminants, in modernizing and strengthening IT capability, and partnering with other FDA Centers and external partners. The excellent progress on IT support for NARMS has been discussed, however CVM needs to be actively engaged in the FDAwide IT planning to assure that OR’s research needs are met. CVM has made progress identifying areas of scientific expertise to strengthen (for example, in microbial genomics, milk proteomics, biomarkers of genetically engineered animals, novel contaminant identification and analytical methods for multi-residue screening) and in securing some positions for new hires. Attention to recruitment (as described in the prior section) is now needed. The actions that OR and CVM leadership have taken in these responses to the 2007 recommendations are commendable and should be strengthened to insure that CVM scientists retain leadership roles in these fields. An example of how quality science can lead to CVM international leadership is their work accomplished in identifying the mechanism behind melamine cyanuric acid crystalluria. Recruitment in some key areas is ongoing and CVM has benefited from the Commissioner Fellowship and ORISE fellows program. These efforts should be continued and expanded. Continued building of research capability in “omics” and developing nanotechnology expertise should be encouraged. The final area that does require further attention is closer collaboration with other FDA Centers and federal agencies in relevant research programs. For example, residue research programs could be coordinated across CVM, CDC, FSIS and ARS units. Bioinformatic work would benefit from NCTR input. External collaborations with universities should be expanded beyond local colleges where expertise in specific areas may be lacking. External input into and peer review of research should continue to be encouraged and financially supported. Recommendations • To provide the anticipatory, fundamental and applied regulatory research that CVM needs to fulfill its mission, OR’s planning process needs to be more open and inclusive, actively seek engagement with leading scientists and organizations in academia and industry, and be benchmarked against other organizations. OR science is looked to globally as the source of data and insights to inform regulatory decisions worldwide, yet OR scientists have only minimal contact with colleagues in other countries. Specifically, OR should consider the following: o Create opportunities to meet with and participate in scientific exchanges with the world’s experts from academia, other governmental organizations and industry to consider topics relevant to the research agenda for OR’s regulatory science mission. Mechanisms to engage in such dialogs that could be considered include convening periodic scientific symposia or seminars on topics of emerging science, food safety or animal health, utilizing one of the National Academy of Sciences forums in which FDA is already participating such as the Forum on Emerging Infectious Diseases or the Food Forum, or arranging scientific symposia prior to meetings of relevant Codex committees or in conjunction with other national or international meetings. o Conduct an environmental scan with a 5 to 10 year time horizon and with external input. CVM is currently conducting such an environmental organizational scan with 6-12 month time frame through interviews with the Center’s office directors and leadership teams. It will identify what’s on the horizon with respect to new technology, emerging science, the changing policy landscape, trends in the regulated industry and the economy and they how will affect CVM. An internal SWOT analysis will accompany the issues scan. The report is now being drafted, and was not available to the external review committee. On its completion, CVM leadership should consider the value of conducting a follow-on environmental scan with a longer time horizon and input from academia and industry to provide insights on emerging issues, science and technology and provide time to build anticipatory research plans. o CVM and OR would benefit from the direct advice of a Board of External Scientific Counselors, as recommended in November 2007 by the FDA Science Board in its report to the Commissioner entitled “FDA Science and Mission at Risk.” Its main role would be “to provide rigorous, ongoing review of science with the Center” (p. 37), and among its first assignments could be review and advise on the results of the environmental scans – both short and long-range – and OR’s plans. o OR should develop list of organization against which to benchmark its research planning process. Consideration should be given to other FDA Centers like CFSAN, other federal regulatory agencies like EPA, and similar organizations in other countries. o OR should establish a formal process to elicit intra- and inter-agency research needs in related to animal drugs (i.e., ONADE and the Office of Surveillance and Compliance) and food safety (i.e., CFSAN and FSIS). • OR’s research program deserves better financial and IT support. As the 2007 FDA Science Board recognized, FDA cannot fulfill its mission because its scientific base has eroded and its scientific organizational structure is weak (p. 3). The Science Board identified CVM as being particularly in need of infusion of new resources. o OR, with support from the FDA Chief Scientific Officer, should make establishment of a competitive, nationwide extramural research program a priority in the FDA budget request. An extramural research program would enable OR to be more nimble in responding to emerging issues, to develop and maintain a network of academic scientists who are familiar with the agency and its research needs, and would provide opportunities to identify young scientists as potential Fellows or new OR intramural Principal Investigators. o The Critical Path should continue to be open to CVM/OR priorities and research projects. OR scientists have successfully competed for Critical Path funding. This important mechanism should be expanded to include veterinary concerns, as recommended in the 2007 report of the FDA Science Board (p. 25). o CVM should actively participate in FDA’s IT initiatives to assure that OR’s needs are being recognized and addressed. o Resources made available to NARMS should be expanded to permit the program to address imports (e.g. seafood), include data from more states and more microbes, and to have the bioinformatics infrastructure required for more timely analysis and reporting. • Build capacity to advance and lead new regulatory science. o Build scientific capacity in critical research areas in omics and nanotech. OR has identified priorities for new hires. The Committee endorses these priorities and recommends that, as part of its environmental scan and longer-term research planning, that OR develop a longer-range scientific capacity building plan. o Implement a system for research project management, track projects and progress toward goals and include this information in OR’s annual research report. o OR should be given flexibility to improve recruitment and retention of research personnel. - The ORISE fellows program is of high value in identifying and placing new researchers in OR labs and access to the program should be maintained and expanded. - CVM should continue to take advantage of the current government-wide Direct Hire Authority for certain positions, so that it can go after the kind of scientists needed for its unique mission. • CVM and OR should develop a public face and communicate the value of their work in public health and animal health. o As part of its overall communications strategy involving traditional as well as new media (e.g. websites, Twitter, other media), CVM should consider how to give more visibility to the critically important role that OR plays in fulfillment of CVM’s mission. o In its annual research reports, OR should develop ways to describe the impact of its research in laymen’s language. This same information could be part of the feed of new information into CVM’s overall communications. • OR should strive to maintain a balanced portfolio of mission-relevant research responsive to stakeholders regulatory science needs and cognizant of the changing external environment. Because of its important mission to conduct research to address emergency situations, it is sometimes difficult for OR scientists to maintain steady progress on their annual research plans. o OR should consider establishing an emergency response research function to complement the proposed Veterinary Emergency Response Network (VERN). Thought should be given to how to maintain progress on ongoing research while key PI’s and research staff are pulled away to address a national emergency. o With the diversity of animal products in the food supply (e.g. goat meat, minor bird species) and the anticipated growth of aquaculture in the US and globally, it is important that OR maintain a viable minor use/minor species research program. The minor use/ minor species research program is unique to CVM and important to agriculture. Appendices 1. Charge to the Subcommittee 2. CVM Subcommittee to the Science Board Roster 3. Background Materials Provided to the Subcommittee Appendix 1: Charge to the Subcommittee FDA Center for Veterinary Medicine Research Program Review FDA’s Center for Veterinary Medicine (CVM) is a consumer protection organization that fosters public and animal health by approving safe and effective products for animals and ensuring the safety of animal food/feed. CVM’s Office of Research (OR) provides support to CVM’s program offices that is critical for enabling the Center to fulfill its mission. This support includes conducting applied research and providing scientific expertise to directly address scientific, policy, and regulatory issues that are relevant to the products that CVM regulates. To effectively meet its mission of providing scientific/research support to CVM, the OR has developed and implemented a planning process for its research programs and activities. This process involves an annual review and prioritization that includes input from OR scientists and managers, the other CVM offices, and external stakeholders. CVM’s Center Management Team reviews and signs-off on the plan. CVM believes the planning process for its research programs and activities has been very effective to date. This annual planning process leads to the development of the CVM Three-Year Research Plan. OR also reports annually on the progress of the research plan through the CVM Research Report. Overall CVM accomplishments are summarized in CVM’s Annual Report. Charge to FDA Science Board: The charge to the Science Board is to conduct a critical review of CVM research programs and the planning process that CVM has implemented for developing its Three-Year Research Plan. The agency requests additional input from the Science Board as to how the planning process for its research programs and activities may be improved. In particular, the Science Board is requested to review CVM’s current research program, most recent Three-Year Research Plan, and annual Research Report, to provide recommendation(s) regarding how CVM’s research planning process might be improved to most effectively utilize available resources and increase its research program capacity for supporting the approval of safe and effective products for animals and ensuring the safety of animal food/feed. Appendix 2: CVM Subcommittee to the Science Board Roster Chair Executive Secretary Catherine Woteki, Ph.D., R.D. Carlos Peńa, Ph.D., M.S. Expertise: Nutrition, Food Safety Senior Science Policy Analyst Global Director of Scientific Affairs 5600 Fishers Lane, Rm 14B-08 Mars, Inc. Rockville, MD 20857 6885 Elm Street Phone: (301) 827-6687 McLean, Virginia 22101 Fax: (301) 827-3042 Email: carlos.pena@fda.hhs.gov Science Board Members Subject Matter Experts Lonnie King, D.V.M., M.P.A. Michael Doyle, Ph.D. Expertise: Veterinary Medicine Expertise: Food Microbiology Director, National Center for Zoonotic, Regents Professor and Director Vectorborne, and Enteric Diseases University of Georgia Center for Food Center for Disease Control Safety 1600 Clifton Road, MS D-76 1109 Experiment Street Atlanta, GA 30333 Griffin, GA 30223-1797 Jim Riviere, D.V.M., Ph.D. Expertise: Pharmacology Burroughs Wellcome Fund Distinguished Professor, Director of CCTRP Department of Population Health and Pathobiology College of Veterinary Medicine North Carolina State University Box 8410 4700 Hillsborough St. Raleigh, NC 27606 David J. Smith, Ph.D. Expertise: Analytical Chemistry Research Physiologist USDA-Agricultural Research Service Biosciences Research Laboratory 1605 Albrecht Blvd Fargo, ND 58105 Lorraine M. Sordillo, Ph.D. Expertise: Proteomics Meadowbrook Professor Department of Large Animal Clinical Sciences College of Veterinary Medicine Michigan State University G300 Veterinary Medical Center East Lansing, MI 48824 Appendix 3: Background Materials Provided to the Subcommittee 1. CVM at a Glance 2. 2007 Science Board Report: http://www.fda.gov/ohrms/dockets/ac/07/briefing/2007-4329b_02_00_index.html 3. NARMS Report: http://www.fda.gov/ohrms/dockets/ac/07/briefing/2007- 4307b1_03_NARMS_Report.pdf 4. Research Program Reports: A. 2006 B. 2007 C. 2008 5. Research Plan 2009-2011 6. Slides: A. FDA Science Board Review of CVM’s Research Program B. Research in Support of the Center for Veterinary Medicine C. CVM Office of Research: Division of Animal Research D. Division of Residue Chemistry E. The Division of Animal and Food Microbiology F. CVM Strategic Recruitment Process: Finding the “Right” People CVM logo CVM AT A GLANCE --- MISSION STATEMENT: CVM is a consumer protection organization. We foster public and animal health by approving safe and effective products for animals and by enforcing applicable provisions of the Federal Food, Drug, and Cosmetic Act and other authorities. PHILOSOPHY: We are a high performance organization where stewardship of the organization belongs to everyone. Our success depends on hiring the right people, setting clear expectations and fostering everyone’s development so each one of our employees reaches their maximum potential. Through our vision and values we have become a Center of Excellence within FDA and our succession plan serves as a model for the rest of the Agency. CORE FUNCTIONS: • Animal Drug Review • Animal Feed Safety • Compliance-Related Actions • Post-Approval Monitoring WHO WE SERVE: Animal Drug Manufacturers (300); Feed Manufacturers (6,600); Livestock and Poultry Producers (over 1 million); Specialized Industry/Firms (a variety); 8.5 billion chickens & turkeys; 160 million cattle & pigs; 65 million dogs & 75 million cats, 9.5 million horses,11 million sheep & goats; other minor animal species and 300 million humans in the U.S. BUSINESS CHALLENGES: Food Protection/Import Strategy Animal Biotechnology (genetic engineering and cloning) Antibiotic Resistance (AR)/National Antimicrobial Resistance Monitoring System (NARMS) Unapproved Animal Drugs Animal Drug User Fee Act (ADUFA) Performance Animal Generic Drug User Fee Act (AGDUFA) Minor Use Minor Species (MUMS) Food and Drug Administration Amendments Act (FDAAA) of 2007 STAFF (FTE) FY 2009*: CVM 424; Field Resources 238 = Total 662 BUDGET ($000) FY 2009*: CVM Budget Authority $73,035 CVM User Fees $17,480** Field Resources (BA and UF) $43,829 Total $134,344 * Does not includes FY 08 Supplemental increase of $6,057,000 and 14 FTE **Includes user fee resources provided to CVM only. 1 Center for Veterinary Medicine 2006 RESEARCH REPORT 1 Center for Veterinary Medicine OFFICE OF RESEARCH FY06 ANNUAL REPORT TABLE OF C ONTENTS Table of Contents ............................................................................................................................ 1 About the Office of Research.......................................................................................................... 3 Mission..................................................................................................................................... 3 Research Capabilities................................................................................................................ 3 Facilities ................................................................................................................................... 3 Staff.......................................................................................................................................... 4 Office of Research Highlights....................................................................................................... 10 Division of Residue Chemistry (DRC) ................................................................................... 10 Division of Animal Research (DAR)...................................................................................... 14 Division of Animal and Food Microbiology (DAFM) ........................................................... 19 Premarket/Drug Review................................................................................................................ 22 Animal Drug Safety and Efficacy ........................................................................................... 22 Antimicrobial Resistance Mechanisms ................................................................................... 23 Immunopharmacology ............................................................................................................ 25 Metabolism and Residue Depletion ........................................................................................ 28 Method Trials: Chemical......................................................................................................... 29 Microbiological Methods........................................................................................................ 30 Pharmacokinetics/Pharmacodynamics....................................................................................32 Method Development in Support of Minor Use/Minor Species ............................................. 35 Compliance .................................................................................................................................. 37 Drug Residue Methods............................................................................................................ 37 Pharmacodynamics and Residue Depletion ........................................................................... 39 Method Trials and Validation ................................................................................................. 40 Incursion Services ................................................................................................................... 41 Post-Approval Monitoring ............................................................................................................ 42 PulseNet ................................................................................................................................ 42 Retail Meat Surveillance......................................................................................................... 43 ResistVet ................................................................................................................................ 44 Animal Feed Safety....................................................................................................................... 45 BSE—Detecting Prohibited Substances ................................................................................. 45 Surveillance Methods for Animal Feed .................................................................................. 46 Chemical Method Development ............................................................................................. 47 2 Leveraging FDA Resources...........................................................................................................48 Formal Activities .....................................................................................................................48 Informal Activities...................................................................................................................50 Accomplishments ..........................................................................................................................52 Publications.............................................................................................................................52 Presentations...........................................................................................................................57 Outside Reports .......................................................................................................................66 Professional Service.................................................................................................................66 Interns and Visiting Scientists .................................................................................................68 Other Events and Activities .....................................................................................................68 OR Final Report Summaries..........................................................................................................70 About the Office Of Research 3 Mission The Office of Research (OR) conducts applied and basic research in support of current and evolving FDA regulatory issues. We in partnership with federal and state agencies and other center customers provide research solutions that ensure the safety of animal-derived food and animal health products. Within OR, research is conducted by three Divisions: The Division of Residue Chemistry (DRC) conducts analytical research for compounds which pose a potential health risk if found in animal tissue or feed. The Division develops and validates methods for official and research uses. They determine the fate of xenobiotics in animals to answer questions about their safety or efficacy. The Division of Animal Research (DAR) conducts applied and basic research using animals and animal systems in support of current and evolving regulatory issues. They provide research solutions to issues of animal health, food safety of animal-derived products, and other animal industry associated technologies. The Division of Animal and Food Microbiology (DAFM) conducts basic and applied research involving the isolation, identification, and phenotypic and genotypic characterization of microorganisms potentially harmful to animals and humans. In particular, they explore the effects of antimicrobial use in animals on 1) efficacy against pathogens, 2) changes in the environmental microbial ecology, and 3) the development of antimicrobial resistance in pathogenic and commensal microorganisms. Research Capabilities The Office of Research is a multidisciplinary organization with scientists trained to conduct research in the broad areas of analytical chemistry, biochemistry, pharmacology, toxicology, immunology, microbiology, microbial genetics, animal nutrition, animal science, residue chemistry, and veterinary medicine. Facilities The Office of Research is housed in a state-of-the-art research complex located on 166.5 acres, including approximately 38 acres of pasture in Laurel, MD. The complex consists of offices, laboratories, animal research buildings and support facilities. The laboratories included in the complex are designed and equipped to conduct studies in biochemistry, microbiology, pharmacology, immunology, nutrition, toxicology and various aspects of aquaculture. Specific laboratory capabilities include a radioactive materials lab, mass spectrometry lab, genetic sequencing lab and analytical instrument rooms. The animal research buildings can accommodate a variety of animals such as cattle, both beef and dairy, calves, swine, sheep, poultry, and various fresh and salt water species of fish. The facilities also include surgical suites and recovery rooms for large animals. About the Office Of Research 4 STAFF DIRECTORY, SEPTEMBER 30, 2006 OFFICE OF THE DIRECTOR (HFV-500) Dr. Marleen M. Wekell, Acting Director 301-210-4136, marleen.wekell@fda.hhs.gov Dr. David B. Batson, Deputy Director (retired) Dr. David G. White, Research Microbiologist, Director of National Antimicrobial Resistance Monitoring System (NARMS) 301-210-4246, david.white@fda.hhs.gov Mr. O.J. Cartwright, Quality Assurance Officer 301-210-4219, orton.cartwright@fda.hhs.gov Ms. Carol Cope, Quality Assurance Officer 301-210-4243, carol.cope@fda.hhs.gov Mr. Bruce Bradley, Safety and Occupational Health Manager 301-210-4687, bruce.bradley@fda.hhs.gov Ms. Vivian Vontress, Management Officer 301-210-4153, vivian.vontress@fda.hhs.gov About the Office Of Research 5 Administrative Staff (HFV-506) Mrs. Denise Durham, Program Support Specialist 301-210-4186, denise.durham@fda.hhs.gov Ms. Ettie Karpman, Secretary 301-210-4138, ettie.karpman@fda.hhs.gov Mr. Neil Schibblehut, Model Maker 301-210-7852, neil.schibblehut@fda.hhs.gov Mr. John Schrider, Maintenance Mechanic 301-210-7853, john.schrider@fda.hhs.gov Ms. Katie Orr, Program Support Assistant 301-210-4139, katie.orr@fda.hhs.gov DIVISION OF RESIDUE CHEMISTRY (HFV-510) Mr. Michael H. Thomas, Director 301-210-4650, michael.thomas@fda.hhs.gov Analytical Methods Team (HFV-511) Dr. Philip J. Kijak, Team Leader 301-210-4589, philip.kijak@fda.hhs.gov Dr. Mary Carson, Chemist 301-210-4651, mary.carson@fda.hhs.gov Mr. David N. Heller, Research Chemist 301-210-4579, david.heller@fda.hhs.gov Dr. Hui Li, Staff Fellow 301-210-4271. hui.li@fda.hhs.gov Ms. Cristina Nochetto, Chemist 301-210-4184, cristina.nochetto@fda.hhs.gov Ms. Shani Smith, Chemist 301-210-4242, shani.smith@fda.hhs.gov Metabolism and Diagnostic Team (HFV-512) Dr. Jurgen von Bredow, Team Leader 301-210-4652, jurgen.vonbredow@fda.hhs.gov About the Office Of Research 6 Dr. Pak-Sin Chu, Research Chemist 301-210-4583, pak.chu@fda.hhs.gov Dr. Mayda Lopez, Chemist 301-210-4587, mayda.lopez@fda.hhs.gov Mr. Nathan Rummel, Chemist 301-210-4289, nathan.rummel@fda.hhs.gov Dr. Badaruddin Shaikh, Research Chemist 301-210-4653, badaruddin.shaikh@fda.hhs.gov Ms. Michelle Smith, Chemist 301-210-4581 michelle.smith1@fda.hhs.gov DIVISION OF ANIMAL RESEARCH (HFV-520) Dr. Russell A. Frobish, Director 301-210-4683, russell.frobish@fda.hhs.gov Mrs. Christie-Sue Cheely, ORAU Fellow 301-210-4094, christie.cheely@fda.hhs.gov Mrs. Jamie Boehmer, Biologist 301-210-4281, jamie.boehmer@fda.hhs.gov Mrs. Dorothy Farrell, Microbiologist 301-210-4470, dorothy.farrell@fda.hhs.gov Mr. Charles Gieseker, Biologist 301-210-4217, charles.gieseker@fda.hhs.gov Ms. Karyn Howard, Biologist 301-210-4244, karyn.howard@fda.hhs.gov Ms. Yolanda Jones, Biologist 301-210-4135, yolanda.jones@fda.hhs.gov Dr. Joseph C. Kawalek, Research Chemist 301-210-4296, joseph.kawalek@fda.hhs.gov Mr. Ron Miller, ORAU Fellow 301-210-4762, ron.miller@fda.hhs.gov About the Office Of Research 7 Dr. Michael J. Myers, Research Pharmacologist 301-210-4355, michael.myers@fda.hhs.gov Dr. Renate Reimschuessel, Research Biologist 301-210-4024, renate.reimschuessel@fda.hhs.gov Dr. Michael L. Scott, Staff Fellow 301-210-4218, michael.scott@fda.hhs.gov Dr. Jeffrey L. Ward, Veterinary Medical Officer 301-210-4216, jeffrey.ward@fda.hhs.gov Mrs. Jewell Washington, Biologist 301-210-4245, jewell.washington@fda.hhs.gov Dr. Haile Yancy, Staff Fellow 301-210-4096, haile.yancy@fda.hhs.gov Animal Care and Use Staff (HFV-521) Mr. Mark Henderson, Biological Science Technician 301-210-4681, mark.henderson@fda.hhs.gov Mr. Samuel Howard, Animal Caretaker 301-210-7830, samuel.howard@fda.hhs.gov Mr. Mark McDonald, Animal Scientist 301-210-4658, mark.mcdonald@fda.hhs.gov DIVISION OF ANIMAL AND FOOD MICROBIOLOGY (HFV-530) Dr. Robert D. Walker, Director (retired) Microbiology and Molecular Biology Team (HFV-531) Dr. Shaohua Zhao, Team Leader 301-210-4472, shaohua.zhao@fda.hhs.gov Mr. Jason Abbott, Microbiologist 301-210-4185, jason.abbott@fda.hhs.gov Mrs. Karen Blickenstaff, Microbiologist, 301-210-4761, karen.blickenstaff@fda.hhs.gov About the Office Of Research 8 Mrs. Sonya Bodeis-Jones, Microbiologist 301-210-4251, sonya.bodeis@fda.hhs.gov Mrs. Peggy Carter, Microbiologist 301-210-4256, peggy.carter@fda.hhs.gov Mrs. Patricia Cullen, Microbiologist 301-210-4132, patricia.cullen@fda.hhs.gov Mrs. Sharon Friedman, Microbiologist 301-210-4249, sharon.friedman@fda.hhs.gov Mrs. Althea Glenn, Staff Fellow 301-210-4214, althea.glenn@fda.hhs.gov Ms. Susannah Hubert, Microbiologist 301-210-4473, susannah.hubert@fda.hhs.gov Dr. David Wagner, Animal Scientist (retired) National Antimicrobial Resistance Monitoring System (NARMS) Team (HFV-532) Dr. Patrick McDermott, Team Leader 301-210-4213, patrick.mcdermott@fda.hhs.gov Mrs. Sherry Ayers, Microbiologist 301-210-4268, sherry.ayers@fda.hhs.gov Mrs. Linda English, Microbiologist 301-210-4585, linda.english@fda.hhs.gov Mr. Stuart Gaines, Microbiologist 301-210-4294, stuart.gaines@fda.hhs.gov Dr. Elvira Hall-Robinson, Epidemiologist 301-210-4255, elvira.hall-robinson@fda.hhs.gov Dr. Heather Harbottle, Staff Fellow 301-210-4246, heather.harbottle@fda.hhs.gov Ms. Brenda Kroft, ORAU Fellow 301-210-4265, brenda.kroft@fda.hhs.gov About the Office Of Research 9 Mr. Shawn McDermott, Microbiologist 301-210-4267, shawn.mcdermott@fda.hhs.gov Dr. Terry Proescholdt, Epidemiologist 301-210-4023, terry.proescholdt@fda.hhs.gov Mrs. Sadaf Qaiyumi, Visiting Scientist 301-210-4350, sadaf.qaiyumi@fda.hhs.gov Ms. Amanda Stearns, ORAU Fellow, 301-210-4763, amanda.stearns@fda.hhs.gov Dr. Siddhartha Thakur, Visiting Scientist, 301-210-4264, siddhartha.thakur@fda.hhs.gov Dr. Loretta Walker, Veterinary Medical Officer 301-210-4350, loretta.walker@fda.hhs.gov Contact Information For more information about the Office of Research and its programs contact: Dr. Marleen M. Wekell, Acting Director, Office of Research 301-210-4136, marleen.wekell@fda.hhs.gov Mr. Michael H. Thomas, Acting Deputy Director, Office of Research 301-210-4650, michael.thomas@fda.hhs.gov Dr. Russell A. Frobish, Director, Division of Animal Research 301-210-4682, russell.frobish@fda.hhs.gov Dr. Philip J. Kijak, Acting Director, Division of Residue Chemistry 301-210-4589, philip.kijak@fda.hhs.gov Dr. Patrick McDermott, Acting Director, Division of Animal and Food Microbiology 301-210-4213, patrick.mcdermott@fda.hhs.gov Dr. David G. White, Research Microbiologist, Director of National Antimicrobial Resistance Monitoring System (NARMS) 301-210-4181, david.white@fda.hhs.gov Office Of Research Highlights 10 Introduction The Office of Research (OR) is the laboratory-based research arm of the Center for Veterinary Medicine (CVM), Food and Drug Administration (FDA). OR’s research priorities are ever changing, being driven by the needs of other CVM offices – i.e., the Office of New Animal Drug Evaluation (ONADE), the Office of Minor Use Minor Species (MUMS) and the Office of Surveillance and Compliance (OSC) and by FDA-wide requirements to thoroughly address the latest food and drug safety concerns. To meet these needs, OR is staffed by researchers with diverse scientific backgrounds – microbiology, biochemistry, toxicology, analytical chemistry, pharmacology, veterinary science, etc. – as well as scientists with specialized training e.g., aquatic science specialists and antimicrobial resistance geneticists. In this section the recent OR studies included are organized by the three OR Divisions in which they were conducted – Division of Residue Chemistry (DRC), Division of Animal Research (DAR) and Division of Animal and Food Microbiology (DAFM). Division of Residue Chemistry OR’s Division of Residue Chemistry (DRC) has been responsible for developing and validating monitoring methods used in FDA’s highly effective milk safety program. More recently, DRC has focused on developing methods to measure drug residues in aquacultured species and honey. DRC scientists are developing data to correlate the concentration of drug in fluids such as plasma and urine to the drug concentration in tissue. The information can be used to develop more efficient monitoring programs for drug residues in animals at or prior to slaughter. Nitrofurans: Nitrofurans are broad-spectrum antibacterial drugs highly efficacious in the treatment of protozoan and bacterial infections in both humans and animals. Their therapeutic uses date back to the 1940s. Because of their carcinogenicity and mutagenicity, nitrofurans have been banned for use in food-producing animals in many countries. In spite of the ban, nitrofurans continue to be of regulatory concern, as they are still being illegally used worldwide. To address such concerns, DRC scientists have developed methods for determination of bound residues of nitrofurans in shrimp and in channel catfish. In the past year, our efforts have been directed to the development of two methods, one for honey and one for milk. Despite differences in the details of sample clean-up, the methods involve an overnight acid hydrolysis and simultaneous derivatization of the released side-chain metabolites to their nitrophenyl derivatives followed by LC-MS/MS determination. The attached figure illustrates these reactions for semicarbazide (SC), a side-chain residue of Office Of Research Highlights 11 nitrofurazone. Using this approach, OR scientists can confirm and quantitate nitrofuran residues down to 1 ppb. NH2 O N H N H NH2 O N H H2N SC protein acid hydrolysis 37 şC NH2 O N H H2N 37 şC derivatization NO2 NH2 O N H N NO2 CHO + SC 2-NBA NPSC A B Among the matrices we have worked with, honey presents the greatest challenge. The reasons are: 1) honey is a complex matrix and exhibits diverse compositions and characteristics, 2) matrix effect is a serious problem, as it can enhance or suppress the analyte responses upon mass spectrometric ionization, and 3) the time frame to perform the bee dosing experiments is limited to the nectar flow seasons in spring. Despite these challenges, DRC scientists have successfully developed and validated a method for nitrofuran residues in honey. Such accomplishment demonstrates a collaborative effort among the Division of Residue Chemistry of the Center for Veterinary Medicine, the Bee Research Laboratory of the United States Department of Agriculture, and the South Eastern Regional Laboratory of the Office of Regulatory Affairs. In addition to method development, DRC scientists have collaborated with the Gulf Coast Seafood Laboratory (GCSL), Center for Food Safety and Nutrition (CFSAN) to conduct a depletion study for nitrofurans in channel catfish. This study examines the depletion rates of both parent compounds and protein-bound residues of four nitrofuran drugs (furazolidone, nitrofurazone, furaltadone, and nitrofurantoin) in edible tissues of channel catfish. Dosing was performed at GCSL, where channel catfish were orally dosed with individual nitrofuran drugs. Tissues were collected at various time points from 2 hours to 56 days post-dose. Bound residues of nitrofurans were determined by DRC scientists using a previously validated LC-MS/MS method, and assays for the parent nitrofurans were conducted by GCSL scientists using a published method. USDA approved meat safe for human consumption is not allowed to contain drug residues above a defined tolerance level in the tissue. The ability to predict the correct time to slaughter a drug treated bovine, so Office Of Research Highlights 12 that the drug residues will meet the tolerance requirement, will prevent the discard and needless loss of food animals. Since tissue samples cannot be obtained from the live bovine to determine when the drug-tissue levels have decreased sufficiently to slaughter the animal, a more accessible biological fluid sample must be obtained. The drug concentration in the biological fluid sample may be used to predict the drug concentration in the tissue of the live animal. Animals in which the predicted tissue concentration is greater than tolerance can be withheld from slaughter until the analysis of additional biological fluid samples indicates that the drug concentration in the kidney tissue will be acceptable. The ability to predict the correct drug-tissue concentration based on the drug level in the biological fluid sample will depend on the establishment of a consistent relationship between the drug in the fluid and the drug in the tissue over an extended period of time. The existence of a consistent relationship can be used to predict the concentration of drug in the tissue of the live animal before slaughter to a level in a biological fluid. Ultimately the target level in the biological fluid may be detected with a specific rapid drug screening test kit. The biological fluid will be collected from the live animal and evaluated with the rapid drug screening test kit. A positive response will indicate that the drug has not been sufficiently eliminated and the animal must wait another period of time before slaughter. A negative response will designate that the drug residue tissue concentration will be below the tissue tolerance level and the animal may safely be slaughtered at this time. Sulfonamides are among the oldest, but still effective, antibiotics used in veterinary medicine. In steers and dairy cows, sulfadimethoxine is effective in the treatment of respiratory infections and is approved with a tolerance of 100 ppb in edible tissues. Sulfadimethoxine residues above this tolerance in the tissues of the slaughtered animal may lead to the wasteful loss of the entire carcass. The sulfadimethoxine would readily have been eliminated to below tolerance levels if the time to slaughter would simply have been delayed for several more days. The kidneys and the liver are the primary regulatory monitoring sites for the presence of drug residues in slaughtered animals. Correlations between the drug residue concentration in these tissue sites and the concentration of the same residues in the urine, plasma and saliva are needed in order to use one or more of the biological fluid concentrations to estimate the concentration in the kidney and/or liver. Multiple biological fluid samples may be collected at various time periods following the final dose of a drug regimen, but kidney tissue and liver tissue can only be collected at the slaughter of the animal. Recently, laparoscopic techniques have been employed to obtain small pieces of kidney and liver tissue at same time as the biological fluid samples to Office Of Research Highlights 13 significantly improve the statistical validity of the estimated tissue concentration from a small number of animals. The graph illustrates the simultaneous pharmacokinetic sulfadimethoxine elimination in the kidney and liver tissues and the corresponding elimination in the urine, plasma and saliva. At the edible tissue tolerance concentration of 100 ppb it is possible to use the graph to estimate concentration of sulfadimethoxine in the urine (700 ppb), plasma (400 ppb) and saliva (30 ppb). Conversely, the determination of a sulfadimethoxine concentration of less than 700 ppb in urine, less than 400 ppb in plasma and less than 30 ppb in saliva, will indicate that the kidney tissue and the liver tissue concentration is less than the tolerance concentration of 100 ppb. Statistical evaluation of the tissue-fluid correlation can provide greater confidence in the assurance of always defining animals with regulatory tissue levels which are below tolerance at the time of slaughter. Rapid screening tests can be designed to respond to specific concentrations of sulfadimethoxine in urine, plasma or saliva which will ensure a less than tolerance concentration in kidney and liver tissues of the live steer before it is slaughtered. Sulfadimethoxine Correlation Kidney, Liver, Plasma, Urine and Saliva 1 10 100 1000 10000 100000 0 20 40 60 80 100 120 Time in Hours Log Sulfadimethoxine ppb pp liver kidney urine plasma saliva Office Of Research Highlights 14 Division of Animal Research (DAR) During the past year, the Division of Animal Research has conducted research in support of the pre-market and post-market programs of the Center. The research efforts are designed to provide information for assessing the safety and efficacy of drugs, to support the preparation of guidance documents, to develop analytical methodology necessary to support the Agency’s Feed Ban, to evaluate the usefulness of commercially available test kits for detecting prohibited animal proteins in animal feed, and to support the Minor Use/Minor Species program. Aquaculture Farm raised fish are increasingly becoming an important source of food, especially as wild caught fish harvests are declining. As aquaculture production increases in the United States, so too does the need for safe and effective aquatic animal therapeutics. Recently the Minor Species Minor Uses Animal Heath Act was passed to encourage the development of drugs for minor species, such as fish. DAR scientists conduct studies to support new drug development while assuring food safety. During FY06, DAR scientists used aquatic animal models of diseases to examine the efficacy, safety, environmental fate and residue levels of compounds that may be used during fish farming. We modified a fungal disease model for trout to produce the disease in catfish. Since fungal diseases are opportunistic pathogens, a series of stressors is needed to induce disease. In trout, normally cold temperature fish, one of these stressors is warming the water. For catfish, the stressor was modified, cooling the fish to make them more susceptible to disease. The new disease model will be used in 2007 to conduct a GLP study in catfish to determine the efficacy of formalin to reduce mortalities associated with fungal (Saprolegnia sp.) infections. We continued evaluating the in vivo and in vitro effects of anthelmintic drugs on Alcopenteron ureterectes (a renal parasite) in largemouth bass. The disease model was developed at OR, and our laboratory is the only facility in the United States that has a population of largemouth bass propagating this experimental infection. These studies are designed to develop protocol methods for studies of anthelmintic efficacy. Such studies will help FDA scientists develop guidance for sponsors developing anthelmintic drugs The Phish-Pharm Database was published on line, (http://www.aapsj.org/view.asp?art=aapsj070230 ). It is available as an Excel file, and Access database file and a stand alone database package. This relational database provides information on pharmacokinetic parameters in fish, providing rapid access to data about drug and chemical half-lives in fish tissues. The data can be sorted and rapidly Office Of Research Highlights 15 retrieved, identifying not only the residue levels in a particular species of fish, but the experimental conditions such as temperature, salinity and duration of exposure. This database is a valuable tool for both regulators and researchers of aquatic therapeutics. DAR scientists developed two guidelines for antimicrobial testing of aquatic bacteria. These standards, a result of a world wide collaboration coordinated by CVM, are the first Clinical Laboratory Standards Institute (CLSI) standards for aquatic bacteria. The guidelines Guideline (M42-A) and Guideline (M49-A) were published in August and will facilitate comparison of inter-laboratory results and help CVM monitor the influence of antimicrobials in the aquatic environment. In 2006 OR scientists used those methods to begin collecting data that could be used in the process of developing interpretive criteria for antimicrobials used against aquatic microorganisms. Two methods for assaying oxytetracycline (OTC) in fish blood were developed, an HPLC method and a microbiological assay (to show biological activity). In addition, OR scientists developed a model for furnunculosis in trout to examine the pharmacokinetics of OTC in diseased fish. These methods will help FDA begin to establish breakpoints for aquatic animal drugs. Office Of Research Highlights 16 BSE—Methods for Detecting Prohibited Materials As a consequence of discussions with analysts in FDA’s Office of Regulatory Affairs who conduct polymerase chain reaction (PCR) analyses of animal feed, we modified our research activities on the development of a real-time PCR method. An integral component of this activity is an effort to simplify further the entire procedure from start to finish, thus making it very user friendly. We have identified primers for the appropriate species and are working on combining all components of the procedure, excluding the actual instrumentation part, into a single package. Once we have completed the in-house evaluation of this third generation PCR method, we will conduct a validation study. Pharmacokinetics/ Pharmacodynamics Drug sponsors are responsible for submitting studies to prove their drugs are safe and effective. Complementary work – accomplished by CVM, its contractors and collaborators may alter the type and number of studies required for approvals, thus improving the efficiency of the drug approval process. An example of this is a pharmacokinetics/ pharmacodynamics program to assess the effects of drugs in diseased animals, an important contribution because most data submitted to CVM are generated in healthy animals. In a follow-up to a previous PK/PD study of enrofloxacin in beef steers, preliminary analysis of data from seven animals has demonstrated that the instillation of sterile saline or culture medium (the "carrier" used to introduce the bacteria into the lung in the infection model) had no effect on plasma or bronchial fluid pharmacokinetics of the drug. Data from this study will be combined with some of the data from the previous enrofloxacin study, which utilized the infection model, to document the bronchial fluid levels of the drug and the impact of infection on PK parameters. These results are currently being prepared for publication. Also, we are continuing to analyze the data from a pilot PK/PD study of tilmicosin (a macrolide antibiotic) administered subcutaneously to beef steers, both in the healthy state and following induction of pneumonia with Mannheimia haemolytica. Results of this study will be used to plan a larger study of the effects of infection on active levels and disposition of tilmicosin. Office Of Research Highlights 17 Immunopharmacology A pilot study was conducted to develop procedures for a more formal investigation into the effects of endotoxin contamination of pharmaceuticals on animal health. Temperature is an important early indicator of animal health; however, it is difficult to accurately measure small changes in temperature in food producing animals. In this study, animal telemetry was used to collect both core body temperature (surgically implanted bovine sensor) and heart rate (belt around girth) of Holstein steers. Measures were recorded locally on ambulatory data recorders attached to each steer and to a base station where researchers can carefully monitor animals in real-time. Body surface heat was measured using infrared technology (thermography; infrared camera) concentrating mainly on soft tissues near the head region (e.g., tear ducts, nostrils, and primarily ears). A second form of telemetry was adopted which involved glued temperature patches placed in the inside ear to take minute by minute measures for 12-hrs along with infrared images to compare results. These devices were investigated prior to the formal study to assure best methodology for detecting changes in animal health and temperature. . Office Of Research Highlights 18 Division of Animal and Food Microbiology (DAFM) The Division of Animal and Food Microbiology conducts basic and applied microbiological research in support of the Center’s pre-marketing and post-marketing regulatory responsibilities. This research includes: developing standards for measuring the efficacy of anti-bacterial agents; surveillance of retail meat commodities for antimicrobial-resistance among foodborne bacteria; monitoring of animal feeds and animal production environments for the prevalence and dissemination of select enteric bacteria, including the emergence and spread of antimicrobial resistance among potential food-borne pathogens; and using DNA fingerprinting and other phenotypic and genetic markers to determine the source and relatedness of enteric pathogens isolated from humans and food animals. DAFM has initiated and collaborates on a number of research studies, both internally- and externally-funded, that are aimed at developing approaches to support the safe use of antimicrobial agents in food animals. This research has multiple focuses. Standardized Susceptibility Testing Methods These include the development of standardized testing methods to ensure the intra- and inter-laboratory reproducibility of data generated from antimicrobial susceptibility testing. Standardized methods ensure that data can be compared over time between different testing laboratories. DAFM research also focuses on strategies designed to understand the mechanisms and dissemination of antimicrobial resistance in order to prolong the use of antimicrobial drugs as therapeutic agents and reduce the prevalence of antimicrobial resistant bacteria throughout the food production continuum. Standardized in vitro antimicrobial susceptibility testing methods are important to the FDA, both for food safety surveillance purposes and for ensuring the reliability of data submitted to the Agency by drug sponsors. In 2006, DAFM scientists completed a multi-laboratory study to standardize an in vitro antimicrobial resistance screening method for Campylobacter based on disk diffusion. This study showed that standard disk masses resulted in no zones of bacterial growth inhibition for strains resistant to erythromycin or ciprofloxacin, the two recommended antimicrobials for treating campylobacteriosis. This method has been incorporated into the CLSI M45-P document. Office Of Research Highlights 19 Source Tracking For food-borne bacteria, identifying the source of contamination is an essential first step in preventing human infections. Moreover, it is important to determine whether the source of contamination is of human, environmental, or animal origin. Each year, it is estimated that there are approximately 76 million food-borne infections leading to 325,000 hospitalizations in the United States. With the large toll attributed to these food-borne pathogens, many of which are associated with food animal products, a reliable method to identify the origin of the pathogen would help target control measures to improve food safety. The objective of this ongoing study is to utilize genetic and biochemical methods to determine the animal origin of Campylobacter and Salmonella isolates. Data from this study will be an important element in determining if the emergence of Campylobacter or Salmonella in humans is due to the transfer of these pathogens from particular animal groups, or whether they exhibit a weakly clonal population structure with no animal host specificity. Furthermore, these studies will help to monitor the safety of the U.S. food supply by determining the influence of agricultural practices on the development of antimicrobial resistance in different use environments. PulseNet PulseNet, the national molecular subtyping network for food-borne disease surveillance, was established in 1996 through a collaborative effort of CDC, FDA, USDA and state health departments. The program uses pulsed-field gel electrophoresis (PFGE) as the DNA fingerprinting method to identify the source of food-borne illness outbreaks. PulseNet has already been highly successful in preventing and reducing food-borne outbreaks. CVM’s efforts as part of PulseNet focus on characterizing bacterial strains obtained from food-producing animals and retail meats. Data from these samples provide a critical link with NARMS, a surveillance program that monitors trends in antimicrobial susceptibility (see below). The PulseNet database represents a powerful epidemiological tool to conduct trace-back studies during outbreaks of food-borne illness, leading to faster intervention and establishment of control measures. Office Of Research Highlights 20 PFGE and Antimicrobial Resistance Profiles in Salmonella Typhimurium In CVM, PulseNet-related accomplishments in 2006 included subtyping of more than 1,000 Salmonella, E. coli, and Campylobacter isolates recovered from food animals, retail meats and human by PFGE. More than two thousand Salmonella and Campylobacter isolates were analyzed by PFGE using second enzyme. Our data show that multi-drug resistant Salmonella serotypes other than Typhimurium and Newport, such as Agona, Uganda, Dublin, and Heidelberg, etc., have emerged in the United States. Results demonstrated that resistant isolates spread between animals and humans. The research supports the conclusion that for foodborne bacteria isolated from a food animal or its derived meats, which show indistinguishable DNA fingerprints patterns from a human isolate, the animal or meat can be considered as the source of the human outbreak. The PulseNet data base also will allow CDC and CVM to monitor emerging of multi-drug resistant (MDR) food-borne pathogens in the United States, and to understand how bacterial antimicrobial resistance develops, disseminates, and persists in the animal production environment, retail foods and how such pathogens contribute to human illness. To date, CVM PulseNet database has more than 7,000 data entries, which include 4,015 Salmonella, 432 E. coli, 2,646 Campylobacter, and 69 Vibrio. Office Of Research Highlights 21 NARMS Contamination of foods destined for human consumption is a major concern for the Food and Drug Administration, the Center for Disease Control and Prevention and the U.S. Department of Agriculture. In 1996, these three government agencies initiated a program to monitor Salmonella, Campylobacter, Escherichia coli and Enterococcus isolated from cattle, pigs, chickens and turkeys and to compare the serotype and/or antibiogram of these bacteria to bacteria of the same species isolated from humans. In 2002, the program was expanded to include the sampling of select retail meats from cattle, pigs, chickens, and turkeys. The retail meat component is made possible through the CDC, which contracts with 10 state public health laboratories to collect ground beef and ground turkey, pork chops, and chicken breasts from local food markets in their respective states. These samples are then processed by each state laboratory using the same methods for the isolation and identification of Salmonella and Campylobacter (four sites are also isolating and identifying Escherichia coli and Enterococcus). In 2006, nearly 4800 meats were cultured. Once identified, the isolates are sent to the Office of Research where their identity is confirmed and they are subjected to antimicrobial susceptibility tests. Salmonella and Campylobacter are also analyzed by PFGE, and the patterns are submitted to PulseNet. In addition to processing the isolates from the retail meats, the Office of Research also monitors the quality of data generated by the participating laboratories through training and quality control testing. Premarket/Drug Review 22 Animal Drug Safety & Efficacy INTRODUCTION. The mission statement for Agency research states “FDA uses innovative science-based decision making to efficiently evaluate and make available beneficial new products, to develop sound safety standards and guidance, and to rapidly identify and address emerging public health needs.” Research at OR enables the Center to resolve regulatory issues in the area of animal drug safety and efficacy on a scientific basis. IMPACT. Results of these investigations provide pivotal data to support the approval of selected drugs for use in aquatic species. This provides safe and effective drugs to an industry with limited availability of approved drugs with other species. Other research with terrestrial species is designed to develop models for conducting safety and efficacy studies. This work may alter the types and number of studies required, or identify the end points for demonstrating safety or efficacy, thus improving the efficiency of the drug approval process. ACCOMPLISHMENTS • We developed a catfish fungal disease model in support of INAD 011365. This model will be used in a GLP study to determine if formalin treatments will reduce mortality associated with fungal (Saprolegnia) infections in channel catfish. The GLP study will be conducted in FY 07. • We conducted and reported our findings of three drugs tested in vitro against a monogenean in largemouth bass kidneys. We continue to maintain a population of largemouth bass infected with the renal parasite Alcopenteron ureterectes, the only documented laboratory infection model of this parasite. Such studies are important for developing guidance for sponsors of potential anthelminitic drugs to treat internal fish parasites. • FDA is becoming increasingly concerned about the effects of pharmaceuticals in the environment. We presented data showing the accumulation of oxytetracycline in a model “not-target” species of aquatic algae Chlamydonomonas reinhardtii. OTC could be identified in discrete fluorescent foci within the algae for up to seven days post dosing. Since algae are consumed by pond raised fish and sometimes they are raised for human consumption, it is important to determine how antimicrobial use will affect their growth and to what extent the compound may accumulate in these organisms. • We published the PhishPharm pharmacokinetic database on line (http://www.aapsj.org/view.asp?art= aapsj070230). It is available as an Excel file, an Access database file and a stand alone database Premarket/Drug Review 23 package for those who do not have the Microsoft Access program. Phish-Pharm includes information from over 400 articles and provides rapid access to data about drug and chemical half-lives in fish tissues. The data can be sorted and rapidly retrieved, identifying not only the residue levels in a particular species of fish, but the experimental conditions such as temperature, salinity, and duration of exposure. This database is a valuable tool for both regulators and researchers of aquatic therapeutics. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Antimicrobial Resistance Mechanisms INTRODUCTION. CVM collaborates on and has initiated a number of research studies, both internally and externally-funded, aimed at developing approaches to support the safe use of antimicrobials in food animals. This research focuses on strategies designed to provide greater understanding of the mechanisms of antibiotic resistance in order to prolong the use of antimicrobial drugs as therapeutic agents and reduce the prevalence of antibiotic resistant bacteria throughout the food production continuum. IMPACT. The data from these projects help to define the genetic elements in bacteria isolated from animals that contribute to the emergence and spread of antimicrobial resistance. ACCOMPLISHMENTS • CVM is investigating molecular typing tools to help determine the animal origin of food-borne bacterial pathogens. To date, over 3000 isolates representing strains of Salmonella and Campylobacter have been characterized using a combination of two or more of the following methods: antibiotic susceptibility testing (AST); serotyping, plasmid profiling; pulsed-field gel electrophoresis (PFGE) using single and multiple enzymes; repetitive element PCR (Rep-PCR); multilocus sequence typing (MLST); fatty acid profiling; and more recently protein profiling, virulence gene profiling, and microarray. Results from serotyping, AST, PFGE, and MLST have provided the following associations between animal hosts and food-borne pathogens: certain serotypes have been found to be associated only with certain food animal groups; AST profiles have shown certain resistance phenotypes to be occurring with particular animal hosts; and PFGE profiles coupled with AST profiles and MLST sequence types have been shown to occur with particular animal hosts. Protein profiling of approximately 30 isolates of one Salmonella serotype has identified a unique protein associated with specific PFGE fingerprint clusters. Two-enzyme PFGE has been shown to have better Premarket/Drug Review 24 discriminatory power than MLST for Campylobacter coli isolates, showing genotypic diversity with some evidence of clonality among isolates from chicken breasts from retail meat and humans. Optomization and standardization techniques for a multi-pathogen identification and characterization microarray is underway and nearing completion for use in screening virulence genes and antimicrobial resistance genes of isolates from a number of animal sources. Alternative methods are being examined at OR and the Center for Food Safety and Nutrition, Office of Scientific Analysis and Support. CONTACT: Dr. Heather Harbottle, 301-210-4246, heather.harbottle@fda.hhs.gov • As part of ongoing collaboration with four state veterinary diagnostic laboratories, we have characterized a total of 135 Salmonella isolates representing 32 serotypes recovered from diseased animals in year 2004 using antimicrobial susceptibility testing, pulsed-field gel electrophoresis (PFGE) and examined for the presence of class-1 integron and blaCMY gene. Overall, 97% of isolates were resistant to at least one antimicrobial, 76% to = 3, and 13% to = 9 antimicrobials. Many isolates exhibited resistance to sulfamethoxazole (96%), follow by ampicillin (74%), streptomycin (71), tetracycline (57%) chloramphenicol (50%), kanamycin (33%), amoxicillin-clavulanic acid (31%), ceftiofur (31%), cefoxitin (30%), gentamicin (20%), trimethoprim-sulfmethoxazole (12%),nalidixic acid (4%), and ceftriaxone (4%). All isolates were susceptible to amikacin and ciprofloxacin. Antimicrobial resistance class-1 integron was commonly detected (56 %) in the Salmonella isolates. Four resistance genes (aadA, aadB, catB and dhfr,) were identified in the integrons. The blaCMY gene was commonly present in ceftiofur resistant Salmonella isolates. The Salmonella isolates were genetically diverse, and several multiple drug resistance clones were widely spread among animals. This study indicates that antimicrobial-resistant Salmonella were commonly present in sick animals, and stresses the need for continued surveillance of antimicrobial resistant zoonotic bacterial pathogens from animals as well as need of education for veterinary professionals and the animal industry. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov • CVM is concerned about the potential of antimicrobials used in the aquatic environment to cause alterations in the susceptibility of bacteria that could also infect humans. We investigated the changes in antimicrobial susceptibility of Bacillus cereus after treating fish in Premarket/Drug Review 25 a recirculating system with oxytetracycline medicated feed. We also tracked the susceptibility of B. cereus in a parallel unexposed system. We found that the susceptibility of B. cereus in fecal samples from fish given OTC feed had a higher percent of OTC tolerant bacteria than those on control feed. Within a few weeks after dosing, however, the number of OTC tolerant bacteria in the feces of the treated fish had dropped to control levels. Additional exposures are planned for FY 07 to determine the effect of repeated. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Immuno- Pharmacology INTRODUCTION. The Division of Manufacturing Technologies and the Division of Therapeutic Drugs for Food Animals within ONADE and the Division of Animal Research (OR) have worked together to examine CVM Policy and Procedures Guidance (PPG)1240.4122 (benchmarks for human pharmaceuticals) regarding the standards for the manufacturing of sterile, pyrogen-free animal pharmaceuticals (e.g., contamination of injectables, intra-mammary infusion, and intra-uterine drugs in cattle). ONADE’s primary concerns for bovine focused on determining the permissible levels of endotoxin contamination and the biological relevance of these contaminants. Research designed to answer these concerns will enable the Center to make better science based decisions that may lead to refinement of current guidance policy. IMPACT. The outcome from a range of investigations should provide pivotal data to determine if the current threshold for pyrogen contamination meets, exceeds, or is less than permissible levels of endotoxin as shown by biological indicators and their relevance to health and welfare within a species. If the current CVM PPG meets specifications for the initial species investigated, then additional species (e.g., swine, sheep) will be investigated to assess their pyrogenic threshold response. In addition, these investigations should provide a biological health index for different levels of pyrogen exposure to gauge the potency of the reaction. Another study could evaluate whether in-vitro whole blood culture data could substitute for in vivo data in determining the impact of the physiological response. Overall, these studies will impact CVM’s ability to “specifically” address manufacturing issues related to sterility of “animal pharmaceuticals” and potentially the adoption or refinement of current CVM PPG and novel pyrogen testing methods. Premarket/Drug Review 26 ACCOMPLISHMENTS • Holstein Steers assigned to one of six treatment groups divided according to LPS (E. coli O55:B5) dose and means of administration with a parallel control (no LPS treatment) steer were examined to gauge potency of reaction within a pilot study. Limited data from this study provided an indication that the range of endotoxin concentrations to be used in a more informative study may begin near 0.05 ug (using 1.0 ug LPS as positive control) with either means of administration, bolus or infusion. Further evidence of potency based upon concentration of LPS have been characterized via sporadic coughing, increased salivation, decrease in feed intake, submissivestationary movement, snotty nose, rumen shutdown, bloat, increased respiration rate, and lower temperature of extremities (i.e. ears). • Animal telemetry was used to collect both core body temperature (surgically implanted bovine sensor) and heart rate (belt around girth) of Holstein steers. Measures were recorded locally on ambulatory data recorders attached to each steer and to a base station where researchers can carefully monitor animals in real-time. Body surface heat was measured using infrared technology (thermography; infrared camera) concentrating mainly on soft tissues near the head region (e.g., tear ducts, nostrils, and primarily ears). A second form of telemetry were adopted with glued temperature patches placed in the inside ear to take minute by minute measures for 12-hrs along with infrared images to compare results. These devices were investigated prior to the larger formal study to assure best methodology for detecting changes in animal health and temperature. • A biological gauge for determining the relationship between the potency of LPS concentrations and animal response is currently being developed. Plasma and serum collected at time of study have been used or will be used to perform ELISA on 2,3-dinor thromboxane B2, 6-keto prostaglandin F1a, cortisol, haptoglobin, CD-14, lipopolysaccharide-binding protein, glucose, lactate, serum amyloid A, albumin, and TNF-a. Blood gas analysis, electrolytes, hematology, blood pH, blood pressure, and hematocrit have been completed. Future analyses will include microarray investigations based upon samples collected from these animals and isolation of novel biomarkers in saliva and plasma via proteomics (SELDI-TOF technology). CONTACT: Dr. Michael L. Scott, 301–210–4218, michael.scott@fda.hhs.gov Premarket/Drug Review 27 INTRODUCTION. The importance of the identification of biomarkers indicative of food animal disease stems from both the emergence of proteomic methods in research designed to evaluate drug efficacy, and from the subsequent need to establish valid proteomic criteria to require of pharmaceutical companies in pre-approval drug trials. To date, only one drug has been approved for the treatment of inflammation related to lipopolysaccharide (LPS) exposure in cattle. Identification of protein biomarkers that exhibit differential expression following inoculation with Escherichia coli or administration of lipopolysaccharide (LPS) could elucidate previously unknown effects of LPS exposure, and aid in the identification of accurate protein biomarkers for use in anti-inflammatory drug efficacy trials. IMPACT. The discovery of differentially expressed proteins in tissues and fluids from cattle suffering from coliform mastitis or endotoxemia as a result of inoculation with Escherichia coli or administration of LPS respectively, could lead to the establishment of more accurate biomarkers to evaluate drug efficacy and aid in the approval of new veterinary drugs. ACCOMPLISHMENTS • We have completed the animal phase of a coliform mastitis study in which 24 dairy cattle were inoculated intra-mammarily with Escherichia coli (strain P4), and administered either flunixin meglumine or carprofen (non-steroidal anti-inflammatory drugs) eight hours post inoculation. Milk and plasma samples were collected at regular intervals and physiological data were collected. • We have investigated differential expression of bovine milk proteins in a small subset of samples collected during the coliform mastitis study using 2-D gel electrophoresis and surfaced-enhanced laserdesorption time-of-flight mass spectrometry (SELDI-TOF). Initial results indicate that changes in milk protein expression levels can be detected as early as 12-18 hours post infection, and that these changes can be correlated to increases in rectal temperature. Follow-up analyses will include removal of high abundance proteins to evaluate differential expression of low abundance milk proteins during mastitis infection and the subsequent analysis of the response of any potential biomarkers to the administration of non-steroidal anti-inflammatory drugs. CONTACT: Jamie Boehmer, 301-210-4281, jamie.boehmer@fda.hhs.gov Premarket/Drug Review 28 Metabolism and Residue Depletion Identification of Marker Residue and Depletion of Erythromycin in Salmon INTRODUCTION. There is currently an INAD before the Center for erythromycin use in farmed salmon. It is sponsored by a consortium of producers. Initial depletion studies were conducted using a microbiological inhibition assay to determine residue. To support the INAD, NCTR developed a chemical LC-fluorescence method to determine residues. When both methods were applied to the same incurred residue tissue in a bridging study, the microbiological assay consistently found higher concentrations of residue, suggesting the presence of metabolites not detected in the chemical assay. Metabolism of erythromycin in mammals is well-characterized, and it is possible to identify these known metabolites without using radioactive dosing by using LC-MSn to analyze the incurred residue tissues. IMPACT. This study provides the necessary metabolite identification data, determinative and confirmatory method development and validation to support the approval of a MUMS drug candidate. In addition, the LCMSn method being used can be incorporated into a multi-class method, facilitating eventual surveillance for erythromycin residues. ACCOMPLISHMENTS • Following our previous year’s work, we conducted a larger depletion study of erythromycin in salmon. The LC-MSn method had been validated for determination of erythromycin A and Ndemethylerythromycin A, and estimation of putative anhydroerythromycin A by reference calibration. The accuracy of the method for the first two compounds at 0.5 ppm was 83% and 81%, with CVs of 18% and 15%, respectively. The limit of detection was < 0.01 ppm for both. For the depletion study, salmon were fed 100 mg erythromycin A thiocyanate for three days, and then allowed to deplete for up to 28 days. The results showed that erythromycin rapidly metabolizes, and that by three days depletion most of the residue is present as metabolites. A portion of each depletion sample was also sent to FDA’s Denver District Office for determination of residue by a microbial inhibition assay. Best correlation (R2 = 0.9994) with the microbial assay results occurred if a fraction (10%- empirically selected) of the total estimated metabolite concentration was included with the parent erythromycin concentration found by the LC-MSn assay. Premarket/Drug Review 29 Comparison of Ery A plus 10% of metabolites vs. Microbial Inhibition Assay Concentration y = 0.5108x + 0.1124 R2 = 0.9994 0 5 10 15 20 25 0 10 20 30 40 50 CONTACTS: Dr. Mary Carson, 301-210-4652, mary.carson@fda.hhs.gov Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Method Trials: Chemical INTRODUCTION. A drug sponsor must provide FDA with a method to detect residues for new animal drugs intended for use in food producing animals. The methods are submitted by drug developers as part of the approval process for a New Animal Drug Application (NADA). Typically, the method consists of two parts, a determinative procedure to quantify the amount of drug residue present, and a confirmatory procedure to unambiguously identify the presence of the drug residue. Recent advances in analytical chemistry using liquid chromatography/mass spectrometry (LC-MS) have made it possible to combine the two procedures into a single method. The trials for NADA methods are typically coordinated by the drug sponsor in what is known as a Sponsor-Monitored Method Trial. Before the start of the trial, the sponsor is given the option of holding a method demonstration at either the sponsor’s laboratory or the CVM research facility. To ensure that the method is practical for use, the CVM laboratory serves as one of the participants in the method trial for the determinative procedure. CVM/DRC serves as the expert laboratory for all confirmatory procedures. IMPACT. The acceptance of new methods is an integral part of the approval process of NADAs for drugs used in food animals. Approved methods must be suitable for use in FDA-ORA and USDA-FSIS laboratories with written procedures that are clear, complete, and free of Premarket/Drug Review 30 ambiguity. The methods are needed to ensure that the approved drugs are not being misused, and the analytical results generated with these methods can be used with confidence by the Center when undertaking regulatory actions. ACCOMPLISHMENTS • DRC participated in a Sponsor-Monitored Method Trial based on a method demonstrated at OR in the 2005. The trial had been temporarily suspended because of problems transferring the method from the developers’ laboratory to the participating laboratories. The method trial was successful largely due to information developed at DRC which demonstrated that LCMS matrix effects on the sponsor’s instrument were not duplicated on instruments in the other laboratories. The method trial was completed after the sponsor modified the original method to reduce matrix effects. Research initiated at DRC in response to this experience resulted in a publication describing a new technique for ruggedness testing LC/MS methods for the influence of matrix effects. DRC began the evaluation of a multispecies confirmatory method. In this study, the confirmatory method evaluated will be used both in support of a pending New Animal Drug Application (NADA) and to provide updated confirmatory procedures for previously-approved NADAs from the sponsor for the compound. For both trials, DRC completed the work within the time frame agreed upon with the sponsor. CONTACT: Dr. Philip J. Kijak, 301-210-4589, philip.kijak@fda.hhs.gov Microbiological Methods INTRODUCTION. The Biological Methods program seeks to develop, improve, and implement diagnostic methods for the detection of pathogenic microorganisms or their toxins and chemical residues in food animals, their environments, and their derived food products. Most current bacteriological methods are time consuming and labor intensive, requiring that organisms be isolated in pure culture before subsequent biochemical testing. Similarly, detection of toxins may require extensive bioassays. We are continually evaluating methods that will enhance our ability to detect microorganisms in various matrices, including litter, bedding (straw/hay), animal feed of all types, and food. IMPACT. Once isolated and identified, determining a bacterium's antimicrobial susceptibility profile is of considerable importance to CVM Premarket/Drug Review 31 for several reasons. These research activities provide the Agency with up-to-date data on the potential fate of an approved antimicrobial in its usage environment, including its effects on bacteria other than the target microorganisms. Accurate testing methods are essential, and OR scientists are closely involved in validating methods and establishing quality control and interpretative criteria in association with the Clinical Laboratory Standards Institute (CLSI). This has allowed CVM to establish a quality control testing program for NARMS, as well as teach these methods to visiting scientists from other federal agencies. In addition, improvement in early warning systems to notify people of harmful biological conditions that may threaten a food source is integral to the Agency’s mission to protect the food supply. ACCOMPLISHMENTS • CVM has completed studies to improve upon a previously established broth microdilution antimicrobial susceptibility testing method for Campylobacter. A second multi-laboratory study has successfully determined quality control ranges for an additional six antimicrobial agents, resulting in a method that now allows for a total of fourteen antimicrobials to be tested. This will permit greater flexibility to clinical, research and surveillance laboratories interested in testing Campylobacter for antimicrobial susceptibility.CVM completed studies to develop a disk diffusion method to screen Campylobacter for antimicrobial resistance to the two first-line antimicrobials, erythromycin and ciprofloxacin. This approach is more rapid and less expensive that dilution methods. As such, it is more suitable to microbiologists in resource poor laboratories testing Campylobacter susceptibility to these agents. CONTACT: Dr. Patrick McDermott, 301-210-4213, patrick.mcdermott@fda.hhs.gov • We developed two standards for testing antimicrobial susceptibility (AST) for aquatic bacteria for the Clinical Laboratory Standards Institute (CLSI, formerly NCCLS). These standards, a result of a world wide collaboration coordinated by CVM, are the first CLSI standards for aquatic bacteria and were published in August 2006. . These standards will facilitate comparison of inter-laboratory results and help CVM monitor the influence of antimicrobials in the aquatic environment. • Using our new AST methods published by CLSI, we conducted antimicrobial susceptibility testing of over 200 Aeromonas salmonicida isolates, approximately 100 from the United States and 100 from outside the United States. Minimal inhibitory concentration (MIC) and diameter of the zone of inhibition for oxytetracycline, Premarket/Drug Review 32 ormetoprim-sulfadimethoxine, oxolinic acid, and florfenicol were determined for each isolate. Susceptibility tests for oxytetracycline, ormetoprim-sulfadimethoxine and oxolinic acid revealed two distinct populations of bacteria. Isolates tested against florfenicol clustered into a single population. Oxolinic acid susceptibility data revealed higher MICs in the non-United States A. salmonicida isolates. Slowgrowing (atypical) A. salmonicida isolates were generally more susceptible than typical isolates for all antimicrobials, except oxolinic acid. Frequently, distributions of susceptibility results are being used to develop epidemiologic cutoff values. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Pharmacokinetics/ pharm -acodynamics INTRODUCTION: Investigations of the pharmacokinetic/pharmacodynamic characteristics of various drugs are being conducted in several different animal species and for several different purposes. One investigation compares drug pharmacokinetics in healthy versus diseased animals. The drug concentration at an infection site reaching the responsible bacterial pathogen is dependent on the pharmacokineticbehavior of the administered drug in the target animal species. Essentially all pharmacokinetic data submitted to CVM are generated in normal, healthy animals. Therefore, CVM is unable to validate the assumption that pharmacokinetic parameters are unaltered in the diseased state compared to the healthy state for that drug/disease/animal species. Should this assumption be incorrect, we are at risk not only of therapeutic failures, but of equal or greater importance, of also risking the public health via the inadequate exposure of pathogen to the drug. PK/PD studies are conducted in support of the Center’s Minor Use/ Minor Species (MUMS) program and its Critical Path Initiative involving Process Analytical Technology (PAT). In regards to the MUMS program, there are limited data on the pharmacokinetics of anthelmintics used in the parasite control of small ruminants (sheep and goats). Approvals for use in these minor species rely on data generated in the major species, namely, cattle. In support of PAT, pharmacokinetic studies are necessary to provide in vivo data for correlation with in vitro dissolution data. Pharmacokinetic studies are also conducted in aquaculture species to provide information necessary for the development of interpretive criteria. Another area of investigation involves studying the ear as an injection site in cattle. CVM’s Office of New Animal Drug Evaluation (ONADE) currently has several drug products approved, or under investigation, that designate the ear pinna as the site for subcutaneous injection. The ear has Premarket/Drug Review 33 become an increasingly common site for the injection of therapeutic and production drugs in cattle, primarily because the problem of extended drug residues at the injection site is avoided, and it is also less likely to result in carcass damage and trimming required at the time of slaughter. However, field safety studies with some of these drugs have resulted in several reports of acute death following administration. These cases have been attributed to inadvertent injection of the drug into an artery, resulting in back-flush into the cerebral blood supply, leading to embolism and death. While CVM/ONADE has requested that the drugs in question be studied, in order to determine if the adverse events are volume-related or due to physical/chemical properties of the drug/carrier, it has become apparent that no detailed anatomical references exist that describe the blood vessels on the posterior aspect of the bovine ear. IMPACT: Results from these investigations will provide the scientific support for the development of guidance documents and regulatory decisions within the Center. This research will help CVM identify those (if any) classes of compounds where we need to factor the disease condition into our human food safety assessments. This information will be invaluable in designing pre-approval studies for assessing the potential for selecting for resistant bacterial strains, and for selecting optimal dosage rates and intervals. Comparative pharmacokinetic studies involving cattle, sheep and goats will facilitate development of guidelines for conducting future studies under the Minor Use/Minor Species Program (MUMS). Correlations of this type are necessary to determine whether manufacturing changes as measured by Near IR under PAT will be an adequate quality control tool that can be used to assess changes in final product composition and if these changes have a potential impact on drug disposition in vivo. ACCOMPLISHMENTS: • We have evaluated data from the animal phase of a pilot study of tilmicosin using a pneumonia model in 4 beef steers. The study involved the administration of tilmicosin subcutaneously, both in the healthy state and following induction of pneumonia with Mannheimia haemolytica. Drug levels in the plasma and at the site of infection (bronchial fluid) have been analyzed and have demonstrated that tilmicosin persists in the lung for a prolonged period of time. A larger study is being designed to better evaluate the effects of infection, and we are currently conducting some laboratory investigations to determine the best way to obtain bronchial fluid specimens for analysis. • Initial analysis of pharmacokinetic data from a similar study of enrofloxacin (a fluoroquinolone antimicrobial) in 24 beef steers Premarket/Drug Review 34 suggested that pneumonia may alter the levels of the antibiotic at the site of infection, as measured in bronchial fluid, an effect which may be different depending on the drug's route of administration. Analysis of the enrofloxacin data suggested that there were no significant effects on plasma PK parameters, and no changes in bacterial susceptibility were detected. Because we observed some pharmacokinetic changes in enrofloxacin levels in the bronchial fluid in control calves, a follow-up study was completed in eight uninfected animals, in order to investigate the effects of the sham-infection procedure utilized. This data is currently being analyzed, but iT does not appear that infection has a significant effect on the levels of this drug in the lung. • A study is currently underway to map the arteries that supply the posterior aspect of the bovine ear. Seven beef steers were euthanized, and following removal of the head and isolation of the common carotid arteries, an acrylic polymer was injected to create casts of the arteries supplying all cranial structures. The final specimens are currently undergoing digestion, in order to remove all tissue. Casts of the vessels will be isolated and mapping of the vascular pathways will be performed, in order to identify the most likely points for inadvertent intra-arterial injection and the possible pathways allowing access of the drugs to the brain. Subsequent studies are planned in order to determine if the reported adverse events are volume-related or due to physical/chemical properties of the drug/carrier. CONTACT: Dr. Jeffrey L. Ward, 301-210-4216 jeffrey.ward@fda.hhs.gov • There are currently no FDA accepted interpretive criteria for antimicrobials in aquatic organisms. During FY 06, we developed two methods for determining oxytetracycline concentrations in fish blood. These methods, an HPLC and a microbiological assay will be used to determine PK parameters of OTC in trout. We have recently developed a model for furnunculosis in rainbow trout and will be examining the effect of disease on the PK in both healthy and infected fish. The outcome of these studies will provide information needed to develop interpretive critieria. CONTACT: Dr. Renate Reimschuessel, 301-210-4024 renate.reimschuessel@fda.hhs.gov • We had originally planned to initiate a study during the summer of 2006 to assess the bioavailability of Orbifloxacin tablets which Premarket/Drug Review 35 had been prepared using several different coatings that affected their dissolution. During the pilot testing phase, we noted that the slow and medium release tablets were minimally bioavailable and that the fast release tablet showed considerable inter-animal variation. As a result, it was decided to put the study on hold. ONADE sponsors were going to set up an extramural contract to conduct the animal phase of the study after they had procured more of the active pharmaceutical ingredient from the drug sponsor so they could test additional formulations. CONTACT: Dr. Joseph C. Kawalek, 301-210-4296 joseph.kawalek@fda.hhs.gov Method Development in Support of Minor Use Minor Species INTRODUCTION. The passage of The Minor Use and Minor Species Animal Health Act of 2004 recognized the need to increase the availability of drugs for minor species. A major cost incurred by a drug sponsor is the need to develop analytical methodology to monitor for drug residues. The advancement of LC-MS technology has allowed the development of methods that can detect a wide range of compounds in a single chromatographic analysis. The high specificity of the MS detector also means that simpler extraction and purification procedures may be used. OR is developing “off the shelf” multiresidue methods that can be used by drug sponsors in support of approvals for use in minor species. IMPACT. By developing methods that can be used “off the shelf” for the quantitation and confirmation of a drug in a minor species, the research supports the Agency’s Critical Path initiative. The research benefits the agency by providing methods that utilize resources for monitoring more efficiently. Additionally, it can serve as a model of an alternative more efficient approach for the development of all regulatory drug residue methods. The current approach to the development of drug residue methods is expensive, sometimes delays the approval of needed drugs, and does not provide efficient methods for enforcement. ACCOMPLISHMENTS Multiresidue Methods • Multiclass Residue Analysis in Finfish. We used the selective power of LC-ion trap mass spectrometry to detect 38 compounds from a variety of drug classes in a single analysis. Fish muscle was extracted with acetonitrile and hexane. The acetonitrile phase was evaporated, the extract dissolved in water and acetonitrile, and washed again with hexane. A portion was analyzed by gradient chromatography on a phenyl column. MS2 or MS3 spectra were monitored for each compound. Method performance was initially evaluated in salmon by Premarket/Drug Review 36 Premarket/Drug Review 37 the analysis of replicate samples of control fish, fish fortified with a drug mixture at 1, 0.1 and 0.01 ppm, and salmon dosed with a representative from each drug class (tylosin, lincomycin, florfenicol, ampicillin, cephalexin, metronidazole, albendazole, oxolinic acid, malachite green, Romet). More than half (20) of the 38 drugs were detectable at 0.01 ppm, the lowest fortification level. This included the macrolides, quinolones and fluoroquinolones , malachite green, and most of the imidazoles. Florfenicol amine, metronidazole, sulfonamides, tetracyclines, and most of the betalactams were detectable at 0.1 ppm. Due to lower instrument sensitivity, ivermectin and penicillin G were only detectable in the 1 ppm fortified samples. With the exception of metronidazole and tylosin, residue presence was confirmed in all the dosed salmon. The method evaluation is being repeated for trout, catfish, and tilapia, with comparable results thus far. This project will be continued in partnership with FDA-ORA Southeast Regional Laboratory in Atlanta where a chemotherapeutics surveillance program for seafood is being implemented. CONTACT: Dr. Mary Carson, 301-210-4652, mary.carson@fda.hhs.gov Methyltestosterone in Fish • In tilapia aquaculture, an all-male population is desired because males grow faster and bigger than do females. The synthetic androgen 17"- methyltestosterone (MT) is commonly used for sex reversal in newly hatched tilapia fry. Concerns, however, exist over the misuse of MT in adult fish and over its potential use as a growth promoter. In response to a request from the Office of New Animal Drug Evaluation, DRC scientists have developed a method capable of determining MT in fillets of tilapia, rainbow trout, and salmon at subparts- per-billion levels. The method has been validated at levels from 0.40 to 1.6 ppb, with MT-d3 used as an internal standard. The accuracy is between 100-110% and coefficients of variation of <10% for all three fish species. This method can be used for monitoring and surveillance purposes as well as for use in research studies. CONTACTS: Dr. Pak-Sin Chu, 301-210-4583, pak.chu@fda.hhs.gov Dr. Mayda Lopez, 301-210-4587, mayda.lopez@fda.hhs.gov Compliance 38 Drug Residue Methods INTRODUCTION. The drug residue method development program addresses the needs of CVM's post-approval activities for analytical methods for drug residues in animal-derived foods. While drug sponsors are responsible for developing methods for new animal drugs, these methods are usually developed only for the requested use and will be for a specific species and target organ. Therefore, CVM must also develop analytical methods. For example, it was reported that antiviral drugs were being administered to poultry in China in an effort to control avian influenza. Due to concern that indiscriminate agricultural use of these compounds might lead to the development of resistant viral strains, CVM issued an Order of Prohibition banning the use of adamantanes and neuraminidase inhibitors in poultry. However, currently no analytical methods for these compounds are available in poultry tissues. The Agency’s Pandemic Preparedness Plan calls for the development of such methods. Another example is the extralabel use of animal drugs by veterinarians under certain conditions allowed under Animal Medicinal Drug Use Clarification Act (AMDUCA). To assure no residues remain, it is necessary to measure them; however, analytical methods may not be available for that extralabel use. Also, import products may contain residues of drugs not allowed for use in the United States. FDA and USDA-FSIS require regulatory methods that can detect and measure a broad range of drugs at very low concentrations, yet are rugged, fast, economical, and safe. Addressing these needs involves incorporating new cleanup, separation, and detection technologies into regulatory methods for drug residues. At the completion of method development, a standard operating procedure is prepared and methods are validated. DRC continues to place more emphasis on mass spectrometric methods due to their high degree of specificity, potential for high throughput, or ability to analyze multiple residues in a single procedure. The focus of the current compliance methods development is for enforcement methods developed in response to a specific need. For example, nitrofuran residues have been detected in products from Southeast Asia. When these drug residue problems were detected by other countries, the FDA did not have suitable methods for regulatory analysis. In response to the problem, DRC adapted and validated methods for these compounds to provide the Agency with acceptable methods for regulatory analysis. IMPACT. Validated methods are critical to understanding and monitoring the safety of food products from animals. Needed enforcement methods allow the Agency to respond to emerging drug residue problems. Compliance 39 Compliance 40 ACCOMPLISHME NTS • Determination of MS-222 in Fish. MS-222 (tricaine methanesulfonat e) is approved in the U.S. in fish and other coldblooded species for anesthesia and to facilitate handling and transport. Three weeks must elapse before treated fish may be harvested for food. The drug is rapidly depleted, and no unsafe residues are expected under these conditions. However, there exists the possibility that the drug is being used in an extralabel manner, notably as a sedative in holding tanks that are used to transport fish to abattoirs. The method submitted with the original NADA had a limit of detection near 1 ppm. We are in the process of developing and validating a routine LC-UV surveillance method capable of quantifying 0.1 ppm. Initially, we looked at both parent tricaine and two known metabolites. Analysis of treated salmon and catfish showed presence of parent and one metabolite. However, the parent drug remained the predominant residue, mirroring the findings for trout that had been used to support the approval. We developed an efficient solvent extraction of the parent drug from tissue. We are currently working on optimizing the cleanup and chromatography conditions to better separate tricaine from minor matrix and reagent interferences. CONTACT: Dr. Mary Carson, 301-210-4652, mary.carson@fda.hhs.gov • A high performance liquid chromatographic procedure for the determination of albendazole and its metabolites: albendazole sulfoxide, albendazole sulfone and albendazole amino-sulfone in the muscle tissue of large mouth bass (LMB) and hybrid striped bass (HSB) was developed. The procedure is being applied to study the in vivo metabolism and residue depletion of parent albendazole and its metabolites in the muscle tissues of both LMB and HSB. CONTACT: Dr. Badar Shaikh, 301-210-4654, badaruddin.shaikh@fda.hhs.gov Nitrofurans: DRC scientists have completed the development and validation of methods for determining the residues of the nitrofuran drugs furazolidone, nitrofurazone, furaltadone, and nitrofurantoin in honey and in cow milk at low ppb. In addition to method development, DRC scientists have collaborated with the Gulf Coast Seafood Laboratory (GCSL), Center for Food Safety and Nutrition (CFSAN) to conduct a depletion study for nitrofurans in channel catfish. Such depletion study has also been completed. Compliance 41 CONTACTS: Dr. Pak-Sin Chu, 301-210-4583, pak.chu@fda.hhs.gov Dr. Mayda Lopez, 301-210-4587, mayda.lopez@fda.hhs.gov Pharmacokinetics and Residue Depletion INTRODUCTION. During FY06 CVM scientists continued to study the correlation of drug residue levels in tissues and fluids of beef steers. The drug evaluated this year is sulfadimethoxine (SDM), which has been misused in dairy cows and beef steers. The unapproved use of SDM is one of the major causes of illegal drug residues in animal products. Like the preceding studies for gentamicin and penicillin G, the current study took advantage of the combination of novel laparascopic surgical techniques to obtain minute amounts of organ tissue samples in standing steers, and liquid chromatography-tandem mass spectrometry to analyze drug residues therein with high sensitivity and specificity. The mathematical relationship between the drug residue levels in animal tissues (kidney and liver) and in readily obtainable body fluids (plasma, urine, and saliva) has been developed. Our data will be useful for the development of rapid screening test kits, which producers may apply to plasma, urine or oral fluids to estimate if sulfadimethoxine has been depleted sufficiently below the tolerance level to allow safe slaughter of the beef steer. IMPACT. Utilization of pre-slaughter test kits can prevent the waste of animals which have simply been slaughtered too soon after the last injection of antibiotic. ACCOMPLISHMENTS • The study demonstrated drug residue correlations among the liver, kidney, plasma, urine and oral fluid in steers for sulfadimethoxine and its main metabolite in bovine species, 4N-acetyl-sulfamethoxine (AcSDM). The correlations provide the basic research required to establish the rapid screening test of plasma, urine or oral fluid to estimate sulfadimethoxine concentration in kidney with respect to the regulatory tolerance level to determine the appropriate safe time to slaughter the animal. CONTACT: Dr. Jurgen von Bredow, 301-210-4651, jurgen.vonbredow@fda.hhs.gov • An LC-MS/MS based residue method has been developed and validated for quantitation of SDM and AcSDM in bovine kidney, liver, plasma, urine, and oral fluid. The lower limits of quantitation (LLOQ) are 10 ng/g, 10 ng/g, 2 ng/mL, 100 ng/mL, and 5 ng/mL for the above matrices respectively. The quantitation ranges are all from 1 x LLOQ to 2000 x LLOQ. Calibration Compliance 42 Compliance 43 curves were constituted with matrix-free standard solutions. The completed method has been used to support the above tissue/fluid drug residue correlations study. CONTACT: Dr. Hui Li, 310-210-4271, hui.li@fda.hhs.gov Method Trials and Validation INTRODUCTION. CVM validates analytical methods for use in FDAORA field laboratories for compliance testing through a process known as a method trial. The purpose of the method trial is to establish that the method performs as claimed, that this performance is fit for the intended purpose, and that the technology transfer is successful. Residue methods test for violative residues of illegal residues of unapproved drugs. Violative residues may indicate improper drug use that could contribute to antibiotic resistance. Methods may be developed at CVM or submitted by other Federal or state regulatory laboratories for use as enforcement tools. These methods are validated through the non-NADA method trial program. IMPACT. The method trial program provides the FDA-ORA, USDAFSIS, and others with regulatory methods that are suitable for the intended use with written procedures that are clear, complete, and free of ambiguity. The methods are used in support of regulatory programs, and the data generated using these methods can be used with confidence by the Center when undertaking regulatory actions. ACCOMPLISHMENTS • We coordinated with ORA to begin the evaluation of several methods including several of the OR multiresidue methods. We are working with the Animal Drug Research Center at the FDA Denver District to start a multi-laboratory trial of a method for malachite green and gentian violet in finfish. We have provided the shrimp multiresidue method to the Denver District Laboratory and are providing samples for a single laboratory validation of the method, and the finfish multiresidue method to the Southeast Regional Laboratory in Atlanta for an evaluation. CONTACT: Dr. Philip J. Kijak, 301-210-4589, philip.kijak@fda.hhs.gov Compliance 44 Incursion Services DAR continued providing tissues of fish dosed with a variety of drugs and chemicals to develop methods in several species of fish, including tilapia, Atlantic salmon, rainbow trout and channel catfish. These tissues are necessary to ensure that the methods work for some of the more complex matrices found in fish flesh. Incurred tissues are also used for method validation trials, conducted by multiple laboratories in collaboration with OR scientists. Considerable effort is put into maintaining a population of contaminant free fish which are essential for control tissues. In addition, DAR scientists provided tissues from fish treated with several dosages and varying depletion times. Developing methods for chemicals being used in foreign countries will help prevent contaminated food from entering the U.S. and also will help efforts to develop import tolerance levels of selected drugs. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Post-Approval Monitoring 45 PulseNet INTRODUCTION. PulseNet, the national molecular subtyping network for food-borne disease surveillance, was established in 1996 through a collaborative effort of CDC, FDA, USDA, and state health departments. The program uses pulsed-field gel electrophoresis (PFGE) as the DNA fingerprinting method to pinpoint an exact source of food-borne illness outbreak. PulseNet has already been highly successful in preventing and reducing food-borne illness outbreaks. In the past, PulseNet has focused on food-borne pathogens isolated from patients and foods because foodborne pathogen isolates from animals were limited. In a collaboration with veterinary diagnostic laboratories in the U.S. and FoodNet, DAFM researchers are obtaining isolates of Salmonella, Campylobacter and E. coli O157:H7 isolates from food animals, including cattle, swine, chicken, turkey, and selected retail meats from these same animal species. These isolates are subjected to susceptibility testing, serotyping and are subtyped by PFGE. The DNA fingerprinting patterns of the isolates from animals and meats are submitted to PulseNet. IMPACT. CVM’s efforts as part of PulseNet focus on characterizing bacterial strains obtained from food-producing animals and retail meats. Data from these samples provide a critical link with the NARMS program, a sentinel surveillance system focused on the identification, and antimicrobial susceptibility testing of food-borne bacteria. PulseNet studies help to reveal if there is a clonal spread of food-borne pathogens, including resistant isolates, between animals and humans or whether there is widespread dissemination of unrelated strains. Also, Salmonella isolates are examined at the genetic level for the presence of specific resistance determinants, which may spread independently of the bacterial hosts. These studies will help us better understand the genetic diversity of Salmonella and Campylobacter, the link of these pathogens between animals and humans, and whether antibiotic usage in animal husbandry may influence antimicrobial resistance in food-borne pathogens, including the extent of resistance gene transfer between animal and human food-borne pathogens. ACCOMPLISHMENTS • We have established DNA fingerprinting databases for E. coli O157:H7, Salmonella, and Campylobacter. A database is being developed for Vibrio. We are sharing the databases with PulseNet at CDC and exchange information with all the PulseNet participants through the website. We subtyped bacterial pathogens not only from NARMS/FoodNet and four veterinary diagnostic laboratories, but also from the ResistVet surveillance program in Mexico, as well as the USDA-AMS produce survey program. Post-Approval Monitoring 46 • To date, CVM PulseNet database has more than 7,000 data entries, which include 4,015 Salmonella, 432 E. coli, 2,646 Campylobacter, and 69 Vibrio. • For FY 2006, we have used PFGE to subtype more than 1,000 Salmonella, E. coli, and Campylobacter isolates recovered from food animals, retail meats and human by PFGE. More than two thousand Salmonella and Campylobacter isolates were subtyped by PFGE using second enzyme. Total of 2,123 PFGE patterns have been submitted to CDC national PulseNet database. Our data suggest that multi-drug resistant Salmonella serotypes other than Typhimurium and Newport are emergent in the United States, with antimicrobial resistant clones spreading between animals and humans. These serotypes include Agona, Uganda, Dublin, and Heidelberg. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov Retail Meat Surveillance INTRODUCTION. The goal of this surveillance program is to provide data to the National Antimicrobial Resistance Monitoring System (NARMS) on the prevalence and extent of antimicrobial resistance in foodborne bacteria from retail chicken, turkey, pork, and beef products. Retail meat surveillance provides information on isolates at the consumer level by sampling meat products in the 10 FoodNet sites (CA, CO, CN, GA, MD, MN, NY, TN, OR, NM). Each site cultures meat samples for the presence of Salmonella and Campylobacter. In addition, four sites (GA, MD, OR, TN) test samples for E. coli and Enterococcus. All participating laboratories use similar methods adapted from the FDA Bacteriological Analytical Manual and may receive additional training at the Office of Research. Isolates are sent to FDA/OR for confirmatory and additional testing. IMPACT. This program is central to FDA programs designed to limit the development and dissemination of antimicrobial-resistant food-borne pathogens by providing an ongoing surveillance of retail meats. This will help to provide information that is necessary to develop and implement science-based measures to prevent or reduce the transfer of resistant pathogens to humans via the food supply. ACCOMPLISHMENTS • CVM/OR published the 2004 annual report of the NARMS retail meats surveillance, available at: http://www.fda.gov/cvm/NARMSReport2004.htm. This website is updated as new information becomes available. Post-Approval Monitoring 47 • Studies on isolates collected in 2004 are nearly completed. The results should be posted on the CVM web site in mid 2006. • Studies on isolates collected in 2005 are nearly completed. The results should be posted on the CVM web site in mid 2007. • Along with NARMS partners at the USDA and the CDC, the first Executive Report was published in 2006 summarizing 2003 data from all three NARMS components. • The NARMS 2004 Executive Report should be posted in Mid 2007. CONTACT: Dr. David G. White, 301-210-4181, david.white@fda.hhs.gov ResistVet INTRODUCTION. ResistVet is a surveillance program for food-borne pathogens in Mexico. Using NARMS as a template, CVM has collaborated with Mexican public health officials to help establish a system for monitoring trends in antimicrobial resistance in isolates of Salmonella, E. coli and Campylobacter from humans (healthy and ill), food animals (poultry, swine) and retail meats (chicken, pork). IMPACT. The ResistVet program has provided data on the prevalence and antimicrobial resistance of food-borne isolates in Mexico. This information assists the FDA in better understanding how the situation in Mexico compares to that is the US, including the microbiological status of imported meats and animals from Mexico. ACCOMPLISHMENTS • In 2006, CVM/OR collaborated with Mexico’s ResistVet Surveillance Program by performing genetic analysis of Salmonella and E. coli strains collected in their surveillance laboratories. Isolates from retail foods, and healthy and ill people are assayed for antimicrobial susceptibility and compared using pulsed field gel electrophoresis (PFGE). Data from the CVM/ResistVet collaboration showed how extended-spectrum cephalosporing resistant Salmonella Typhimurium infections increased over the past five years in Yucatan, with many recent isolates showing resistance to a large number of antimicrobials. PFGE analysis suggest that these S. Typhimurium, arising mainly from pork products. • Analyzed E. coli isolates for genetic mechanisms conferring resistance to quinolones and cephalosporins. CONTACT: Dr. Patrick McDermott, 301-210 4213, patrick.mcdermott@fda.hhs.gov Animal Feed Safety 48 Animal Feed Safety 49 BSE— Detecting Prohibited Substance INTRODUCTION. In an attempt to prevent the emergence of bovine spongiform encephalopathy (BSE) in U.S. cattle, FDA established a ban on using processed animal proteins in feed for ruminants. However, CVM did not have an analytical method to detect these prohibited proteins in animal feeds. Initially, CVM validated a PCR-based method for the detection of primer pairs that permit detection of DNA derived from either swine, sheep, and goats, poultry, and horse, as well as a primer set capable of simultaneously detecting DNA derived from cattle, sheep, goats, deer, elk, horse, and swine. The PCR method using the bovine-specific primers was transferred to ORA laboratories and has been used for the analysis of regulatory samples. • We completed the in-house evaluation of our third generation PCR method for the detection of processed animal proteins. This method uses a new approach for the extraction of DNA from animal feed, which when coupled with real-time PCR, resulted in an assay that can be performed in two hours. The evaluation of this new method used the acceptance criteria previously developed for our evaluation of commercial test kits. Based on success in having this new real-time PCR-based method meet those criteria, it was decided to subject this method to a validation study. Accordingly, we initiated a multilaboratory study to determine the performance characteristics of this method. We are currently awaiting the results from the participating laboratories. • We are continuing our evaluation of the capacity of this method to detect processed animal proteins generated in the European Union, using authentic materials prepared in Great Britain. The E.U. mandates more stringent rendering conditions than the U.S., resulting in final products that are more difficult to analyze. Because of the restrictions imposed as a condition of importation, we can not disseminate these materials to other laboratories and so we must perform the only evaluation of this method’s capabilities to detect material prepared in countries of the European Union. In FY 2006, we completed the evaluation of a fourth commercially available diagnostic test marketed for the detection of ruminant proteins in animal feed. This test kit could not detect bovine meat and bone meal found in animal feed regardless of the concentration of the meal. This result was expected since this particular test kit yielded a marginal rate of detection when testing pure bovine meat and bone meal. CONTACT: Dr. Michael J. Myers, 301-210-4355, michael.myers@fda.hhs.gov Animal Feed Safety 50 Surveillance Methods for Animal Feed Rapid screening test kits for aflatoxins in feed INTRODUCTION. The contamination of corn and grains with aflatoxins may lead to intoxication or death of the animals consuming the feed. Feeds must be monitored for aflatoxin contamination and the distribution and sale of aflatoxin contaminated feed must be controlled. The sensitivity and reliability of commercially available aflatoxin screening test kits are being evaluated with fortified corn in the presence of various feed components. The test kits are also challenged with commercially available feed samples that have been determined to be contaminated with aflatoxin. IMPACT. An evaluation and selection of successful rapid screen test kits will enable animal feed regulators to make rapid decisions about feed that is safe and may be fed to animals – or feed that must be decontaminated or destroyed. ACCOMPLISHMENTS • The commercially available test kit manufactured by Neogen (Agriscreen) test is a rapid, simple field test capable of indicating the absence or presence of greater than tolerance concentrations of the sum total of the aflatoxin components. This test did not respond to normal feed components added to corn contaminated with aflatoxin. Neogen (Agriscreen) test kit is sensitive to aflatoxin contaminated corn mixed into commercial pelleted dry dog food. Another commercially produced aflatoxin test kit, Afla Test P (Vicam), is able to quantitate the level of aflatoxin, but, the system will requires a well established laboratory and a trained technician to perform this test. Naturally incurred aflatoxin in ground corn certified by Trilogy labs and a commercially purchased sample of dog food contaminated with corn containing aflatoxin are being used to validate the performance of these test kit systems. CONTACT: Jurgen von Bredow, 301-210-4651, jurgen.vonbredow@fda.hhs.gov Animal Feed Safety 51 Chemical Method Development INTRODUCTION. There are potential health risks associated with contamination of animal feeds by inappropriate drug levels, insecticides, fungal mycotoxins, or other harmful chemicals. Many compounds of concern are amenable to analysis by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Methods have been developed that will combine simple liquid extractions of animal feed with sensitive LCMS/ MS or GC/MS surveillance for a wide range of compounds. A standardized set of model feeds was used to challenge the new methods, based on the wide range of protein, carbohydrate, fiber, oil and moisture content that might be present in feed formulations. IMPACT. The LC-MS/MS approach will allow us to efficiently monitor for many suspect compounds in animal feed. In addition, the methods will enable us to verify that such compounds are not present, in cases of suspected contamination. ACCOMPLISHMENTS • In the first phase of method development, a procedure was validated for surveillance of 27 moderately polar veterinary drugs from nine chemical classes. • In the second phase of method development, Office of Research chemists expanded the suite of surveillance methods to include an extraction scheme for non-polar contaminants. The detection of organophosphate and organochlorine pesticides was carried out by GC/MS, and carbamate pesticides and polyether ionophore animal drugs were analyzed by LC-MS/MS. The GC/MS method for pesticides was tested against OR’s set of six model feeds, and it was discovered that pigments from “green” feeds need to be removed prior to GC/MS analysis. An additional cleanup step using solid phase extraction (SPE) was added, specifically for use with chlorophyll-containing feeds. CONTACT: David N. Heller, 301-210-4579, david.heller@fda.hhs.gov Leveraging FDA Resources 52 Leveraging, in simplest terms, is working with others outside FDA in ways that will help the Agency meet its public health responsibilities. FDA has been quite successful with its past collaborations and the Agency intends to expand and build upon this solid foundation in developing new partnerships. INTRODUCTION and IMPACT. Leveraging initiatives allow us to devote our scarce resources to those activities that we are uniquely qualified to perform. Such leveraging or cooperative ventures are not a means to shirk our responsibilities but a means to expand our capabilities by allowing us to use our intellect, time, money, and resources in a manner that maximizes their value. We should think of leveraging and other collaborative opportunities, not as last resorts, but as primary strategies for achieving our mission. We also have a long history of collaborating with the external scientific community on a more formal basis, through cooperative agreements, interagency agreements, memoranda of understanding, cooperative research and development agreements, and contracts. But we are now making this kind of leveraging central to our operations. By pooling our financial and intellectual assets we are able to achieve results greater than either organization could have achieved alone. In order for this to be successful, we must have a core of expertise within the Agency that is knowledgeable in the particular area in which we would like to collaborate, and internal activity in the area to serve as a springboard for getting more work done. Formal Activities • Interagency Agreement—CVM established an agreement with USDA/ARS for the purpose of monitoring animal origin Salmonella, E. coli, Campylobacter, and Enterococcus isolates to determine the frequency, characteristics and changes in susceptibility profiles present in these bacterial populations. • Interagency Agreement—CVM established an agreement with CDC to monitor human Salmonella, E. coli, Campylobacter and other bacterial isolates to determine the frequency, characteristics and trends of resistance determinants present in these bacterial populations. • Collaborators designed and carried out a series of experiments using the NIST database of electron ionization mass spectra. The project goal was to provide data on the number of ions, abundance matching windows, and other parameters required for highly confident identifications by mass spectrometry. The results are relevant to CVM’s recommendations for standardized confirmation criteria, because these matching criteria are used to identify drug residues for enforcement purposes. Leveraging FDA Resources 53 Leveraging FDA Resources 54 • Food Safety Initiative Cooperative Agreements—We supported five cooperative agreements with various universities to conduct research on microbiological hazards associated with the food animal production environment, including animal feeds. • Analytical Methods Development Contract—This contract was funded to help the Center conduct method trials for new and improved analytical methods for animal drug residues. • Cooperative Research and Development Agreement—Grant funds were provided to CVM/OR by the National Research Initiative Competitive Grants Program to support the characterization of multiple antibiotic resistances among enterohaemorrhagic E. coli. • Cooperative Research and Development Agreement—Grant funds were provided to CVM/OR by the National Research Initiative Competitive Grants Program to follow resistant Salmonella through the food chain. • Cooperative Research and Development Agreement—Grant funds were provided to CVM/OR by the National Research Initiative Competitive Grants Program to support the characterization of enterococci from the poultry production environment. • Joint Institute for Food Safety and Applied Nutrition (JIFSAN)— CVM/OR collaborated with the University of Maryland on food safety projects funded by JIFSAN including a project to evaluate the in vitro metabolic profiles as a method to predict residue depletion of drugs in different species of fish. • Cooperative Research and Development Agreement—Funds were provided to CVM/OR by the Clinical Microbiology Institute for the purpose of participating in studies that help generate quality control ranges for antimicrobial agents approved by the FDA for clinical use. • Interagency Agreement—Funds were provided to CVM/OR by USDA’s Agricultural Marketing Service to characterize pathogenic microorganisms isolated in USDA’s Microbiological Data Program. • University of Maryland Contract—The purpose of this project was to examine the prevalence of and genetic relatedness of Enterococcus faecium in fecal samples collected from poultry in the food animal production environment, from poultry workers, and from a community referent group. Leveraging FDA Resources 55 • American Type Culture Collection Contract—The purpose of this contract is to use existing microbiological collections to (1) examine historical susceptibility of pathogens to antimicrobial agents, (2) categorize human bacterial carriage and (3) promote development of species-specific biomarker methodologies. • Memorandum of Understanding with the Central Science Laboratory, United Kingdom—This collaborative arrangement will provide a mechanism for the cooperative exchange of scientific expertise, assistance, and information to enhance the capabilities of the participants to carry out their responsibilities in consumer protection and public health with regard to issues of food safety. Informal Activities • AOAC International—This collaborative effort involved the codevelopment and use of standardized test kit validation protocols for the evaluation of screening test systems for the detection of drug residues in fresh bulk tank milk samples. • University of Maryland—This informal collaboration provided for the study of the prevalence and antibiotic resistance profiles of food pathogens in retail samples of meat and in poultry houses. • PulseNet—This collaborative effort was initiated by CDC and involves State Departments of Public Health and FDA. It is an epidemiological database focused on the acquisition and storage of DNA fingerprints generated by the procedure known as pulsed-field gel electrophoresis. This database represents a powerful epidemiological tool to conduct trace-back studies during outbreaks of food-borne illness. • USDA and CDC—Informal collaborative effort to characterize Salmonella Typhimurium isolated from the National Antimicrobial Resistance Monitoring System (NARMS). • Summer Student Intern Program—This is a special program for minority college students provides research experience in the biological and chemical sciences. • The Institute for Genomics Research (TIGR), CFSAN and USDA – This collaboration involves a cooperative effort to establish wholegenome DNA sequence data for 10 salmonella serovars. • FDACS — Personnel of the Division of Residue Chemistry audited the validation data of a method for the analysis of fluoroquinolones in honey developed by the Chemical Residue Laboratories of the Florida Department of Agriculture and Consumer Services (FDACS). Recommendations were made to improve the method SOP. Data of Leveraging FDA Resources 56 Leveraging FDA Resources 57 the analysis of regulatory samples found positive by FDACS were reviewed by DRC personnel to corroborate the findings before regulatory actions were taken. • ARS/USDA — The Division of Residue Chemistry collaborated with the Bee Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture in studies in developing analytical methodology to monitor for drug residues in support of the Minor Use Minor Species Health Act. The Bee Research Laboratory provided DRC with incurred honey samples required for the development of multiclass/multir esidue methods in honey CONTACT FOR ALL ABOVE: Mr. Michael H. Thomas, 301-210-4650, michael.thomas@fda.hhs.gov Accomplishments 58 Publications Anderson, K., Lyman, R., Bodeis-Jones, S., White, D.G. 2006. Genetic diversity and antimicrobial susceptibility profiles among Staphylococcus aureus isolated from bovine mastitis. American Journal of Veterinary Research. 67:1185-1191. Arlet, G., Barrett, T.J., Butaye, P., Cloeckaert, A., Mulvey, M.R., White, D.G. 2006. Salmonella resistant to extended-spectrum cephalosporins: prevalence and epidemiology. Microbes and Infection. 8:1945-1954. Babu, U. S., Wiesenfeld, P. L., Raybourne, R. B., Myers, Michael J., and Gaines, D. (2005). Effect of dietary fish-meal on cell-mediated immune response of laying hens. Intl J Poultry Science. 4(9):652-656. Butaye, P., Michael, G.B., Schwarz, S., Barrett, T.J., Brisabois, A., White, D.G. 2006. The clonal spread of multidrug-resistant non-typhi Salmonella serotypes. Microbes and Infection. 8:1891-1897. Carson, M. C. and V.B. Reeves. 2006. Veterinary Drug Residues: Analytical Methods for Residue Analysis. Journal of AOAC International. 89: 566. Chen, S., Cui, S., White, D.G., McDermott, P.F., Zhao, S., Paulsen, I., Meng, J. Contribution of target gene mutations and efflux to decreased susceptibility in Salmonella Typhimurium to fluoroquinolones and other antimicrobials. Antimicrobial Agents and Chemotherapy. 2007:51 535-542. Chiesa, O.A., R. Cullison, D.E. Anderson, K. Moulton, L. D. Galuppo and J. von Bredow. 2006. Development of a technique for serial bilateral renal biopsy in steers. Canadian Journal of Veterinary Research. 70:87-93. Chiesa, O.A., J. von Bredow, M. L. Smith, D. N. Heller and M. H. Thomas. 2006. Use of tissue-fluid correlation to estimate Gentamicin residues in Holstein Steers. Journal of Veterinary Pharmacology and Therapeutics. 29:99-106. Chiesa, O.A., J. von Bredow, M. L. Smith, D. N. Heller and M. H. Thomas. 2006. Bovine kidney tissue fluid correlation for Penicillin, Journal of Veterinary Pharmacology and Therapeutics. 29:299-306. Chu P.-S. and M. I. Lopez. 2005. Liquid Chromatography-Tandem Mass Spectrometry for the Determination of Protein-Bound Residues in Shrimp Dosed with Nitrofurans. Journal of Agricultural and Food Chemistry. 53:8934-8939. Accomplishments 59 Chu P.-S. M. I. Lopez, S. Serfling, C. Gieseker, and R. Reimschuessel. 2006. Determination of 17a-Methyltestosterone in Muscle Tissues of Tilapia, Rainbow Trout, and Salmon Using Liquid Chromatography-Tandem Mass Spectrometry. Journal of Agricultural and Food Chemistry. 54:3193-3198. Deeds J, Reimschuessel R, Place A. 2006. Histopathological effects in fish exposed to the toxins from Karlodinium micrum (Dinophyceae). JAAAH. 18: 136–148. Foley, S.J., White, D.G., McDermott, P.F., Walker, R.D., Rhodes, B., Fedorka-Cray, P.J., Simjee, S., Zhao, S. 2006. Comparison of subtyping methods for differentiating Salmonella enterica serovar Typhimurium isolates obtained from food animal sources. Journal of Clinical Microbiology. 44: 3569-3577. Ge, B., Girard, W., Zhao, S., Gaines, S.A., Friedman, S., Meng, J.. 2006. Genotyping of Campylobacter spp. from retail meats by pulsedfield gel electrophoresis and ribotyping. Journal of Applied Microbiology. 100:175-184. Gieseker C, Serfling S, Reimschuessel R. 2006. Evaluation of Formalin to Control Mortality associated with Saprolegnia parasitica on rainbow trout, Oncorhynchus mykiss. Aquaculture. 253:120-129. Harbottle, H., Thakur, S., Zhao, S., White, D.G. 2006. Genetics of Antimicrobial Resistance. Animal Biotechnology. 17(2): 111-124. Harbottle, H. as part of the MAQC Consortium. 2006. The MicroArray Quality Control (MAQC) project shows inter- and intraplatform reproducibility of gene expression measurements. Nature Biotechnology. 24(9): 1151-61. Harbottle, H., White, D.G., McDermott, P.F., Walker, R.D., Zhao, S. 2006. Comparison of multilocus sequence typing, pulsed-field gel electrophoresis, and antimicrobial susceptibility typing for characterization of Salmonella enterica serotype Newport isolates. Journal of Clinical Microbiology. 44:2449-57. Heller, D. N., C. B. Nochetto, N. G. Rummel and M. H. Thomas. 2006. Development of multiclass methods for drug residues in eggs: hydrophilic solid-phase extraction cleanup and liquid chromatography/tandem mass spectrometry analysis of tetracycline, fluoroquinolone, sulfonamide, and beta-lactam residues. Journal of Agricultural and Food Chemistry. 54:5267-78. Accomplishments 60 Heller, D. N., M. L. Smith and O. A. Chiesa. 2006. Detection of penicillin residues in bovine oral fluid (saliva) by liquid chromatography/tandem mass spectrometry. Rapid Communications in Mass Spectrometry. 20:321-4. Heller, D. N., M. L. Smith and O. A. Chiesa. 2006. LC/MS/MS measurement of penicillin G in bovine plasma, urine, and biopsy samples taken from kidneys of standing animals. Journal of Chromatography B. 830:91-9. Kawalek, JC, Myers, M.J., Howard, K.D., Farrell, D.E. and Shaikh, B. 2006. Hepatic CYP Isoforms and Drug-metabolizing enzyme activities in Broiler Chicks. Int. J. of Poultry Science. 5:104-111. Li, H., P. J. Kijak, S. B. Turnipseed and W. Cui. 2006. Analysis of veterinary drug residues in shrimp: A multi-class method by liquid chromatography–quadrupole ion trap mass spectrometry. Journal of Chromatography B. 836:22-38. Luangtongkum, T., Morishita, T.Y., Ison, A.J., Huang, S., McDermott, P.F., Zhang, Q. Effect of conventional and organic production practices on the prevalence and antimicrobial resistance of Campylobacter spp. in poultry. 2006. Applied and Environmental Microbiology. 72(5): 3600–3607. Martinez, MN, Kawalek, JC, Howard, HD, Ward, JL, Marroum, P, Marnane, W., Bensley, D, Pelsor, FR, Hoag, S, Tatavarti, AS, Xie, L, and Fahmy, R, 2006. Comparison of bovine in vivo bioavailability of two sulfamethazine oral boluses exhibiting different in vitro dissolution profiles. J. vet Pharmacol Therap. 29:459-467. McDermott, P.F., Simala-Grant, J., Walker, R.D., Taylor, D.E. Antimicrobial Resistance in Campylobacter and Helicobacter. In: Antimicrobial Drug Resistance: Principles for the Clinic and Bench, Mayers, D., Sobel, J., Ouellette, M., Lerner, S. (eds.) Humana Press, Totowa, NJ. (In press). Meng, J., Doyle, M.P., Zhao, T., Zhao, S. 2006. Enterohemorrhagic Escherichia coli In: Food Microbiology: Fundamentals and Frontiers. 3rd edition (M.P. Doyle and L.R. Beuchat, ed.). American Society for Microbiology, Washington, DC. Myers, Michael J., Yancy, H. F., et. al. 2006. Validation of a PCRbased method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit. Journal of Food Protection. 69(1):205-210. Accomplishments 61 Myers, Michael J., Yancy, H. F., Farrell, D. E., Washington, J. D., Frobish, R. A. 2005. Evaluation of two commercial lateral-flow test kits that detect animal proteins in finished animal feed. Journal of Food Protection. 68(12):2656-2664. Pagan-Ramos E, Master SS, Pritchett CL, Reimschuessel R, Trucksis M, Timmins GS, Deretic V. 2006. Molecular and physiological effects of mycobacterial oxyR inactivation. J Bacteriol. 188(7):2674-80. Quon D., M. C. Carson, C. B. Nochetto, D. N. Heller and F. Butterworth. 2006. Peer validation of a method to confirm chloramphenicol in honey by liquid chromatography-tandem mass spectrometry. Journal of the AOAC International. 89:586-93. Reimschuessel R, Stewart L, Squibb E, Hirokawa K, Brady T, Brooks D, Shaikh B, Hodsdon C. 2005. Fish Drug Analysis—Phish-Pharm: A Searchable Database of Pharmacokinetics Data in Fish. American Association of Pharmaceutical Scientists Journal. 07(02): E288-E327 http://www.aapsj.org/view.asp?art=aapsj070230 Shaikh, B., N. Rummel, C. Gieseker and R. Reimschuessel. 2006. Metabolism and depletion of albendazole in the muscle tissue of channel catfish after oral treatment. J. Vet. Pharmacol. Therap. 29:525- 530. Simjee, S., Zhang, Y., McDermott, P.F., Donabedian, S.M., Zervos, M.J., Meng, J. 2006. Heterogeneity of vat(E)-carrying plasmids in Enterococcus faecium recovered from human and animal sources. International Journal of Antimicrobial Agents. 28(3):200-5. Stein S. E. and D. N. Heller. 2006. On the risk of false positive identification using multiple ion monitoring in qualitative mass spectrometry: large-scale intercomparisons with a comprehensive mass spectral library. Journal of the American Society for Mass Spectrometry. 17:823-35. Welch, T.J., Florian Fricke, W., McDermott, P.F., White, D.G., Rosso, M-L., Rasko, D.A., Mammel, M.K., Eppinger, M., Rosovitz, M.J., Wagner, D., Rahalison, L., LeClerc, J.E., Hinshaw, J.M., Lindler, L.E., Cebula, T.A., Carniel, E., Ravel, J. 2007. Multiple antimicrobial resistance in plague: An emerging public health risk. PLoS ONE 2(3): e309. doi:10.1371/journal.pone.0000309. Wiesenfeld, P. L., Babu, U. S., Raybourne, R. B., Gaines, D., O’Donnell Jr, M., Myers, Michael J. 2005. Effect of increasing dietary fish-meal on plasma, liver and spleen fatty acids. Intl J Poultry Science. 4:728-733. Accomplishments 62 Accomplishments 63 Yancy, H. F., Mohla, A., Farrell, D. E., and Myers, Michael J. 2005. Evaluation of a rapid PCR-based method for detection of animal material. Journal of Food Protection 68:2651- 2655. Zaidi, M., McDermott, P. F., Fedorka-Cray, P., Canche, C., León, M., Hubert, S., Abbott, J., Headrick, M. and Tollefson, L. T. 2006. Non-typhoidal Salmonella isolated from human clinical cases, asymptomatic children and raw retail meats in Yucatan, Mexico. Clinical Infectious Diseases. 42:21-28. Zhang, Q., Sahin, O., McDermott. P.F., and Payot, S. 2006. Fitness of antimicrobialresistant Campylobacter and Salmonella. Microbes and Infection. 8(7):1972-8 Zhao, S., Fedorka- Cray, P. J., Friedman, S., McDermott, P.F., Walker, R. D., Foley, S.L., Qaiyumi, S., Hubert, S.K., Ayers, S., English, L., Dargatz, D., Salamone, A., White, D.G. 2005. Characterization of Salmonella Typhimurium of animal origin obtained from the National Antimicrobial Resistance Monitoring System (NARMS). Foodborne Pathogens and Disease. 2:169-181. Zhao, S., Maurer, J.J., Hubert, S.K., De Villena, J.F., McDermott, P.F., Meng, J., Ayers, S., English, L. and White, D.G. 2005. Antimicrobial susceptibility and molecular characterization of avian pathogenic Escherichia coli isolates. Veterinary Microbiology. 107:215-224. Zhao, S., McDermott, P.F., Friedman, S., Abbott, J., Ayers, S., Glenn, A., Hall-Robinson, E., Hubert, S.K., Harbottle, H., Walker, R.D. and White, D.G. 2006. Antimicrobial resistance and genetic relatedness among Salmonella from retail foods of animal origin: NARMS retail meat surveillance. Foodborne Pathogens and Diseases. 3:106-117. Zhao, S., McDermott, P.F., Friedman, S., Qaiyumi, S., Abbott, J., Kiessling, C., Ayers, S., Singh, R., Hubert, S., Sofos, J. and White, D.G. 2006. Characterization of antimicrobial resistant Salmonella from imported foods. Journal of Food Protection. 69:500-7. Zheng, J., Meng, J., Zhao, S., Singh, R., and Song, W. 2006. Adherence and invasion of Campylobacter jejuni/coli isolated from retail meats to human intestinal epithelial cells. Journal of Food Protection. 69: 768-774. Accomplishments 64 Presentations Aarestrup, F.M., Hendriksen, R.S., Lockett, J., Gay, K., White, D.G., Bangtrakulnonth, A., Pornreongwong, S., Pulsrikarn, C., Hasman, H., Sorensen, G., Angulo, F.J., and Gerner-Smidt, P. Spread of multiple resistant Salmonella Schwarzengrund from Thailand to Denmark and USA through international trade with food products. Abstracts of the 2006 International Conference on Emerging Infectious Diseases, Atlanta, GA. Bodeis-Jones, S., Carter, P.J., Cullen, P., McDermott, S., Williams, K., White, D.G. Aminoglycoside resistance genes found in Enterococcus spp. recovered from retail meats. Abstracts of the 2006 Annual Conference of Antimicrobial Resistance, Bethesda, MD. Also presented at the 2006 FDA Science Forum, Washington, DC. Chiesa, O. A., von Bredow, J., Heller, D.N., Nochetto, C. B., Smith, M. L., Thomas, M.H. Serial Tissue sampling techniques in support of pharmacokinetic studies in bovine. Academy of Surgical Research. 22nd Annual Convention, Scottsdale, Arizona. 2006. Chiesa, O.A., Karanian, J., Pritchard, W. F., von Bredow, J. Use of endoscopic serial tissue sampling techniques for pharmacokinetic studies in large animals: towards predictive modeling. Scientific Veterinary Endoscopy Society 3rd Annual Scientific Meeting, Keystone, Colorado, 2006. Chu, P. S., Lopez, M. I. Determination of Total Bound and Free Residues of Nitrofurans in Milk of Lactating Cows Using Liquid Chromatography/Tandem Mass Spectrometry. The 12th FDA Science Forum, Washington DC, 2006. Cullen, P., Friedman, S.L., Abbott, J., English, L., Stearns, A., McDermott, P.F., White, D.G., Walker, R.D., Zhao S. and the NARMS Working Group. Characterization of Campylobacter recovered from NARMS Retail Meats by Pulsed-Field Gel Electrophoresis. Abstracts of the 10th PulseNet annual meeting at Miami, FL on April 3-6, 2006, and the 2006 FDA Science Forum, Washington, DC., April 18-20 2006. Deeds, JR, SM. Etheridge, C. Gieseker, R. Reimschuessel, J.P. Abbott, K. Kawabata, J. H. Landsberg, S. Puffer fish: An emerging reservoir for saxitoxins in marine food webs in the US.3rd Symposium on Harmful Algae in the US, October 2-7, 2005, Pacific Grove, CA. English, L.L., White, D.G., McDermott, P.F., Stearns, A., Walker, A.,Hall-Robinson, E., Prescholdt, T., Ayers, S.L., Hubert, S.K., Accomplishments 65 Walker, R.D., and the NARMS Working Group. Prevalence and antimicrobial susceptibility of Campylobacter isolated from retail meat and poultry in the United States, NARMS 2002 – 2004. Abstracts of the Annual Meeting of the American Society for Microbiology, Orlando Fl, May 2006. Also presented at the 2006 FDA Science Forum, Washington, DC. Feldgarden, M., Hall-Robinson, E., Hubert, S.K., McDermott, P.F., White, D.G. The Determinants of antibiotic resistance phenotypes in Enterococcus: Possible evidence for equilibrium and non-equilibrium states. “Evolution 2006,” the joint annual meeting of the Society for the Study of Evolution (SSE), the Society of Systematic Biologists (SSB), and the American Society of Naturalists (ASN). June 23-27, 2006. SUNY Stony Brook, Stony Brook, NY. Fritsche, T.R., Bodeis-Jones, S.M., Fedler, K.A., Walker, R.D., Rhomberg, P.R., Jones, R.N., McDermott, P.F. Disk diffusion susceptibility testing of Campylobacter spp. Use in detection of resistance to macrolides and fluoroquinolones. Abstracts of the Annual Meeting of the American Society for Microbiology, Orlando Fl, May 2006. Garcia RJ, Kane AS, Reimschuessel R. Localization of Oxytetracycline in Chlamydomonas reinhardtii. 5th International Symposium on Aquatic Animal Health, San Francisco, Sept 2006. Gieseker, C., Cheely C., Reimschuessel, R. A survey of drug effects on a renal monogenean in vitro. 5th International Symposium on Aquatic Animal Health, San Francisco, Sept 2006. Hall-Robinson, E., Ayers, S., English, L., Glenn, A., Hubert, S., Walker, L., Proescholdt, Qaiyumi, S., Cullen P., Gaines S., Carter P., McDermott S., McDermott, P., Zhao, S., White, D.G. and the NARMS Working Group. 2006. Prevalence and antibiotic resistance patterns of foodborne pathogens and commensal bacteria isolated from retail meats: NARMS retail meat surveillance 2002-2004. Annual Meeting of the American Veterinary Medical Association. Honolulu, HI. Harbottle, H. An Introduction to Antimicrobial Resistance. University of Illinois Pork Industry Conference on “Antimicrobial Use in Animal Agriculture”. University of Illinois, Urbana, IL. April 27- 29, 2006. Harbottle, H. Microbial Source Tracking: A Detailed Comparison of Methodology using Salmonella Newport isolates. American Registry Accomplishments 66 of Professional Animal Scientists, Washington DC Area Chapter Seminar Series, Beltsville, Maryland, November 16, 2006. Harbottle, H., Thakur, S., McDermott, P.F., White, D.G., Yancy, H., Mason, J., Walker, R.D., Gebreyes, W. A., Zhao, S. Development of a DNA microarray for detection of enteric pathogens, antimicrobial resistance genes, and virulence determinants. United States – Japan Cooperative Program on Development & Utilization of Natural Resources (UJNR), 10th International Symposium on Toxic Microorganisms: Meeting the Challenges of Toxic Microorganisms and Pathogens: Implications for Food Safety and Public Health symposium in College Park, MD, November 2006. Harbottle, H., P.F. McDermott, D.G. White, R.D. Walker, and S. Zhao. 2006. Comparison of Salmonella enterica serotype Newport isolates from 1958-2003 using multi-locus sequence typing and antimicrobial susceptibility profiling. The 106th Annual Meeting of the American Society for Microbiology, Orlando, FL. Also presented at the FDA Science Forum, Washington, DC, April 18-20 2006. Harbottle, H., White, D. G., Zhao, S., Walker, R.D., and McDermott, P.F. Comparison of Salmonella enterica serotype Newport isolates from 1958-2003 using Multi-Locus Sequence Typing and Antimicrobial Susceptibility Typing. Poster at ASM 106th General Meeting, in Orlando, FL, May 21-25, 2006. Heller, D. N. Ion Suppression Mapping: A Tool for Assessing the Transferability of Quantitative Electrospray-LC/MS Methods. 54th ASMS Conference on Mass Spectrometry and Allied Topics, Seattle, WA, 2006. Hubert, S.K., Ayers, S.L., Glenn, A., Hall-Robinson, E., McDermott, P.F., Walker, L.A., Proescholdt, P., Zhao, S., Friedman, S., Abbott, J.W., Walker, R.D., White, D.G., and the NARMS Working Group. Comparison of antimicrobial susceptibility profiles among Salmonella spp. recovered from retail poultry, NARMS 2002-2004. Abstracts of the Annual Meeting of the American Society for Microbiology, Orlando Fl, May 2006. Also presented at the 2006 FDA Science Forum. Washington, DC., April 18-20 2006. Jacobs JM, Baya A, Rhodes M, Reimschuessel R, Harrell. The influence of dietary intake on the progression and severity of Mycobacteriosis in striped bass (Morone saxatillis). USGS/NOAA Mycobacteriosis in Striped Bass Workshop, Annapolis, May 9, 2006. Kaldhone, P.R., Nayak, R., White, D.G., Logue, C.M., Foley, S.L. Accomplishments 67 Characterization of antimicrobial resistance in Salmonella Heidelberg from pre-harvest and post-harvest turkey sources. Abstracts of the 106th Annual Meeting of the American Society for Microbiology, Orlando, FL, May 21-25, 2006. Li, H., Kijak, P.J., von Bredow, J., Chiesa, A., Smith, M. L. Development of an LC/MS Quantitative Method for Residues of Sulfadimethoxine and Its Major Metabolite in Bovine Tissues and Fluids. The 12th FDA Science Forum, Washington DC, 2006. Lopez, M. I., Feldlaufer M., Chu, P. S. Determination of Nitrofuran Residues in Honey. The 12th FDA Science Forum, Washington DC, 2006. Martinez, MN, Kawalek, JC, Howard, HD, Ward, JL, Marroum, P, Marnane, W., Bensley, D, Pelsor, FR, Hoag, S, Tatavarti, AS, Xie, L, and Fahmy, R, 2006. Comparison of bovine in vivo bioavailability of two sulfamethazine oral boluses exhibiting different in vitro dissolution profiles. FDA/Sigma Xi Science Symposium, 2006. Maxwell, T. N., Braam, P., Wagenaar, J., Ellis, A., Jouan, M., McDermott, P.F., Chiller, T. and WHO Global Salm-Surv. WHO Global Salm-Surv international training: Enhancement of global foodborne laboratory-based surveillance and outbreak response. . International Conference on Emerging Infectious Diseases, Atlanta, GA, Mar 2006. McDermott, P. F. Antimicrobial resistance in nontyphoidal Salmonella. In “Antimicrobial Resistance in Bacteria of Animal Origin - Veterinary and Public Health Aspects". F. M. Aarestrup, H. C. Wegener, (Eds.). American Society for Microbiology (ASM Press), Washington, DC, 2006. McDermott, P.F. Development and use of standardized antimicrobial susceptibility testing methods at the U.S. Food & Drug Administration. 2006 International Forum on Hygienic Laboratory Technology and Standardization, Hangzhou, China September, 25-29, 2006. McDermott, P.F. Development of standardized methods for testing antimicrobial resistance of Campylobacter species. The United States Japan Natural Resources Council (UJNR), College Park, MD, November 7, 2006. McDermott, P.F. Managing animal antimicrobials in the United States: Strategies at the Food and Drug Administration. Fundacion Mexicana Para la Salud, Merida, Yucatan, Mexico, April 25, 2006. Accomplishments 68 Accomplishments 69 McDermott, P.F. Research in antimicrobial resistance at FDA Center for Veterinary Medicine. NCTR, Jefferson, AR, September 15, 2006. McDermott, P.F., Hubert, S.K., Tang, J., Cao, H., Quesada, L., Walker, R.D. Ampicillin and gentamicin resistance in E. coli from 1950 – 2002. Abstracts of the Annual Meeting of the American Society for Microbiology, Orlando Fl, May 2006. Also presented at the 2006 FDA Science Forum. Washington, DC., April 18-20 2006. McDermott, P.F., Walker, R.D., Qaiyumi, S., Gaines, S., Cullen, P., Hall-Robinson, E., Ayers, S,. Chiller, T.M., White, D.G. Recovery of daptomycin non-susceptible Enterococcus isolates from retail meats: NARMS 2004. Abstracts of the 46th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA, September 2006. Miller, RA, Reimschuessel R. Epidemiological cut-off values for four antimicrobialagents against Aeromonas salmonicida isolates using MIC and zone diameter frequency distributions. 5th International Symposium on Aquatic Animal Health, San Francisco, September 2006. Miller, RA, Kane AS, Reimschuessel R. Pharmacokinetics of oxytetracycline in rainbow trout using an individualized dosing regime. 5th International Symposium on Aquatic Animal Health, San Francisco, September 2006. Miller RA, Walker RD, Reimschuessel R. Epidemiological cut-off values for four antimicrobial agents against Aeromonas salmonicida isolates using MIC and zone diameter frequency distributions. FDAScience Forum, Washington DC, April 18, 2006 Myers, Michael J, Yancy H. F., Farrell, D. E., Washington, J. D., Deaver, C. M. Development and validation of PCR-based methods for the detection of animal proteins in animal feed. 2006 American Oil Seed Chemists annual meeting. May 1, 2006. Myers, Michael J, Yancy H. F., Farrell, D. E., Washington, J. D., Deaver, C. M., Frobish, R.A. Evaluation of commercial test kits marketed for the detection of animal proteins in animal feed. 2006 American Oil Seed Chemists annual meeting. May 1, 2006. Nochetto, C.B., Cheely, C-S., Gieseker, C., Reimschuessel, R., Carson, M.C. Determination of MS-222 residues in farmed fish. The 12th FDA Science Forum, Washington, D.C., 2006, and AOAC International Annual Meeting, Minneapolis, MN, 2006. Accomplishments 70 Parveen, S., Taabodi, M., Mohamed, T., Schwarz, J., Hubert, S., White, D.G., Oscar, T.. Characterization of Salmonella spp. isolated from pre- and post-chill whole broiler carcasses. Abstracts of the 93rd Annual Meeting of the International Association for Food Protection, Calgary, Alberta, Canada, 2006. Reimschuessel, R. Developing disease models for aquaculture drug approvals. Aquaculture 2006, Las Vegas February 2006. Reimschuessel R , Bowker J, Straus D, Meinertz J,. National Aquaculture Drug Research Forum, Overview of Activities. 5th International Symposium on Aquatic Animal Health, San Francisco, September 2006. Shaikh, B., Rummel, N., Gieseker, C., Reimschuessel, R. Metabolism and residue depletion of 3H-ivermectin in the muscle tissue of rainbow trout after oral administration. The 12th FDA Science Forum, Washington, D.C. 2006. Shaikh, B., Rummel, N., Gieseker, C., Reimschuessel, R. Metabolism and residue depletion of 3H-ivermectin in the muscle tissue of rainbow trout after oral administration. American Chemical Society 232nd National Meeting, San Francisco, CA. 2006. Smith, M. L., Heller D. N. Development of Methods for Aminoglycoside Antibiotics in Animal Feed by LC/MS, The 12th FDA Science Forum, Washington DC, 2006. Smith, S., Cheely, C-S., Gieseker. C, Reimschuessel, R, Carson, M.C. Analysis of erythromycin residues in salmon by LC-MS-MS. The 12th FDA Science Forum, Washington, D.C., 2006, and AOAC International Annual Meeting, Minneapolis, MN, 2006. Stancik Rosenthal, L.M., Barrett, T.J., Hubert, S.K., Hall-Robinson, E., White, D.G., Chiller, T.M. A comparison of surveillance for nontyphi Salmonella in humans and retail meat: NARMS 2003. Abstracts of the 2006 International Conference on Emerging Infectious Diseases, Atlanta, GA, 2006. Stearns, A. A., English, L. L., White, D.G., McDermott, P.F., Walker, A., Hubert, S., Ayers, S., Hall-Robinson, E., Proescholdt, T., Walker, R. D., and the NARMS Working Group. Prevalence and Antimicrobial Resistance of Campylobacter Isolated from Retail Meat and Poultry, NARMS 2004. Abstracts of the Annual Meeting of the American Society for Microbiology, Orlando Fl, May 2006. Also presented at the 2006 FDA Science Forum. Washington, DC., April 18- 20 2006. Accomplishments 71 Wagner, D. D., Carter P. J. Variation in Salmonella Serotype Distributions and Antibiotic Susceptibility Profiles with Environmental Source of the Isolates. Abstracts of the Annual Meeting of the American Society for Microbiology, Orlando Fl, May 2006. White, D.G. Future directions of the National Antimicrobial Resistance Monitoring System (NARMS). National Cattlemen’s Beef Association Spring Legislative Conference. Washington, DC, March 29, 2006. White, D.G. Overview of OIE international antimicrobial resistance activities. International Conference on Emerging Infectious Diseases, Atlanta, GA, March 21, 2006. White, D.G. Updates to the National Antimicrobial Resistance Monitoring System (NARMS). Federation of Animal Science Societies (FASS) Symposia, Food Safety, Animal Drugs, and Animal Health Committee, Rockville, MD, March 13, 2006. White, D.G. Antimicrobial resistance in bacteria, a global issue. 93rd Annual Meeting of the International Association for Food Protection, Calgary, Alberta, Canada, August 14, 2006. White, D.G. Antimicrobial resistance work in the Codex Committee on Residues of Veterinary Drugs in Foods (CCRVDF). 3rd International Workshop on Antimicrobial Resistance, Jeju, Republic of Korea, November 29, 2006. White, D.G. Antimicrobial resistance: Strategies at the U.S. Food and Drug Administration. Training Program in the United States Animal Health/Veterinary Medical System, Rockville, MD. August 22, 2006. White, D.G. Comparison of resistance in non-Typhi Salmonella from humans and retail poultry: NARMS 2004. Antimicrobial resistance in animals session. 46th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA, September 29, 2006. White, D.G. FDA/CVM Update. 110th Annual Meeting of the United States Animal Health Association, Committee on Pharmaceuticals, Minneapolis, MN, October 16, 2006. White, D.G. Surveillance strategies in the U.S., the National Antimicrobial Resistance Monitoring System (NARMS). 3rd International Workshop on Antimicrobial Resistance, Jeju, Republic of Korea, November 28, 2006. Accomplishments 72 White, D.G. The National Antimicrobial Resistance Monitoring System (NARMS). 45th Annual Meeting of the National Mastitis Council, Tampa, FL, January, 22, 2006. White, D.G. The National Antimicrobial Resistance Monitoring System (NARMS). American Registry of Professional Animal Scientists (ARPAS) Symposia, Antimicrobial Resistance in Animal Production: Challenges and Solutions, College Park, MD, May 3, 2006. White, D.G. The National Antimicrobial Resistance Monitoring System (NARMS). 10th International Symposium on Toxic Microorganisms, United States – Japan Cooperative Program on Development and Utilization of Natural Resources, College Park, MD, November 7, 2006. White, D.G., Ayers, S.L., Glenn, A., Hall-Robinson, E., Walker, R.D., Chiller, T., McDermott, P.F., and the NARMS working group. Antimicrobial resistance among E. coli isolates recovered from retail foods of animal origin, NARMS 2004. Abstracts of the 106th Annual Meeting of the American Society for Microbiology, Orlando Fl, May 2006. Also presented at the 2006 FDA Science Forum, Washington, DC. Zaidi, M.B., McDermott, P.F., Campos, F., Contreras, J., Figueroa, G., Hubert, S.K., Lopez, E., Magańa, M., Vazquez, G., Alpuche, C., Estrada, M.T., Calva, J.J. Tollefson, L. Salmonella Surveillance in Mexico, 2002-2005: Results from a Four State Network. International Association for Food Protection, Calgary Alberta, Canada, Aug 2006. Zhao, S. 2006. Characterization of Antimicrobial Resistance of Foodborne Bacterial Pathogens. Training course: Antimicrobial Resistance Susceptibility Testing, Detection and Surveillance. Beijing, China, October 9-17, 2006. Zhao, S. 2006. Introduction of National Antimicrobial Resistance Monitoring System. Training course: Antimicrobial Resistance Susceptibility Testing, Detection and Surveillance. Beijing, China, October 9-17, 2006. Zhao, S. 2006. Mechanisms of Antimicrobial Resistance. Training course: Antimicrobial Resistance Susceptibility Testing, Detection and Surveillance. Beijing, China, October 9-17, 2006. Accomplishments 73 Zhao, S. 2006. Molecular Subtyping and PulseNet. Training course: Antimicrobial Resistance Susceptibility Testing, Detection and Surveillance. Beijing, China, October 9-17, 2006. Zhao, S. and the Division of Animal and Food Microbiology. PulseNet at FDA/CVM: Molecualr Subtyping of Antimicrobial Resistance Foodborne Pathogens Isolated from Food Animal and Derived Meats. The 10th UJNR International Symposium on Toxic Microorganisms. College Park, MD, November 7-9, 2006. Zhao, S., White, D.G., Friedman, S.L., Glenn, Ayers, S.L., Abbott, J., Hubert, S.K., Hall-Robinson, E., Harbottle, H., Walker, R.D., and McDermott, P. F. 2006. Characterization Salmonella enterica serovar Heidelberg from retail meat samples: National Antimicrobial Resistance Monitoring System (NARMS): 2002-2004. The 10th PulseNet annual meeting at Miami, FL; and the 106th Annual Meeting of the American Society for Microbiology, Orlando, FL. and FDA Science Forum, Washington, DC. Zhao, S., McDermott, P. F., Friedman, S.L., Abbott, J., Ayers, S.L., Glenn, A., Hall-Robinson, E., Hubert, S.K., Harbottle, H., Walker, R.D., Chiller, T.M., White, D.G. Antimicrobial resistance and genetic relatedness among Salmonella from retail foods of animal origin: NARMS retail meat surveillance. Abstracts of the 10th PulseNet annual meeting at Miami, FL, April 3-6, 2006. Also presented at the 2006 FDA Science Forum, Washington, DC. Zhao, S., McDermott, P. F., White, D.G., Qaiyumi, S., Friedman, S.L., Abbott, J., Glenn, A., Ayers, S.L., Post, P.K., Fales, W.H., Wilson, R.B., Reggiardo, C., Walker, R.D. Characterization of antimicrobial resistance of Salmonella isolates recovered from diseased animals. Abstracts of the 10th PulseNet annual meeting at Miami, FL, April 3-6, 2006. Also presented at the 2006 FDA Science Forum. Washington, DC. Zhao, S., McDermott, P.F., Freidman, S., Abbott, J., Ayers, S., Glenn, S., Hall-Robinson, E., Huber, S.K., Harbottle, HJ., Walker, R.D., Chiller, T.C., White, D.G. Antimicrobial resistance and genetic relatedness among Salmonella from retail foods of animal origin: NARMS retail meat surveillance. International Conference on Emerging Infectious Diseases, Atlanta, GA, March 2006. Zhao, S., White, D.G., Hall-Robinson, E., Ayers, S., Glenn, A., Friedman, S.L., Abbott, J. W., Harbottle, H., McDermott, P.F. and NARMS retail meat group Prevalence and Antimicrobial Resistance of Salmonella Isolated from Retail Meat: National Antimicrobial Accomplishments 74 Resistance Monitoring System (NARMS): 2002-2005. International Association for Food Protection Annual Meeting. Lake Buena Vista, FL, July 8-11. Outside Reports Methods for Antimicrobial Disk Susceptibility Testing of Bacteria Isolated From Aquatic Animals; Guideline (M42-A), Clinical and Laboratory Standards Institute (formerly NCCLS), Wayne, Pennsylvania, August 2006. Methods for Broth Dilution Susceptibility Testing of Bacteria Isolated From Aquatic Animals; Guideline (M49-A), Clinical and Laboratory Standards Institute (formerly NCCLS), Wayne, Pennsylvania, August 2006. Professional Service Committees: OR staff served on professional, government, Agency, and Center committees or working groups in FY 06: • Badar Shaikh – FDA/CFSAN Radiation Safety Committee; CVM Master Review Committee; Ad hoc reviewer for the Journal of Agriculture and Food Chemistry • David Heller – ad hoc reviewer for Analytical Chemistry, Journal of Chromatography B, Journal of the AOAC International, Journal of Agricultural and Food Chemistry, and Rapid Communications in Mass Spectrometry. • Heather Harbottle - DAFM Microarray Core Facility Representative; Collaborating scientist, Office of Science funded project "Prioritizing Sources of Variability in Genomic Profiling Data for Standards and Guidance Development;" Collaborating scientist on Office of Science funded project "Establishing Quality Control QC) Metrics and Thresholds for Assessing the Overall Quality of a DNA Microarray Gene Expression Study;" Staff College Scientific Steering Committee • Joseph Kawalek – Member of CVM Computer Coordinating Committee; Member of FDA Scientific Computing Work Group. • Mary Carson - Member, Official Methods Board, AOAC International; Chair, Methods Committee for Drugs and Related Topics, AOAC International; CVM Aquaculture Project Advisory Subgroup; Guest Editor for the Journal of AOAC International; ad hoc reviewer for the Journal of AOAC International and the Journal of Food Protection. • Mike Myers - Reviewer, Biochemical Pharmacology. Reviewer, Food Control Accomplishments 75 Accomplishments 76 • Michael Scott – Member, DAR Proteomics Core Facility Representative; Member, CVM Animal Biotechnology Working Group; Member, CVM Genomics and Proteomics Interest Group; Member, CVM Nanotechnology Interest Group; Member, FDA Genomics and Proteomics Interest Group; Member, FDA Nanotechnology Interest Group; CVM Representative, FDA • Pak Chu – CVM Aquaculture Project Advisory Subgroup, Office of Research Computer Committee, Committee for the Advancement of FDA Science. Ad hoc reviewer for the Journal of Agriculture and Food Chemistry. • Patrick McDermott – Member, Standards Implementation Working Group, Food and Drug Administration ; Advisor, Subcommittee on Veterinary Antimicrobial Susceptibility Testing, Clinical and Laboratory Standards Institute (CLSI); Member, Working Group on Susceptibility Testing of Fastidious Organisms (CLSI); NIH Study Section, Drug Discovery and Mechanisms of Antimicrobial Resistance; Member, Steering Committee World Health Organization Global Salm-Surv; Member, NARMS Steering Committee; Pharmaceuticals in the Environment Workgroup, National Science and Technology Council (NSTC) Committee on Environment and Natural Resources (CENR), Antimicrobial Resistance Subcommittee; Member, Research Peer Review Committee for Research Scientists, NCTR; Editorial Board, Journal of Food Protection; Ad hoc reviewer, Journal of Antimicrobial Chemotherapy, Antimicrobial Agents and Chemotherapy, Emerging Infectious Diseases, Clinical Infectious Diseases, Applied and Environmental Microbiology, Veterinary Microbiology, Environmental Health Perspectives, Journal of Bacteriology, FEMS Microbiology Letters, International Journal of Hygiene and Environmental Health. • Phil Kijak - Member FDA Milk Steering Committee; Member, U.S.Delegation Codex Committee on Residues of Veterinary Drugs in Food; Member, Interagency Residue Control Group. • Renate Reimschuessel - Joint Section Editor: Toxicologic Pathology; FDA Aquaculture Subgroup-Seafood Research Task Force; CVM Aquaculture Coordinating Committee; United States Joint Subcommittee on Aquaculture and JSA Aquaculture Effluents Task Force Member; (co-chair of the National Aquaculture Drug Research Forum, a subgroup of the Joint Subcommittee on Aquaculture (JSA) Working Group for Quality Assurance in Aquaculture Production (WGQAAP)); Technical Subgroup Member: Drugs and Chemicals; site reviewer: “Fish Health in the Chesapeake Bay” Maryland Sea Grant. Accomplishments 77 • Shaohua Zhao - Adjunct Faculty, University of Maryland; Member, Project Advisory Group, FDA/CVM; Member, FDA Microarray Interest Group; Member, Steering Committee World Health Organization Global Salm-Surv; Member, World Health Organization Global Salm-Surv (WHO-GSS) Laboratory Subcommittee; Member, International Association of Food Protection; Member, American Society for Microbiology; Technical consultant, PulseNet for FDA/CFSAN and ORA field laboratories; Editorial Board, Journal of Food Protection; Ad hoc reviewer, Journal of Antimicrobial Chemotherapy, Antimicrobial Agents and Chemotherapy, Journal of Clinical Microbiology, FEMS Microbiology Letters, Epidemiology and Infection, Veterinary Microbiology, and Journal of Veterinary Medicine. Interns and Visiting Scientists College-Level Interns, Graduate Students and Scientists: Ashley Yanchik, King’s College Mentor: Jurgen von Bredow Joe Rubin, University of Saskatchewan Mentor: Shaohua Zhao Visiting Scientists: Roberta Garcia, University of Maryland at Baltimore. Mentor: Renate Reimschuessel Other Events and Activities Awards: Clear Science Communication Award 2006. FDA Science Forum. Awarded to M. Lopez, M. Feldlaufer, and P. Chu. For the poster “Determination of Nitrofuran Residues in Honey.” David N. Heller: 2006 CVM Scientific Achievement Award, Excellence in Analytical Science For developing more efficient multiclass analyses of animal drug residues via LC/MS/MS, and for working to harmonize and substantiate the use of mass spectral data in regulatory action. Heather Harbottle: Best Paper Award, Journal of Aquatic Animal Health for the manuscript “DNA Vaccination against Channel Catfish Virus Results in Minimal Immune Response and is Not Efficacious against Challenge”. Awarded by the American Fisheries Society. Renate Reimschuessel: Outstanding Service Award Citation: For dedication and outstanding effort in developing a database of drugs in Accomplishments 78 fish to support the aquaculture regulatory and scientific communities. Database – Phish-Pharm Group Awards Excellence in Analytical Science. Awarded to the Campylobacter Working Group (P.F. McDermott, S.M. Bodeis). "For the development and validation of a standardized broth microdilution antimicrobial susceptibility testing method for the food borne bacterial pathogen Campylobacter." Shaohua Zhao, Susannah K. Hubert, Jason Abbott, Karen Blickenstaff, Patrick F. McDermott. La Fundación Mexicana para la Salud A.C. Recognizing work with important implications for public health, commerce, and tourism in Mexico. For participation in the published research study “Nontyphoidal Salmonella from human clinical cases, asymptomatic children and raw retail meats in Yucatán, Mexico”. David White, Sherry Ayers, Althea Glenn, Elvira Hall-Robinson, Robert Walker, Patrick McDermott, and the NARMS working group. Sigma Xi Poster Awards, 2006 FDA Science Forum. Antimicrobial resistance among E. coli isolates recovered from retail foods of animal origin, NARMS 2004. Group Recognition Award, Center for Veterinary Medicine Honor Awards, NARMS Retail Meat Group. “For exemplary performance of group members in planning, organizing and successfully executing the first FDA NARMS retail meat annual report.”OR Study 326.04 Scientific Achievement Award Outstanding Inter-center Scientific Collaboration. Working Group on Accumulation of Toxins in Pufferfish from Dietary Sources. Citation: For establishing and maintaining a productive collaboration between CVM and CFSAN that has produced key information to address important issues regarding seafood safety. OR Final Report Summaries 79 OR Study 275.26 Title: Florphenicol Method Development Study Director: J. C. Kawalek Abstract: The final procedure for the analysis of FFL in milk provides for a linear response of FFL in EtOAc extracts of skimmed milk in the range of 1 - 100 ppb. We essentially followed the procedure developed by Pfenning et al. (1998, 2000) for the analysis of “phenicol residues” in milk and shrimp. Dried extracts were derivatized with Sylon BFT. Derivatized extracts are analyzed on an Agilent 6890N GLC equipped with split/splitless injector (split ratio was 10:1with total flow = 27ml/min) and capillary column (HP-5, 0.25µm thick, 30m X 0.32mm id). The injector port was set at 280C and the µECD set at 320C. The column oven was programmed from 200 - 290C @ 25C/min with a 3.6min hold. Helium was used as the carrier gas in constant flow mode (2.2ml/min;44cm/s) with 5% methane/argon as the makeup gas at 60mL/min. Injection volume was set at 2µL. The retention time for FFL was 4.02 min. Initially, we had intended to use an internal standard calibration curve that was prepared in milk; however the final procedure uses an external standard curve. Our procedure is based on performing dilutions of the samples and/or standards prior to extraction using milk from untreated cows. However, one could simply extract the standards and unknowns and then remove smaller aliquots of the EtOAc extract for drying down prior to derivatization to adjust for “out of range” samples. If increased sensitivity is required, a larger sample volume could be extracted, but this will only provide an incremental increase in overall sensitivity. Other steps one could take to increase sensitivity would be to reduce the amount of toluene added to extract the TMS derivative, increase the injection volume, and reduce or eliminate the split ratio of the GLC injector. None of these alternatives were tried - primarily because we had no need to do so. The final procedure eliminates essentially all matrix interference allowing analysis of up to 23 samples, 3 controls, and 7 standards (all in triplicate) in two days by one person (extraction on day 1; derivatization and analysis on day 2). A coordinated effort with two individuals could complete the analyses in one day. The major disadvantage is the requirement to dilute the starting milk to keep standards/samples within the linear dose response range. OR Study 275.28 Title: Evaluation of “Greenies” Study Director: J. C. Kawalek Abstract: This was a study to evaluate the stability of “greenies” to mechanical and enzymatic breakdown. “Greenies” were cut into three sections for these experiments. This was done in an attempt to standardize the test article for measurements. The “greenies” were OR Final Report Summaries 80 OR Final Report Summaries 81 exposed to 10mM HCl and phosphate buffer solutions ranging in pH from ~2 to pH 7. The gastric digestive enzyme, pepsin, was added to the acidic solutions, while the pancreatic enzymes, trypsin, chymotrypsin and amylase were added to the “neutral” solution. Regardless of the buffer/enzyme combination, there was little effect on the “digestibility” of the “greenies.” Use of a “Stomacher” with the acidic pepsin solutions to mimic gastric action was uneventful in that the repetitive action of the paddles at 200rpm for up to 90min left the “greenie” portions intact. After prolonged exposure to all the buffers, the “greenies” were hydrated and they swelled up to ~16% above their starting dimension. They were intact and “bendable” like a piece of rubber. The solid “greenies” were extremely hard could not be broken by hand. Repeated striking with a 13oz hammer was ineffective and only served to generate heat. Using a six lb sledge hammer fractured the “bone” portion off and caused a crack in the stem portion, but otherwise there was no dramatic effect. These “greenies” have the resiliency of a bowling ball. Because they are manufactured under conditions that use high heat and pressure, a possible solution to the problem would be to alter the manufacturing process (e.g., reduce temperature and/or pressure, etc.) such that the product is much less compact and becomes “chewable”. OR Study 301.44 Title: Broad Scan Analysis of Drug Residues in Eggs Study Director: David N. Heller Abstract: The purpose of this study was to provide CVM with more efficient surveillance methods for drug residues in eggs. This study was HFV-510’s first attempt to expand LC/MS methodology to the detection of multiple classes of drug residues in one procedure. The study resulted in the development of two extraction techniques, each of which was capable of recovering several drug classes. The first technique, based on solid phase extraction (SPE) with a hydrophilic polymer, recovered sulfonamides, fluoroquinolones, tetracyclines and beta-lactams. The second technique, based on SPE with a silica phase, recovered macrolide and ionophore drugs as well as several other nonpolar veterinary drugs. Both extracts could be analyzed with via liquid chromatography – tandem ion trap mass spectrometry (LC/MS/MS). The methods were applied to fortified and incurred samples (i.e., eggs from hens dosed individually with various drugs). Method performance was evaluated at a target concentration of 100 ng/mL (ppb) in whole, blended egg. The polyether ionophore compound class was evaluated at 10 ppb due to very good LC/MS/MS sensitivity. Method standard operating procedures (SOPs) were written for each of the two methods. The study resulted in three publications in peer-reviewed journals. Brief surveys of retail eggs were carried out but drug residues were not found at levels that were considered a human health risk. The study OR Final Report Summaries 82 also enabled the evaluation of several metabolites which should be used as marker residues, rather than the parent compounds, when applied in future surveys. OR Study 301.55 Title: Determination of 17a-Methyltestosterone Residues in Fish Study Director: Pak-Sin Chu Abstract: An analytical method was developed to quantitate and confirm the presence of 17a-methyltestosterone in the muscles of tilapia, rainbow trout, and salmon. The method employed two liquidliquid partitioning steps and two solid-phase extraction columns for sample cleanup. The final extracts were analyzed on an isocratic reverse-phase liquid chromatography-tandem mass spectrometry system with atmospheric-pressure chemical ionization in the positive ion mode. The method was validated at levels from 0.40 to 1.6 ng/g, with MT-d3 used as an internal standard. The accuracy was between 100% and 110%, and coefficients of variation of <10% were obtained for all three fish species. Muscle tissues from dosed fish were also assayed to demonstrate the effectiveness of the method for recovering the parent drug. OR Study 306.55 Title: Comparative Confirmation of Residue Identity Using Ion Trap LC/MS Study Director: Mary C. Carson Abstract: The purpose of this study was to acquire data to support the regulatory use of ion trap mass spectrometry for animal drug residue confirmation. At the time of the study initiation, ion trap mass spectrometers were more readily available in regulatory laboratories, but drug sponsors often submitted methods utilizing triple quadrupole mass spectrometers. We intended to analyze the same extracts prepared during a CVM Method Trial, only using an ion trap for the confirmatory analyses. The ion trap confirmatory results were compared to the confirmatory results provided by the developing laboratory. This comparison was only conducted for extracts from a single Method Trial, enrofloxacin in swine liver. The results showed that it was possible to adapt a confirmatory method that was developed on a triple quadrupole mass spectrometer for use with a less expensive ion trap mass spectrometer. The feasibility of doing this ultimately depended on the relative sensitivity of the two instruments, and on the concentration of analyte that must be confirmed. In the case of enrofloxacin, we had to inject five times as much extract on the ion trap as was injected on the triple quadrupole. This in turn meant modifying the OR Final Report Summaries 83 OR Final Report Summaries 84 chromatography in order to maintain acceptable peak shape. The final results met CVM’s criteria for selectivity. The ion trap produced structurally significant fragment ions comparable to those produced in the triple quadrupole. The control liver samples all failed to confirm, the fortified samples all confirmed, and nine of the ten incurred sample extracts also confirmed unambiguously. OR Study 306.70 Title: Evaluation and Validation of Confirmatory Methods for Chloramphenicol In Honey Study Director: Mary C. Carson Abstract: The purpose of this study was to conduct a laboratory evaluation and subsequent validation of one or more extraction procedures for chloramphenicol (CAP) in honey. CAP is an antibiotic that has been banned for use in food-producing animals by the U.S. and other countries due to its association with the development of aplastic anemia in humans. There is no tolerance for this drug. The Canadian Food Inspection Agency had developed a method for CAP which looked promising. CAP is extracted from an aqueous dilution of honey using ethyl acetate. The extracts are evaporated and redissolved in water. CAP is then extracted from the aqueous solutions using reversephase SPE cartridges. CAP is eluted from the reverse-phase cartridges with acetonitrile:water and re-extracted into ethyl acetate. The ethyl acetate is evaporated, and the residue is reconstituted in an aqueous solution. Extracts are chromatographed using a reversed-phased column and analyzed by electrospray negative mode MS-MS. Four product ions of precursors m/z 321 or 323 are monitored. The method meets confirmation criteria recommended by the US Food & Drug Administration and four-point identification criteria established by the European Union. With slight modifications to accommodate different equipment, the method was validated in both Canada and DRC. OR Study 327.30 Title: Assessment of Prohibited Protein Carry-over into Animal Feeds Not Prepared with Prohibited Animal Proteins Study Director: Michael J. Myers Abstract: The purpose of this study was to develop a real-time PCR assays using the existing, validated PCR primers, then use these methods to assess animal protein carry over. Real-time PCR methods are more sensitive than traditional methods, and would provide a better assessment of whether carry-over was occurring. The results demonstrated that the existing PCR methods could be migrated to a real-time platform. However, these initial results were less that ideal, suggesting that additional work would be needed to achieve a workable real-time assay. Because of changes in the focus of our methodology OR Final Report Summaries 85 research, coupled with changes in the regulatory environment, the ultimate goal of this study was no longer needed at this time. OR Study 327.33 Title: Preparation of Feed and Feed Ingredients for ORA Study Director: Michael J. Myers Abstract: Samples of different types of feed ingredients or finished feed were prepared for the six FDA/ORA/DFS labs that routinely analyze animal feed at the request of ORA headquarters management. These samples were used as check/proficiency samples for the feed microscopists. They were then available to the lab analysts for use as authentic standards for routine feed microscopic analyses as well as internal controls when performing various analytical methods for detection of animal proteins in feed and feed ingredients. The samples included bovine meat and bone meal (MBM), porcine MBM, lamb meal, bovine blood meal, fish meal, distillers grain, milk replacer, various animal feeds, and dairy feed fortified with bovine MBM at levels ranging from 0.05% (w/w) to 10% (w/w). After submission of the results to ORA management, these samples were to be retained by the individual laboratories as authentic samples for comparative purposes. OR Study 327.35 Title: Evaluation of the MELISA-Tek Test Kit That Detect Ruminant Proteins in Finished Feed and Feed Components Study Director: Michael J. Myers Abstract: The performance characteristics of two ELISA test kits, ELISA Technologies’ MELISA-Tek™ test and Tepnel BioSystem’s (Cooked) Species Identification™ test, designed to detect bovine proteins in animal feed, were evaluated. The test kits were evaluated using acceptance criteria developed by the Center for Veterinary Medicine’s Office of Research for evaluating selectivity, sensitivity, ruggedness, and specificity. The acceptance criteria for determining success used a statistical approach requiring a 90% probability of achieving the correct response, within a 95% confidence interval. In practice, this measure requires the test to achieve the correct response 58 times for every 60 samples evaluated, or a 96.7% accuracy rate. A minimum detection level of 0.1% bovine meat and bone meal (BMBM) was required, consistent with the sensitivity of the analytical methods used by FDA. Selectivity was assessed by testing 60 dairy feed samples that contained no added animal proteins; sensitivity was determined by evaluating 60 samples (per level of fortification) of this same feed that contained either 0.025%, 0.05%, 0.1%, 0.25%, 0.5%, 1% or 2% BMBM. The MELISA-Tek™ test failed the selectivity OR Final Report Summaries 86 assessment using the acceptance criteria established by the manufacturer, but passed when set point criteria developed by FDA was applied to those results. It also failed the sensitivity assessment, as it satisfactorily detected samples fortified at the 2% level only. The MELISA-Tek™ test came close to passing at the 1% level, detecting true positives at a rate of 93%, but failed to accurately detect samples fortified with BMBM at lower levels. In contrast, the BioKit for (Cooked) Species Identification™ test failed to detect a single sample fortified with BMBM, regardless of the level of fortification. The results of this evaluation indicate that neither test is adequate for routine regulatory use. OR Study 327.36 Title: Further Evaluation of Commercial Test Kits That Detect Mammalian Proteins in Finished Feed and Feed Components Study Director: Michael J. Myers Abstract: The purpose of this study was to further evaluate the Neogen Reveal Ruminant test and the Strategic Diagnostics Feedchek test in an attempt to understand some of the results obtained in our previous examination of the performance characteristics of these two tests. The results suggest that the companies label claim of a 1% (w/w) sensitivity might be capable of being met. However, there are still significant issues associated with the level of mineral content in the feed. Except for selenium, the levels of the individual minerals for both types of dairy feed are within the National Research Council’s recommendations for lactating dairy cattle. The higher rate of inclusion of the dairy mineral premix does provide a higher level of selenium than can legally be added, but the total mineral concentration is not greater than what could be included in a dairy ration. In addition, this test is recommended for use in complete feed and feed supplements. Some feed supplements could possibly have higher mineral concentrations. Thus, the effect of mineral concentration on the sensitivity of the test should be questioned. Different dairy mineral premix inclusion rates did not affect the pH of the feed samples. The FeedChek test continued to have unacceptable false positive levels while having acceptable levels of sensitivity. Different levels of dairy mineral premix did not alter the pH of the Reveal for Ruminant in Feed extraction solution, nor did it affect the (poor) rate of detection for these true positive (1% BMBM) samples. OR Study 401.08 Title: Development of an aquatic bacterial database and the standardization of antimicrobial susceptibility testing methods for fish microflora Study Director: Renate Reimschuessel OR Final Report Summaries 87 Abstract: Recently there has been public concern about the use of antibiotics in aquaculture. Specifically, what potential effects could antibiotic use have on the antimicrobial susceptibilities of aquatic bacteria. In order to begin to evaluate such effects, we have undertaken two main tasks; to obtain and archive aquatic bacterial pathogens, and to develop standardized methods for antimicrobial susceptibility testing (AST) of these organisms. Aquatic bacterial isolates were obtained from industry, colleagues, and researchers from the USA, Norway, Canada, and the United Kingdom for the purpose of building a bacterial database of aquatic isolates at CVM/OR. Isolates in this database were used to develop, optimize, and validate the two most commonly used methods of AST of bacteria isolated from the aquatic environment, disk diffusion and broth microdilution. Many of these isolates prefer or require incubation temperatures lower than the temperatures most commonly used for testing isolates of mammalian origin, 35 °C - 42 °C. A total of 660 aquatic isolates were added to the CVM Culture Collection and most were identified using some of the following identification methods; API, VITEK, fatty acid gas chromatographic analysis, and other routine biochemical reactions. These isolates were also grown on various types of media at various temperatures, and were consequently grouped by their preferred or required growth conditions. This grouping aided the development of AST methods to be used for a wider number of aquatic bacterial genera. To standardize the methods of disk diffusion and broth dilution susceptibility testing at the lower temperatures, two large-scale multiple laboratory trials were coordinated. Studies were conducted with cooperation from researchers in the USA, Norway, Greece, Canada, Australia, and Denmark, in accordance with standards developed by the Clinical Laboratory Standards Institute (formerly the NCCLS). Two quality control (QC) organisms, Escherichia coli ATCC® 25922 and Aeromonas salmonicida subsp. salmonicida ATCC® 33658 were established as QC strains for disk diffusion and broth dilution susceptibility tests conducted at 22şC and 28şC. These studies resulted in the first standardized AST methods for bacterial isolates that prefer or require growth at temperatures <35°C. These QC ranges were established for 10 antimicrobial agents important to global aquaculture (ampicillin, enrofloxacin, erythromycin, florfenicol, flumequine, gentamicin, ormetoprim-sulfadimethoxine, oxolinic acid, oxytetracycline, and trimethoprim-sulfamethoxazole). Methods and QC ranges defined in these studies will enable aquatic animal disease researchers to reliably compare AST data between laboratories, and will be used to ensure both precision and inter-laboratory harmonization. OR Final Report Summaries 88 OR Study 401.13 Title: Incurred Amoxicillin in Tilapia; with additional drugs sulfadimethoxine, oxytetracycline, and malachite green Study Director: Renate Reimschuessel Abstract: The purpose of this study was to expose tilapia to the drugs amoxicillin, ormetoprim and sulfadimethoxine, oxytetracycline, and malachite green to obtain incurred tissue samples necessary to develop multi-drug surveillance methods. Fish were obtained from Aquasafra Inc. in Florida on May 17th, 2000 and acclimated and exposed at OR. Amoxicillin was given orally in a capsule embedded in a cube of gelatin-based fish food (gelfood). Ormetoprim and sulfadimethoxine were given together orally as the medicated fish food Romet 30, and oxytetracycline was given orally in OTC-medicated feed. Malachite green was administered as a bath treatment. One fish was dosed with each drug. Three control fish were included, one acclimated to nonmedicated feed, one acclimated to gelfood, and one taken straight from the holding tank similarly to the malachite green-exposed fish. After incursion, filets were collected and transferred to Dr. Mary Carson (CVM/OR) and Dr. Wendy Andersen (ORA/Animal Drug Research Center, Denver Federal Center) for analysis. OR Study 401.16 Title: Incurred 17 MT in Tilapia, Salmon, and Rainbow Trout Study Director: Renate Reimschuessel Abstract: Rainbow Trout (Oncorhychus mykiss), Atlantic salmon (Salmo salar), and Tilapia (Oreochromis species) were dosed with 17 Methyltestosterone (17MT) to obtain the incurred samples necessary for a method validation of a multi-residue method for 17 MT in aquaculture products. Incurred tissues were requested by FDA/CVM/OR/DRC (Pak-Sin Chu) with ~ 0.1 – 5.0 ppb final tissue concentration. We obtained rainbow trout from Maryland Department of Natural Resources (~100 g). These trout were grown in a recirculating system until the fish were approximately 1.0 kg. Atlantic salmon were obtained from the University of Maine as juveniles (~40 g) and grown in a recirculating system until the fish were approximately 2.0 kg. Tilapia were obtained from Aquasafra, a commercial tilapia hatchery in Florida as fry (~1.0 g) and grown in a recirculating tank system until the fish were approximately 1.0 kg. All exposures to 17 MT were conducted at OR. Both the trout and tilapia were hand fed a 1x2 cm piece of custom made gelatinized fish food containing the dose inside a gelatin capsule. The salmon refused food and were tube-fed a gelatin capsule containing the dose along with gelatinized fish food. Fish were dosed with 30 mg/kg for 4 consecutive days and then sacrificed on OR Final Report Summaries 89 withdrawal day 1, 2, 3, 5, 7 14 or 21 for trout and salmon and also day 28 and 35 for tilapia. At least two control fish were also sampled for each species. Three additional salmon (day 1, 2, 3) and one additional trout (day 7) were dosed to further validate the method. Approximately 0.25 – 0.5 kg of muscle with attached skin was obtained from each fish for each drug. Drug and control filets with skin attached were frozen at –80 şC and delivered to DRC shortly thereafter. See study #301.55 for concentrations of the parent compound in the harvested tissues. OR Study 418.03 Title: Trial of an INAD Method to Determine and Confirm Drug Residues in Swine Liver Study Director: David N. Heller Abstract: A laboratory evaluation was conducted of the Sponsor method for drug residues in swine liver. This method is a dual determinative / confirmatory procedure. The proposed tolerance is 500 ng/g (ppb) in liver. The trial was performed according to the standard operating procedure (SOP) of September 22, 2005, as revised on November 28, 2005. The internal standard was provided by the sponsor. Detection was based on liquid chromatography tandem mass spectrometry (LC/MS/MS) with a Waters Quattro Micro instrument. The results met CVM criteria for quantitative method performance (accuracy 80-110%, CV < 10%). Overall accuracy and CV for 15 samples fortified from 250 – 1000 ng/g were 101% and 2%, respectively. No control sample met confirmation criteria; most didn’t show any signal at all. All the fortified and 10 of 15 unknown samples met the confirmation criteria. A conventional estimate of limit of quantitation (LOQ, based on mean of controls + 10 x StdDev) was 9 ng/g, compared to the low standard which was equivalent to 50 ng/g. OR Final Report Summaries 90 OR Study 420.03 Title: Method Trial for the Confirmatory Procedure for a Marker Residue in Bovine Liver and Muscle Using LC-MS/MS Study Director: Hui Li Abstract: A method provided by a drug sponsor to analyze residual marker residue in bovine liver was evaluated at OR. This method utilizes LC-MS/MS for both confirmation and quantification. Chromatographic peaks with reproducible retention time and good signal-to-noise ratio were obtained. The quantitation of fortified extract (after dilution) at 240 and 480 ng/g (equivalent to 300 and 600 ng/mL) levels both gave satisfactory results. However, for confirmation, extensive false positives among the extracts sent by the sponsor were observed using the sponsor’s confirmation criteria given in the SOP. This issue appears to be originating from overly high sensitivity of the instruments to detect the marker residue at concentrations orders of magnitude below tolerance. Suggestions were made to address the problem and improve the method performance. Center for Veterinary Medicine 2007 RESEARCH REPORT Center for Veterinary Medicine OFFICE OF RESEARCH FY07 ANNUAL REPORT TABLE OF CONTENTS Table of Contents ............................................................................................................................ 1 About the Office of Research.......................................................................................................... 3 Mission..................................................................................................................................... 3 Research Capabilities................................................................................................................ 3 Facilities ................................................................................................................................... 3 Staff.......................................................................................................................................... 4 Office of Research Highlights....................................................................................................... 10 Division of Residue Chemistry (DRC) ................................................................................... 10 Division of Animal Research (DAR)...................................................................................... 14 Division of Animal and Food Microbiology (DAFM) ........................................................... 16 Premarket/Drug Review................................................................................................................ 21 Animal Drug Safety and Efficacy ........................................................................................... 21 Antimicrobial Resistance Mechanisms ................................................................................... 22 Immunopharmacology ............................................................................................................ 25 Metabolism and Residue Depletion ........................................................................................ 28 Method Trials: Chemical......................................................................................................... 31 Microbiological Methods........................................................................................................ 32 Pharmacokinetics/Pharmacodynamics....................................................................................34 Method Development in Support of Minor Use/Minor Species ............................................. 37 Compliance .................................................................................................................................. 39 Drug Residue Methods............................................................................................................ 39 Pharmacokinetics and Residue Depletion .............................................................................. 41 Method Trials and Validation ................................................................................................. 42 Incursion Services ................................................................................................................... 43 Post-Approval Monitoring ............................................................................................................ 44 PulseNet ................................................................................................................................ 44 Retail Meat Surveillance......................................................................................................... 45 ResistVet ................................................................................................................................ 47 Animal Feed Safety....................................................................................................................... 48 BSE—Detecting Prohibited Substances ................................................................................. 48 Surveillance Methods for Animal Feed .................................................................................. 49 Chemical Method Development ..............................................................................................50 Leveraging FDA Resources...........................................................................................................52 Formal Activities .....................................................................................................................52 Informal Activities...................................................................................................................53 Accomplishments ..........................................................................................................................55 Publications...................................................................................................................................55 Presentations .................................................................................................................................60 Outside Reports .............................................................................................................................69 Professional Service.......................................................................................................................69 Interns and Visiting Scientists .......................................................................................................71 Other Events and Activities ...........................................................................................................72 OR Final Report Summaries..........................................................................................................75 Mission The Office of Research (OR) conducts applied and basic research in support of current and evolving FDA regulatory issues. We in partnership with federal and state agencies and other center customers provide research solutions that ensure the safety of animal-derived food and animal health products. Within OR, research is conducted by three Divisions: The Division of Residue Chemistry (DRC) conducts analytical research for compounds which pose a potential health risk if found in animal tissue or feed. The Division develops and validates methods for official and research uses. They determine the fate of xenobiotics in animals to answer questions about their safety or efficacy. The Division of Animal Research (DAR) conducts applied and basic research using animals and animal systems in support of current and evolving regulatory issues. They provide research solutions to issues of animal health, food safety of animal-derived products, and other animal industry associated technologies. The Division of Animal and Food Microbiology (DAFM) conducts basic and applied research involving the isolation, identification, and phenotypic and genotypic characterization of microorganisms potentially harmful to animals and humans. In particular, they explore the effects of antimicrobial use in animals on 1) efficacy against pathogens, 2) changes in the environmental microbial ecology, and 3) the development of antimicrobial resistance in pathogenic and commensal microorganisms. Research Capabilities The Office of Research is a multidisciplinary organization with scientists trained to conduct research in the broad areas of analytical chemistry, biochemistry, pharmacology, toxicology, immunology, microbiology, microbial genetics, animal nutrition, animal science, residue chemistry, and veterinary medicine. Facilities The Office of Research is housed in a state-of-the-art research complex located on 166.5 acres, including approximately 38 acres of pasture in Laurel, MD. The complex consists of offices, laboratories, animal research buildings and support facilities. The laboratories included in the complex are designed and equipped to conduct studies in biochemistry, microbiology, pharmacology, immunology, nutrition, toxicology and various aspects of aquaculture. Specific laboratory capabilities include a radioactive materials lab, mass spectrometry lab, genetic sequencing lab and analytical instrument rooms. The animal research buildings can accommodate a variety of animals such as cattle, both beef and dairy, calves, swine, sheep, poultry, and various fresh and salt water species of fish. The facilities also include surgical suites and recovery rooms for large animals. STAFF DIRECTORY, SEPTEMBER 30, 2007 OFFICE OF THE DIRECTOR (HFV-500) Dr. Marleen M. Wekell, Director 301-210-4136, marleen.wekell@fda.hhs.gov Mr. Michael H. Thomas, Acting Deputy Director 301-210-4650, Michael.thomas@fda.hhs.gov Dr. David G. White, Research Microbiologist, Director of National Antimicrobial Resistance Monitoring System (NARMS) 301-210-4246, david.white@fda.hhs.gov Mr. O.J. Cartwright, Quality Assurance Officer 301-210-4219, orton.cartwright@fda.hhs.gov Ms. Carol Cope, Quality Assurance Officer 301-210-4243, carol.cope@fda.hhs.gov Mr. Bruce Bradley, Safety and Occupational Health Manager 301-210-4687, bruce.bradley@fda.hhs.gov Ms. Vivian Vontress, Management Officer 301-210-4153, vivian.vontress@fda.hhs.gov Administrative Staff (HFV-506) Mrs. Denise Durham, Program Support Specialist 301-210-4186, denise.durham@fda.hhs.gov Ms. Ettie Karpman, Secretary (retired) Mr. Neil Schibblehut, Model Maker 301-210-7852, neil.schibblehut@fda.hhs.gov Mr. John Schrider, Maintenance Mechanic 301-210-7853, john.schrider@fda.hhs.gov Ms. Katie Orr, Program Support Assistant DIVISION OF RESIDUE CHEMISTRY (HFV-510) Dr. Philip J. Kijak, Acting Director 301-210-4589, philip.kijak@fda.hhs.gov Analytical Methods Team (HFV-511) Mr. David N. Heller, Acting Team Leader 301-210-4579, david.heller@fda.hhs.gov Dr. Mary Carson, Chemist 301-210-4651, mary.carson@fda.hhs.gov Dr. Hui Li, Staff Fellow 301-210-4271. hui.li@fda.hhs.gov Ms. Cristina Nochetto, Chemist 301-210-4184, cristina.nochetto@fda.hhs.gov Ms. Shani Smith, Chemist 301-210-4242, shani.smith@fda.hhs.gov Dr. Hemakanthi De Alwis, ORAU Fellow 301-210-4263, hemakanthi.dealwis@fda.hhs.gov Metabolism and Diagnostic Team (HFV-512) Dr. Jurgen von Bredow, Team Leader Dr. Pak-Sin Chu, Research Chemist 301-210-4583, pak.chu@fda.hhs.gov Dr. Mayda Lopez, Chemist 301-210-4587, mayda.lopez@fda.hhs.gov Mr. Nathan Rummel, Chemist 301-210-4289, nathan.rummel@fda.hhs.gov Dr. Badaruddin Shaikh, Research Chemist 301-210-4653, badaruddin.shaikh@fda.hhs.gov Ms. Michelle Smith, Chemist DIVISION OF ANIMAL RESEARCH (HFV-520) Dr. Russell A. Frobish, Director 301-210-4683, russell.frobish@fda.hhs.gov Mrs. Jamie Boehmer, Biologist 301-210-4281, jamie.boehmer@fda.hhs.gov Mrs. Dorothy Farrell, Microbiologist 301-210-4470, dorothy.farrell@fda.hhs.gov Mr. Charles Gieseker, Biologist 301-210-4217, charles.gieseker@fda.hhs.gov Ms. Karyn Howard, Biologist 301-210-4244, karyn.howard@fda.hhs.gov Ms. Yolanda Jones, Biologist 301-210-4135, yolanda.jones@fda.hhs.gov Dr. Joseph C. Kawalek, Research Chemist 301-210-4296, joseph.kawalek@fda.hhs.gov Mr. Ron Miller, ORAU Fellow 301-210-4762, ron.miller@fda.hhs.gov Dr. Michael J. Myers, Research Pharmacologist 301-210-4355, michael.myers@fda.hhs.gov Dr. Renate Reimschuessel, Research Biologist 301-210-4024, renate.reimschuessel@fda.hhs.gov Dr. Michael L. Scott, Staff Fellow Dr. Jeffrey L. Ward, Veterinary Medical Officer 301-210-4216, jeffrey.ward@fda.hhs.gov Mrs. Jewell Washington, Biologist 301-210-4245, jewell.washington@fda.hhs.gov Dr. Haile Yancy, Staff Fellow 301-210-4096, haile.yancy@fda.hhs.gov Animal Care and Use Staff (HFV-521) Mr. Mark Henderson, Biological Science Technician (retired) Mr. Samuel Howard, Animal Caretaker (retired) Mr. Mark McDonald, Animal Scientist 301-210-4658, mark.mcdonald@fda.hhs.gov DIVISION OF ANIMAL AND FOOD MICROBIOLOGY (HFV-530) Dr. David G. White, Director 301-210-4246, david.white@fda.hhs.gov Dr. Beth Karp, NARMS Coordinator 301-210-4090, beth.karp@fda.hhs.gov Microbiology and Molecular Biology Team (HFV-531) Dr. Shaohua Zhao, Team Leader 301-210-4472, shaohua.zhao@fda.hhs.gov Mr. Jason Abbott, Microbiologist 301-210-4185, jason.abbott@fda.hhs.gov Mrs. Karen Blickenstaff, Microbiologist, 301-210-4761, karen.blickenstaff@fda.hhs.gov Mrs. Sonya Bodeis-Jones, Microbiologist 301-210-4251, sonya.bodeis@fda.hhs.gov Mrs. Peggy Carter, Microbiologist 301-210-4256, peggy.carter@fda.hhs.gov Mrs. Patricia Cullen, Microbiologist 301-210-4132, patricia.cullen@fda.hhs.gov Mrs. Sharon Friedman, Microbiologist 301-210-4249, sharon.friedman@fda.hhs.gov Mrs. Althea Glenn, Staff Fellow 301-210-4214, althea.glenn@fda.hhs.gov Ms. Thu-Thuy Tran, ORAU Fellow 301-210-4264, thu-thuy.tran@fda.hhs.gov National Antimicrobial Resistance Monitoring System (NARMS) Team (HFV-532) Dr. Patrick McDermott, Team Leader 301-210-4213, patrick.mcdermott@fda.hhs.gov Mrs. Sherry Ayers, Microbiologist 301-210-4268, sherry.ayers@fda.hhs.gov Mrs. Linda English, Microbiologist 301-210-4585, linda.english@fda.hhs.gov Mr. Stuart Gaines, Microbiologist 301-210-4294, stuart.gaines@fda.hhs.gov Dr. Elvira Hall-Robinson, Epidemiologist 301-210-4255, elvira.hall-robinson@fda.hhs.gov Dr. Heather Harbottle, Microbiologist 301-210-4246, heather.harbottle@fda.hhs.gov Ms. Brenda Kroft, ORAU Fellow 301-210-4265, brenda.kroft@fda.hhs.gov Mr. Shawn McDermott, Microbiologist 301-210-4267, shawn.mcdermott@fda.hhs.gov Mrs. Sadaf Qaiyumi, Visiting Scientist 301-210-4350, sadaf.qaiyumi@fda.hhs.gov Dr. Siddhartha Thakur, Visiting Scientist, 301-210-4264, siddhartha.thakur@fda.hhs.gov Contact Information For more information about the Office of Research and its programs contact: Dr. Marleen M. Wekell, Acting Director, Office of Research 301-210-4136, marleen.wekell@fda.hhs.gov Mr. Michael H. Thomas, Acting Deputy Director, Office of Research 301-210-4650, michael.thomas@fda.hhs.gov Dr. Russell A. Frobish, Director, Division of Animal Research 301-210-4682, russell.frobish@fda.hhs.gov Dr. Philip J. Kijak, Acting Director, Division of Residue Chemistry 301-210-4589, philip.kijak@fda.hhs.gov Dr. David G. White, Director, Division of Food and Animal Microbiology and Director of National Antimicrobial Resistance Monitoring System (NARMS) 301-210-4187, david.white@fda.hhs.gov Dr. Beth Karp, Coordinator, National Antimicrobial Resistance Monitoring System (NARMS) 301-210-4090, beth.karp@fda.hhs.gov Introduction The Office of Research (OR) is the laboratory-based research arm of the Center for Veterinary Medicine (CVM), Food and Drug Administration (FDA). OR’s research priorities are ever changing, being driven by the needs of other CVM offices – i.e., the Office of New Animal Drug Evaluation (ONADE), the Office of Minor Use Minor Species (MUMS) and the Office of Surveillance and Compliance (OSC) and by FDA-wide requirements to thoroughly address the latest food and drug safety concerns. To meet these needs, OR is staffed by researchers with diverse scientific backgrounds – microbiology, biochemistry, toxicology, analytical chemistry, pharmacology, veterinary science, etc. – as well as scientists with specialized training e.g., aquatic science specialists and antimicrobial resistance geneticists. In this section the recent OR studies included are organized by the three OR Divisions in which they were conducted – Division of Residue Chemistry (DRC), Division of Animal Research (DAR) and Division of Animal and Food Microbiology (DAFM). Division of Residue Chemistry OR’s Division of Residue Chemistry (DRC) has been responsible for developing and validating monitoring methods used in FDA’s highly effective milk safety program. More recently, DRC has focused on developing methods to measure drug residues in aquacultured species and honey. DRC scientists are developing data to correlate the concentration of drug in fluids such as plasma and urine to the drug concentration in tissue. The information can be used to develop more efficient monitoring programs for drug residues in animals at or prior to slaughter. Many consumers tout honey as a safe natural sweetener. Yet, as with any animal derived food product, the potential for antibiotic contamination from the inappropriate or illegal use of veterinary drugs exists. Antibiotics are used to control bacterial diseases of honey bees such as the American and the European foulbrood. Tylosin, oxytetracycline, and fumagillin are the only antibiotics approved for the treatment of bee diseases in the United States. Increased resistance to the approved antibiotics and the availability of other inexpensive drugs had led many beekeepers to use non-approved antibiotics to treat honeybees. Inappropriate beekeeping practices can lead to the contamination of the honey. Illegal and unapproved drugs such as chloramphenicol and various fluoroquinolones have been detected in imported honey. The most commonly found antibiotics in honey are sulfonamides, tetracyclines, fluoroquinolones, chloramphenicol, tylosin, lincomycin, and streptomycin. The FDA and many state laboratories utilize several single-class analytical methods for the analysis of antibiotics in honey. In order to lower cost, reduce effort, and expedite surveillance, an analytical method capable of assaying multiple classes of antibiotics concurrently was needed. Office of Research scientists have successfully developed and validated a multi-class/multi-residue method for the analysis of 17 antibiotics in honey. This method is designed to accommodate additional drugs being included at a later time. It can be used as the starting point to create an assay method for a new drug intended to treat honeybees. The method can quantify and confirm the presence of the following antibiotics in honey: chlortetetracycline, doxycycline, oxytetracycline, tetracycline, ciprofloxacin, danofloxacin, difloxacin, enrofloxacin, sarafloxacin, tylosin, lincomycin, streptomycin, sulfathiazole, chloramphenicol, and fumagillin. Erythromycin and monensin can be detected and confirmed but not quantitated. The method was validated using both fortified and incurred honey. Honey samples (~ 2g) were dissolved in 10 mL of water and centrifuged. An aliquot of the supernatant was used to determine streptomycin using electrospray ionization (ESI) in positive ion mode. The remaining supernatant was filtered through a fine-mesh, nylon fabric and cleaned up by solid-phase extraction. After solvent evaporation and sample reconstitution, fifteen antibiotics were assayed by LC-MS/MS using electrospray ionization (ESI) in positive ion mode. Afterwards, chloramphenicol was assayed using ESI in negative ion mode. Extraction Procedure 2 g Honey Sample Add 10 mL water Vortex and centrifuge Analysis of Streptomycin LC-MS/MS positive ESI SPE Cleanup Strata X Solvent Evaporation Reconstitution with water Centrifugation Filtration 100 µL aliquot Analysis of 15 drugs LC-MS/MS positive ESI Analysis of Chloramphenicol LC-MS/MS negative ESI The method was validated using fortified honey samples at the low part per billion levels for most of the drugs with accuracies between 65 – 104% and coefficients of variation (CV) of = 16%. Collaborators from the Bee Research Laboratory of the United States Department of Agriculture dosed honey bee colonies with the 17 antibiotics to produce incurred honey to test the analytical method. The CVs of the antibiotics in the incurred samples were < 13%. Outstanding accomplishments of the method were that a single sample preparation method, one LC column, and a straightforward mass spectrometer hardware set up were used in the assay even thought so many different classes of compounds are assayed concurrently. Also, matrix effects on the assay (suppression or enhancement of the analyte response in the mass spectrometer) caused by honey of different floral and geographical origins were found to be much less than those reported in the literature for other analytical methods in honey. Division of Animal Research (DAR) During the past year, the Division of Animal Research has conducted research in support of the pre-market and post-market programs of the Center. The research efforts are designed to provide information for assessing the safety and efficacy of drugs, supporting the Minor Use/Minor Species program. supporting the preparation of guidance documents, developing analytical methodology necessary to support the Agency’s Feed Ban, and supporting the Agency’s efforts to protect the nation’s food supply from harmful chemicals. CVM’s Office of Research scientists provided major support for the Center during the Pet Food Recall of 2007. During the initial investigations, our scientists conducted an extensive review of the literature of melamine and related triazine compounds. They found instances where small renal changes had been noted in original reports, but had not been referenced in more recent review articles. They compiled extensive literature on cyanuric acid and other triazines, and did comprehensive web searches on sources of these compounds in China. These searches brought to light Russian articles that reported toxicity studies of triazines administered in combinations rather than alone. Due to the similarity between the renal crystals found in the dog and cat kidneys and uric acid crystals found in humans with gout, our scientists formed a hypothesis that melamine,acting in combination with another compound, became insoluble and could induce renal failure in animals via a mechanism similar to uric acid nephropathy, a rare syndrome seen in humans undergoing chemotherapy. This hypothesis was put forward in early April 2007, just 3 weeks after the recall began. Using their expertise in pathology, our scientists worked with pathologists at the AVMA and AAVLD (American Association of Veterinary Laboratory Diagnosticians) to interpret their histopathology findings. The veterinary pathologists had voiced concerns that the crystals in histology sections were too few in number to cause renal failure. OR scientists obtained tissues from affected pets and demonstrated that the crystals, dissolved in formalin over time. This fact helped explain why relatively few crystals were present in some specimens submitted after being preserved in formalin. These results were reported to the AAVLD and AVMA, and as a result the recommendations for submitting specimens were modified to stress the importance of providing frozen tissues in addition to fixed tissues. Later, in collaboration with FDA scientists at the Forensic Chemistry Center in Cincinnati, Ohio, the composition of the crystals was determined to be melamine:cyanuric acid. When the recalled products were traced to food animal feeds, CVM was greatly concerned about the potential for contaminated filets entering the food chain. CVM scientists began to develop more refined methods for testing triazines in animal feeds. CVM’s residue chemists developed provisional extraction methods to detect melamine or cyanuric acid in a variety of feed formulations and ingredients. The methods included a novel liquid chromatographic system that can analyze for both cyanuric acid and melamine in the same run without derivatization. These methods were applied to commercial aquaculture feeds in use at OR. Since there were no compliance methods for detecting melamine in fish or meats, a high priority was placed on developing tissue methods for melamine and related triazines. CVM’s residue chemists participated in Agency-wide information-sharing aimed at accelerating the development of tissues methods. In order to validate these methods, collaborating FDA chemists needed tissues from animals that had ingested those chemicals. CVM’s aquaculture research group was the first laboratory to respond, providing tissues from trout, catfish, tilapia and salmon dosed with melamine, cyanuric acid and a combination of both melamine and cyanuric acid. CVM was also the first laboratory to demonstrate the formation of renal crystals in fish treated with melamine in combination with cyanuric acid. Those crystals had the same morphologic appearance as the crystals found in kidneys from pets affected by the recalled foods. Office of Research’s work investigating the melamine-related renal toxicosis provided key insights into the causes and the mechanisms of toxicity. The extensive review of the literature, experimental investigation of pet kidneys and rapid response to agency requests for incurred tissues led to major advances during the crisis. Aquaculture DAR scientist conducted studies to support new drug development while assuring human food safety under the Minor Species Minor Uses Animal Health Act. During 2007, DAR scientists used aquatic animal models of diseases to examine the efficacy, safety, environmental fate and residue levels of compounds that may be used in fish farming. We used a disease model developed at CVM to induce a fungal disease in catfish, and then conducted a GLP study in catfish to determine the efficacy of formalin to reduce mortalities associated with fungal (Saprolegnia sp.) infections. The Phish-Pharm database was updated in 2007 and was put on CVM’s website (http://www.fda.gov/cvm/addaquainfo.htm). It is available as an Excel file, an Access database, and a stand alone database package. This relational database provides information on pharmacokinetic parameters in fish, providing rapid access to data about drug and chemical half-lives in fish tissues. DAR scientists developed and published two methods for assaying oxytetracycline (OTC) in fish blood, an HPLC method and a microbiological assay (to show biological activity). In addition, DAR scientists tested a model for furnunculosis in trout to obtain data on pharmacokinetics of OTC in diseased fish. These methods will help FDA begin to establish breakpoints for aquatic animal drugs . BSE—Methods for Detecting Prohibited Materials A study is being conducted to produce antibodies capable of detecting just bovine meat and bone meal. This test would allow for the differentiation between prohibited proteins from bovine proteins that are exempt under the 1997 Feed Ban. This new test would permit a laboratory to ascertain if the PCR positive result for bovine materials was due to the presence of bovine muscle or some other exempted bovine protein. Pharmacokinetics/ Pharmacodynamics A is underway to provide a pharmacokinetic comparison of several approved anthelmintics in a major species (cattle) and minor species (sheep and goats). We have completed the animal phase for levamisole, fenbendazole, albendazole, and one dosage of ivermectin. The study will include the use of doramectin, moxidectin and a second dosage form of ivermectin. Plasma samples are being collected over the entire posttreatment period and up to and in some cases beyond the specified withdrawal times. Heads of steers were perfused with an acrylic polymer via the common carotid arteries in order to map the possible pathways for drugs injected at the base of the ear to gain access to the cerebral vasculature and cause sudden death or other adverse events. By tracing the ear vessels toward the skull, one can find that a possible pathway to the brain exists via the maxillary artery and the rostral and caudal rete branches of this artery. Cattle do not have a functional internal carotid artery, and therefore backflush via that pathway is not a possible route to the brain. Immunopharmacology The laboratory phase of a coliform mastitis study in which dairy cattle were inoculated intramammarily with Escherichia coli and administered either flunixin meglumine or carprofen (non-steroidal anti-inflammatory drugs) continues. Protein expression in both fluid and cytosolic milk fractions collected prior to and after inoculation have been profiled. The resulting peptide sequences were used to query databases to identify cytosolic and whey proteins expressed during coliform mastitis. Changes in milk protein expression levels were detected as early as 12-18 hours post infection, and were correlated to increases in rectal temperature and milk somatic cell measurements. The response of the proteins established as being expressed only during coliform infection to non-steroidal antiinflammatory drugs will be evaluated. Division of Animal and Food Microbiology (DAFM) The Division of Animal and Food Microbiology conducts basic and applied microbiological research in support of the Center’s pre-marketing and post-marketing regulatory responsibilities. This research includes: developing standards for measuring the efficacy of anti-bacterial agents; surveillance of retail meat commodities for antimicrobial-resistance among foodborne bacteria; monitoring of animal feeds and animal production environments for the prevalence and dissemination of select enteric bacteria, including the emergence and spread of antimicrobial resistance among potential food-borne pathogens; and using DNA fingerprinting and other phenotypic and genetic markers to determine the source and relatedness of enteric pathogens isolated from humans and food animals. DAFM has initiated and collaborates on a number of research studies, both internally- and externally-funded, that are aimed at developing approaches to support the safe use of antimicrobial agents in food animals. This research has multiple focuses. Standardized Susceptibility Testing Methods These include the development of standardized testing methods to ensure the intra- and inter-laboratory reproducibility of data generated from antimicrobial susceptibility testing. Standardized methods ensure that data can be compared over time between different testing laboratories. DAFM research also focuses on strategies designed to understand the mechanisms and dissemination of antimicrobial resistance in order to prolong the use of antimicrobial drugs as therapeutic agents and reduce the prevalence of antimicrobial resistant bacteria throughout the food production continuum. Standardized in vitro antimicrobial susceptibility testing methods are important to the FDA, both for food safety surveillance purposes and for ensuring the reliability of data submitted to the Agency by drug sponsors. In 2006, DAFM scientists completed a multi-laboratory study to standardize an in vitro antimicrobial resistance screening method for Campylobacter based on disk diffusion. This study showed that standard disk masses resulted in no zones of bacterial growth inhibition for strains resistant to erythromycin or ciprofloxacin, the two recommended antimicrobials for treating campylobacteriosis. This method has been incorporated into the CLSI M45-P document. Source Tracking For food-borne bacteria, identifying the source of contamination is an essential first step in preventing human infections. Moreover, it is important to determine whether the source of contamination is of human, environmental, or animal origin. Each year, it is estimated that there are approximately 76 million food-borne infections leading to 325,000 hospitalizations in the United States. With the large toll attributed to these food-borne pathogens, many of which are associated with food animal products, a reliable method to identify the origin of the pathogen would help target control measures to improve food safety. The objective of this ongoing study is to utilize genetic and biochemical methods to determine the animal origin of Campylobacter and Salmonella isolates. Data from this study will be an important element in determining if the emergence of Campylobacter or Salmonella in humans is due to the transfer of these pathogens from particular animal groups, or whether they exhibit a weakly clonal population structure with no animal host specificity. Furthermore, these studies will help to monitor the safety of the U.S. food supply by determining the influence of agricultural practices on the development of antimicrobial resistance in different use environments. PulseNet PulseNet, the national molecular subtyping network for food-borne disease surveillance, was established in 1996 through a collaborative effort of CDC, FDA, USDA and state health departments. The program uses pulsed-field gel electrophoresis (PFGE) as the DNA fingerprinting method to identify the source of food-borne illness outbreaks. PulseNet has already been highly successful in preventing and reducing food-borne outbreaks. CVM’s efforts as part of PulseNet focus on characterizing bacterial strains obtained from food-producing animals and retail meats. Data from these samples provide a critical link with NARMS, a surveillance program that monitors trends in antimicrobial susceptibility (see below). The PulseNet database represents a powerful epidemiological tool to conduct trace-back studies during outbreaks of food-borne illness, leading to faster intervention and establishment of control measures. PFGE and Antimicrobial Resistance Profiles in Salmonella Typhimurium In CVM, PulseNet-related accomplishments in 2006 included subtyping of more than 1,000 Salmonella, E. coli, and Campylobacter isolates recovered from food animals, retail meats and human by PFGE. More than two thousand Salmonella and Campylobacter isolates were analyzed by PFGE using second enzyme. Our data show that multi-drug resistant Salmonella serotypes other than Typhimurium and Newport, such as Agona, Uganda, Dublin, and Heidelberg, etc., have emerged in the United States. Results demonstrated that resistant isolates spread between animals and humans. The research supports the conclusion that for food- borne bacteria isolated from a food animal or its derived meats, which show indistinguishable DNA fingerprints patterns from a human isolate, the animal or meat can be considered as the source of the human outbreak. The PulseNet data base also will allow CDC and CVM to monitor emerging of multi-drug resistant (MDR) food-borne pathogens in the United States, and to understand how bacterial antimicrobial resistance develops, disseminates, and persists in the animal production environment, retail foods and how such pathogens contribute to human illness. To date, CVM PulseNet database has more than 7,000 data entries, which include 4,015 Salmonella, 432 E. coli, 2,646 Campylobacter, and 69 Vibrio. NARMS Contamination of foods destined for human consumption is a major concern for the Food and Drug Administration, the Center for Disease Control and Prevention and the U.S. Department of Agriculture. In 1996, these three government agencies initiated a program to monitor Salmonella, Campylobacter, Escherichia coli and Enterococcus isolated from cattle, pigs, chickens and turkeys and to compare the serotype and/or antibiogram of these bacteria to bacteria of the same species isolated from humans. In 2002, the program was expanded to include the sampling of select retail meats from cattle, pigs, chickens, and turkeys. The retail meat component is made possible through the CDC, which contracts with 10 state public health laboratories to collect ground beef and ground turkey, pork chops, and chicken breasts from local food markets in their respective states. These samples are then processed by each state laboratory using the same methods for the isolation and identification of Salmonella and Campylobacter (four sites are also isolating and identifying Escherichia coli and Enterococcus). In 2006, nearly 4800 meats were cultured. Once identified, the isolates are sent to the Office of Research where their identity is confirmed and they are subjected to antimicrobial susceptibility tests. Salmonella and Campylobacter are also analyzed by PFGE, and the patterns are submitted to PulseNet. In addition to processing the isolates from the retail meats, the Office of Research also monitors the quality of data generated by the participating laboratories through training and quality control testing. Animal Drug Safety & Efficacy INTRODUCTION. The mission statement for Agency research states “FDA uses innovative science-based decision making to efficiently evaluate and make available beneficial new products, to develop sound safety standards and guidance, and to rapidly identify and address emerging public health needs.” Research at OR enables the Center to resolve regulatory issues in the area of animal drug safety and efficacy on a scientific basis. IMPACT. Results of these investigations provide pivotal data to support the approval of selected drugs for use in aquatic species. This provides safe and effective drugs to an industry with limited availability of approved drugs with other species. Other research with terrestrial species is designed to develop models for conducting safety and efficacy studies. This work may alter the types and number of studies required, or identify the end points for demonstrating safety or efficacy, thus improving the efficiency of the drug approval process. ACCOMPLISHMENTS • We conducted a GLP study using a catfish fungal disease model we had developed in support of an INAD. This study determined the ability of formalin treatments to reduce mortality associated with fungal (Saprolegnia) infections in channel catfish.. • We published our method for maintaining a population of largemouth bass infected with the renal parasite Alcopenteron ureterectes, the only documented laboratory infection model of this parasite. We continued evaluating the effects of selected anthelmintics against the monogenean in vitro. Such studies are important for developing guidance for sponsors of potential anthelminitic drugs to treat internal fish parasites.. • We submitted a manuscript describing the accumulation of oxytetracycline (OTC) in a model “not-target” species of aquatic algae Chlamydonomonas reinhardtii. Using fluorescent imaging we showed that OTC accumulates within descrete organells in the algae. Since the public and FDA is becoming increasingly concerned about the effects of pharmaceuticals in the environment, it is important to determine how antimicrobial use will affect algal growth and to what extent the compound may accumulate in these organisms.. • We published the PhishPharm pharmacokinetic database on line (http://www.aapsj.org/view.asp?art= aapsj070230). It is available as an Excel file, an Access database file and a stand alone database package for those who do not have the Microsoft Access program. Phish-Pharm includes information from over 400 articles and provides rapid access to data about drug and chemical half-lives in fish tissues. The data can be sorted and rapidly retrieved, identifying not only the residue levels in a particular species of fish, but the experimental conditions such as temperature, salinity, and duration of exposure. This database is a valuable tool for both regulators and researchers of aquatic therapeutics. • We developed and published two methods for assaying oxytetracycline (OTC) in fish blood, an HPLC method and a microbiological assay (to show biological activity). • We developed and tested a model for furnunculosis (a bacterial disease) in trout. Diseased fish were treated with OTC in order to obtain pharmacokinetic data in diseased fish. Most frequently, such PK data is derived only from normal fish. These data in diseased animals will help FDA begin to establish breakpoints for aquatic animal drugs. • We conducted a study to evaluate the effect of renal failure on hematologic parameters in trout. Using a gentamicin model for inducing renal failure we demonstrated that packed cell volume and total protein decline as renal failure progresses. This study provides vital information on osmoregulation during disease, which can help correlate pharmacokinetic information in diseased animals. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Antimicrobial Resistance Mechanisms INTRODUCTION. CVM collaborates on and has initiated a number of research studies, both internally and externally-funded, aimed at developing approaches to support the safe use of antimicrobials in food animals. This research focuses on strategies designed to provide greater understanding of the mechanisms of antimicrobial resistance in order to prolong the use of antimicrobial drugs as therapeutic agents and reduce the prevalence of antimicrobial resistant bacteria throughout the food production continuum. IMPACT. The data from these projects help to define and differentiate the genetic elements in bacteria isolated from animals that contribute to the emergence and spread of antimicrobial resistance. ACCOMPLISHMENTS • CVM is investigating molecular typing tools to help determine the animal origin of food-borne bacterial pathogens. To date, over 4000 Salmonella and Campylobacter isolates have been characterized using a combination of two or more of the following methods: antibiotic susceptibility testing (AST); serotyping, plasmid profiling; pulsedfield gel electrophoresis (PFGE) using single and multiple enzymes; repetitive element PCR (Rep-PCR); multilocus sequence typing (MLST); fatty acid profiling; and more recently protein profiling, virulence gene profiling, and microarray. Results from serotyping, AST, PFGE, and MLST have provided the following associations between animal hosts and food-borne pathogens: specific serotypes have been found to be associated only with certain food animal groups; AST profiles have shown certain resistance phenotypes to be occurring with particular animal hosts; and PFGE profiles coupled with AST profiles and MLST sequence types have been shown to be associated with particular animal hosts. Protein profiling of approximately 30 isolates of one Salmonella serotype has identified a unique protein associated with specific PFGE fingerprint clusters. Two-enzyme PFGE has been shown to have better discriminatory power than MLST for Campylobacter coli isolates, showing genotypic diversity with some evidence of clonality among isolates recovered from retail chicken breasts and ill humans. Optimization and standardization techniques for a multi-pathogen identification and characterization microarray including Salmonella, Campylobacter, and E. coli identification probes is underway and nearing completion for use in screening virulence genes and antimicrobial resistance genes of isolates from a number of animal sources. PCR validation of this array has been completed and array refinements are underway. Alternative methods are being examined at OR and the Center for Food Safety and Nutrition, Office of Scientific Analysis and Support. CONTACT: Dr. Heather Harbottle, 301-210-4246, heather.harbottle@fda.hhs.gov • As part of an ongoing collaboration with veterinary diagnostic laboratories, we have characterized a total of one hundred and six Pseudomonas aeruginosa isolates recovered from clinically ill dogs between 2003 and 2006 in the United States. Antimicrobial susceptibility profiles were determined and the genetic basis of fluoroquinolone resistance was characterized. The presence of class 1 integrons was also screened by PCR. Of the ß-lactams tested, all isolates were resistant to ampicillin, cefoxitin, cefpodoxime, cephalothin and cefazolin, however, less than 10% of isolates were resistant to cefotaxime/clavulanic acid, ceftazidime, piperacillin/tazobactam and cefepime. Two isolates were resistant to the carbapenems, one to imipenem and the other to meropenem. Among the quinolones and fluoroquinolones, most isolates were resistant to nalidixic acid (96%), followed by orbifloxacin (52%), difloxacin (43%), enrofloxacin (31%), marbofloxacin (27%), gatifloxacin (23%), levofloxacin (21%) and ciprofloxacin (16%). The 102 nalidixic acid resistant isolates were screened for QRDR (quinolone resistance determining region) point mutations in the gyrA, gyrB, parC and parE genes; these mutations were present in 34 strains. There was an association between QRDR mutations and increasing fluoroquinolone MICs. Interestingly, only two isolates contained integrons and both carried the aadA gene conferring streptomycin and spectinomycin resistance. The level of resistance found in this study suggests that many of the antimicrobial agents commonly used in companion animal medicine may not constitute appropriate therapy for the treatment of canine pseudomonas infections. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov The NARMS program has identified many different Salmonella strains resistant to high numbers of antimicrobials. In an effort to understand the genetic bases for these multidrug-resistant (MDR) resistance profiles, CVM scientists collaborated with CFSAN researchers and investigators from the J. Craig Venter Institute to sequence the genomes of 17 salmonella strains representing 12 serovars of public health importance. The strains were selected in part to understand the genetic differences between resistant and susceptible strains of the same serotype. DNA sequence analysis showed that the same family of MDR plasmids in Salmonella infecting humans is also present in Yersinia, Klebsiella and Escherichia coli. In addition, screening tests showed that this MDR plasmid is widespread geographically and. among different meat commodities, and can be transmitted to susceptible bacteria. In addition, the whole genome sequence data, which currently is being annotated and analyzed, will shed light on the genetic basis for virulence, serotype, and animal host specificity. This work will supply the data needed to develop rapid molecular diagnostic tests for detecting resistance genes of biomedical importance, and provide a means to rapidly characterize field strains to support animal and public health epidemiology and guide anti-infective therapy. CONTACT: Dr. Patrick McDermott, 301-210-4213, patrick.mcdermott@fda.hhs.gov • Extended-spectrum cephalosporin (ESC) resistance in Salmonella is an especially important health issue, since this class of drugs is used to treat pediatric infections and severe infections in adults. A total of 345 ampicillin-resistant Salmonella were screened for the presence of the major genes know to confer ESC resistance, namely CTX-M, CMY, TEM, SHV and OXA. These isolates were also resistant to 5 or more antimicrobial classes. One hundred seventy-two were found to carry CMY-2 and displayed resistance to ceftiofur, an ESC used in food animal medicine. In addition, 160 carried TEM-1, 9 of which also had CMY-2. SHV, OXA and CTX were not detected in any strains, unlike what is seen in other geographic regions. These data help describe the genetic bases for ESC resistance in Salmonella from the U.S., and the nature and magnitude of the resistance phenotypes present in strains carrying CMY-2. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov Immuno- Pharmacology INTRODUCTION. ONADE and OR scientists are collaborating on several studies designed to provide needed scientific data in support of the ONADE review function. One such collaboration involves examining the standards for the manufacturing of sterile, pyrogen-free animal pharmaceuticals (e.g., contamination of injectables, intra-mammary infusion, and intra-uterine drugs in cattle). The investigation focuses on determining the permissible levels of endotoxin contamination and the biological relevance of this contamination. Other investigations attempt to identify biomarkers indicative of inflammation or disease in animals. IMPACT. The outcome from these investigations should provide pivotal data to determine if current threshold for pyrogen contamination meets, exceeds, or is less than permissible levels of endotoxin as shown by the biological indicators and their relevance to health and welfare within a given species. In addition, the discovery of differently expressed proteins indicative of inflammation or other diseases in animals could lead to the establishment of more accurate biomarkers to evaluate drug efficacy and aid in the approval of new veterinary drugs. ACCOMPLISHMENTS • Animal telemetry data collected from one of six treatment groups divided according to LPS (E. coli 055:B5) dose (1.0, 0.60, and 0.05- ug/kg BW of Hostein steers) and means of administration (intravenous bolus or infusion) have been further examined along side colonic temperatures and body surface temperatures (inner ear) determined by infrared technologies (thermography). Limited information provided by the study revealed: 10 useful starting points to begin a more formal endotoxin safety investigation (i.e., region near 0.05-ug using 1.0-ug LPS as a positive control) and 2) a more sensitive means of body temperature change (subcutaneous telemetry sensors) will be needed to record the effects of LPS concentrations below 0.60-ug/kg of BW. The addition of a more sensitive measure even at the higher temperatures would provide data as to how quick the temperature was affecting the different bodily functions of the animal, in place of core body temperature that rises and drops slower by telemetry measurement. The formal study will be conducted with multiple means of temperature measurement: core body (telemetry), subcutaneous body (telemetry), colonic or rectal, and surface of inner ear (similar to tympanic; thermography). • We also generated data using a heart rate belt (belt around the girth) on Holstein steers using telemetry technology. However, after looking at the clinical signs of LPS sepsis in some of the steers, the heart rate belts were replaced with a more sophisticated telemetry tool which uses a different form of recording device to record respiration rate. Animals receiving different concentrations of LPS demonstrated varying levels of respiratory stress. Measurement of this parameter in the formal study will provide useful information. • To gauge the physiological response caused by the different potencies of LPS in the Holstein steers, different biological markers were investigated. Plasma and serum collected at time of study have been used to work out procedures and perform ELISAs on cortisol, haptoglobin, lipopolysaccharide-binding protein, nitrotyrosine, amyloid-A, albumin, and 8-hydroxy-2’ deosyguanosin. Analyses have been completed on lactate, glucose, blood gas, blood pH, electrolytes, hematology, and blood pressure. Whole blood samples, representing different time points, LPS concentrations, and modes of administration, were collected in special RNA tubes and processed for analysis by Bovine Gene Array to assess up and down regulation of genes under these conditions • A novel physiological measure during LPS sepsis will be applied to the formal study as a result of partial blindness that occurred in one steer dosed with LPS. The steer fully recovered from this temporary condition; however, this incident raised the question “can LPS potentially cause a neurological or immunological disorder or unwanted secondary result that results in blindness or an increase in intra-ocular pressure. For these reasons, a Tona Vet will be adopted for use with bovine to measure intra-ocular pressure in LPS treated steers. CONTACT: Dr. Russell Frobish, 301–210–4683, russell.frobish@fda.hhs.gov • We have completed the animal phase of a coliform mastitis study in which 24 dairy cattle were inoculated intra-mammarily with Escherichia coli (strain P4), and administered either flunixin meglumine or carprofen (non-steroidal anti-inflammatory drugs) eight hours post inoculation. Milk and plasma samples were collected at regular intervals and physiological data were collected. • 2-D gel electrophoresis was used to profile protein expression in both fluid and cytosolic milk fractions collected prior to inoculation with Escherichia coli, and at 12, 18, 24, 36, and 48 hours post infection. Proteins present in non-mastitic milk samples as well as proteins expressed in milk only during coliform mastitis were excised from 2- D gels, digested with trypsin, and the tryptic peptides evaluated using liquid chromatography followed by mass spectrometry. The resulting peptide sequences were used to query protein databases (Swiss-Prot and liquid chromatography followed by mass spectrometry. The resulting peptide sequences were used to query protein databases (Swiss-Prot and MSDB) to identify cytosolic and whey proteins expressed during coliform mastitis. To date, several proteins associated with innate immune response have been identified. In general, changes in milk protein expression levels could detected as early as 12-18 hours post infection, and were correlated to increases in rectal temperature and milk somatic cell measurements. Future analyses will include bovine serum albumin removal in pooled whey and cytosolic milk protein fractions in attempt to unmask any low abundance proteins not previously identified. As well, the response of the proteins established as being expressed only during coliform infection to non-steroidal anti-inflammatory drugs will be evaluated and any potential differential. CONTACT: Jamie L. Boehmer 301-210-4281, jamie.boehmer@fda.hhs.gov • We initiated studies in swine to identify biomarkers of inflammation. These markers would be used as adjunct measures of efficacy to help drug sponsors establish an anti-inflammatory claim for non-steroidal anti-inflammatory drugs (NSAID). There currently are no NSAIDs approved with an anti-inflammatory claim. This study will use a combination of clinical, biochemical, and molecular endpoints to identify and develop reliable biomarkers of inflammation which also track with therapeutic outcomes. This work will use two different models of inflammation, a systemic inflammatory model and a model of a local, soft tissue inflammation. Work to date at the molecular level has identified some unique genes which may be potential biomarkers at both the molecular and whole animal level. CONTACT: Dr. Michael J. Myers, 301-210-4355, michael.myers@fda.hhs.gov Metabolism and Residue Depletion Identification of Marker Residue and Depletion of Erythromycin in Salmon INTRODUCTION. There is currently an INAD before the Center for erythromycin use in farmed salmon. It is sponsored by a consortium of producers. Initial depletion studies were conducted using a microbiological inhibition assay to determine residue. To support the INAD, NCTR developed a chemical LC-fluorescence method to determine residues. When both methods were applied to the same incurred residue tissue in a bridging study, the microbiological assay consistently found higher concentrations of residue, suggesting the presence of metabolites not detected in the chemical assay. Metabolism of erythromycin in mammals is well-characterized, and it is possible to identify these known metabolites without using radioactive dosing by using LC-MSn to analyze the incurred residue tissues. IMPACT. This study provides the necessary metabolite identification data, determinative and confirmatory method development and validation to support the approval of a MUMS drug candidate. In addition, the LCMSn method being used can be incorporated into a multi-class method, facilitating eventual surveillance for erythromycin residues. ACCOMPLISHMENTS Following our previous year’s work, we conducted a larger depletion study of erythromycin in salmon. The LC-MSn method had been validated for determination of erythromycin A and Ndemethylerythromycin A, and estimation of putative anhydroerythromycin A by reference calibration. The accuracy of the method for the first two compounds at 0.5 ppm was 83% and 81%, with CVs of 18% and 15%, respectively. The limit of detection was < 0.01 ppm for both. For the depletion study, salmon were fed 100 mg erythromycin A thiocyanate for three days, and then allowed to deplete for up to 28 days. The results showed that erythromycin rapidly metabolizes, and that by three days depletion most of the residue is present as metabolites. A portion of each depletion sample was also sent to FDA’s Denver District Office for determination of residue by a microbial inhibition assay. Best correlation (R2 = 0.9994) with the microbial assay results occurred if a fraction (10%-empirically selected) of the total estimated metabolite concentration was included with the parent erythromycin concentration found by the LC-MSn assay. . Comparison of Ery A plus 10% of metabolites vs. Microbial Inhibition Assay Concentration y = 0.5108x + 0.1124 R2 = 0.9994 0 5 10 15 20 25 0 10 20 30 40 5 CONTACTS: Dr. Mary Carson, 301-210-4652, mary.carson@fda.hhs.gov Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Method Trials: Chemical INTRODUCTION. A drug sponsor must provide FDA with a method to detect residues for new animal drugs intended for use in food producing animals. The methods are submitted by drug developers as part of the approval process for a New Animal Drug Application (NADA). Typically, the method consists of two parts, a determinative procedure to quantify the amount of drug residue present, and a confirmatory procedure to unambiguously identify the presence of the drug residue. Recent advances in analytical chemistry using liquid chromatography/mass spectrometry (LC-MS) have made it possible to combine the two procedures into a single method. The trials for NADA methods are typically coordinated by the drug sponsor in what is known as a Sponsor-Monitored Method Trial. Before the start of the trial, the sponsor is given the option of holding a method demonstration at either the sponsor’s laboratory or the CVM research facility. To ensure that the method is practical for use, the CVM laboratory serves as one of the participants in the method trial for the determinative procedure. CVM/DRC serves as the expert laboratory for all confirmatory procedures. IMPACT. The acceptance of new methods is an integral part of the approval process of NADAs for drugs used in food animals. Approved methods must be suitable for use in FDA-ORA and USDA-FSIS laboratories with written procedures that are clear, complete, and free of ambiguity. The methods are needed to ensure that the approved drugs are not being misused, and the analytical results generated with these methods can be used with confidence by the Center when undertaking regulatory actions. ACCOMPLISHMENTS • DRC participated in a Sponsor-Monitored Method Trial based on a method demonstrated at OR in the 2005. The trial had been temporarily suspended because of problems transferring the method from the developers’ laboratory to the participating laboratories. The method trial was successful largely due to information developed at DRC which demonstrated that LCMS matrix effects on the sponsor’s instrument were not duplicated on instruments in the other laboratories. The method trial was completed after the sponsor modified the original method to reduce matrix effects. Research initiated at DRC in response to this experience resulted in a publication describing a new technique for ruggedness testing LC/MS methods for the influence of matrix effects. • DRC began the evaluation of a multispecies confirmatory method. In this study, the confirmatory method evaluated will be used both in support of a pending New Animal Drug Application (NADA) and to provide updated confirmatory procedures for previously-approved NADAs from the sponsor for the compound. • For both trials, DRC completed the work within the time frame agreed upon with the sponsor. CONTACT: Dr. Philip J. Kijak, 301-210-4589, philip.kijak@fda.hhs.gov Microbiological Methods INTRODUCTION. The Biological Methods program seeks to develop, improve, and implement diagnostic methods for the detection of pathogenic microorganisms or their toxins and chemical residues in food animals, their environments, and their derived food products. Most current bacteriological methods are time consuming and labor intensive, requiring that organisms be isolated in pure culture before subsequent biochemical testing. Similarly, detection of toxins may require extensive bioassays. We are continually evaluating methods that will enhance our ability to detect microorganisms in various matrices, including litter, bedding (straw/hay), animal feed of all types, and food. IMPACT. Once isolated and identified, determining a bacterium's antimicrobial susceptibility profile is of considerable importance to CVM for several reasons. These research activities provide the Agency with up-to-date data on the potential fate of an approved antimicrobial in its usage environment, including its effects on bacteria other than the target microorganisms. Accurate testing methods are essential, and OR scientists are closely involved in validating methods and establishing quality control and interpretative criteria in association with the Clinical Laboratory Standards Institute (CLSI). This has allowed CVM to establish a quality control testing program for NARMS, as well as teach these methods to visiting scientists from other federal agencies. In addition, improvement in early warning systems to notify people of harmful biological conditions that may threaten a food source is integral to the Agency’s mission to protect the food supply. ACCOMPLISHMENTS • CVM has completed studies to improve upon a previously established broth microdilution antimicrobial susceptibility testing method for Campylobacter. A second multi-laboratory study has successfully determined quality control ranges for an additional six antimicrobial agents, resulting in a method that now allows for a total of fourteen antimicrobials to be tested. This will permit greater flexibility to clinical, research and surveillance laboratories interested in testing Campylobacter for antimicrobial susceptibility.CVM completed studies to develop a disk diffusion method to screen Campylobacter for antimicrobial resistance to the two first-line antimicrobials, erythromycin and ciprofloxacin. This approach is more rapid and less expensive that dilution methods. As such, it is more suitable to microbiologists in resource poor laboratories testing Campylobacter susceptibility to these agents. CONTACT: Dr. Patrick McDermott, 301-210-4213, patrick.mcdermott@fda.hhs.gov • We published a manuscript reporting the antimicrobial susceptibility results of over 200 Aeromonas salmonicida isolates. Minimal inhibitory concentration (MIC) and diameter of the zone of inhibition oxytetracycline, ormetoprim-sulfadimethoxine and oxolinic acid revealed two distinct populations of bacteria. Isolates tested against florfenicol clustered into a single population. Oxolinic acid susceptibility data revealed higher MICs in the non-United States A. salmonicida isolates. Slow-growing (atypical) A. salmonicida isolates were generally more susceptible than typical isolates for all antimicrobials, except oxolinic acid. These distributions were used to determine epidemiologic cutoff values, which will help the Agency when it begins to develop breakpoint values.. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov • Using our new AST methods published by CLSI, we conducted antimicrobial susceptibility testing of over 200 Aeromonas salmonicida isolates, approximately 100 from the United States and 100 from outside the United States. Minimal inhibitory concentration (MIC) and diameter of the zone of inhibition for oxytetracycline, ormetoprim-sulfadimethoxine, oxolinic acid, and florfenicol were determined for each isolate. Susceptibility tests for oxytetracycline, ormetoprim-sulfadimethoxine and oxolinic acid revealed two distinct populations of bacteria. Isolates tested against florfenicol clustered into a single population. Oxolinic acid susceptibility data revealed higher MICs in the non-United States A. salmonicida isolates. Slow-growing (atypical) A. salmonicida isolates were generally more susceptible than typical isolates for all antimicrobials, except oxolinic acid. Frequently, distributions of susceptibility results are being used to develop epidemiologic cutoff values. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Pharmacokinetics and pharmacodynamics INTRODUCTION: Investigations of the pharmacokinetic/pharmacodynamic characteristics of various drugs are being conducted in several different animal species and for several different purposes. One investigation compares drug pharmacokinetics in healthy versus diseased animals. The drug concentration at an infection site reaching the responsible bacterial pathogen is dependent on the pharmacokineticbehavior of the administered drug in the target animal species. Essentially all pharmacokinetic data submitted to CVM are generated in normal, healthy animals. Therefore, CVM is unable to validate the assumption that pharmacokinetic parameters are unaltered in the diseased state compared to the healthy state for that drug/disease/animal species. Should this assumption be incorrect, we are at risk not only of therapeutic failures, but of equal or greater importance, of also risking the public health via the inadequate exposure of pathogen to the drug. PK/PD studies are conducted in support of the Center’s Minor Use/ Minor Species (MUMS) program and its Critical Path Initiative involving Process Analytical Technology (PAT). In regards to the MUMS program, there are limited data on the pharmacokinetics of anthelmintics used in the parasite control of small ruminants (sheep and goats). Approvals for use in these minor species rely on data generated in the major species, namely, cattle. In support of PAT, pharmacokinetic studies are necessary to provide in vivo data for correlation with in vitro dissolution data. Pharmacokinetic studies are also conducted in aquaculture species to provide information necessary for the development of interpretive criteria. Another area of investigation involves studying the ear as an injection site in cattle. CVM’s Office of New Animal Drug Evaluation (ONADE) currently has several drug products approved, or under investigation, that designate the ear pinna as the site for subcutaneous injection. The ear has become an increasingly common site for the injection of therapeutic and production drugs in cattle, primarily because the problem of extended drug residues at the injection site is avoided, and it is also less likely to result in carcass damage and trimming required at the time of slaughter. However, field safety studies with some of these drugs have resulted in several reports of acute death following administration. These cases have been attributed to inadvertent injection of the drug into an artery, resulting in back-flush into the cerebral blood supply, leading to embolism and death. While CVM/ONADE has requested that the drugs in question be studied, in order to determine if the adverse events are volume-related or due to physical/chemical properties of the drug/carrier, it has become apparent that no detailed anatomical references exist that describe the blood vessels on the posterior aspect of the bovine ear. IMPACT: Results from these investigations will provide the scientific support for the development of guidance documents and regulatory decisions within the Center. This research will help CVM identify those (if any) classes of compounds where we need to factor the disease condition into our human food safety assessments. This information will be invaluable in designing pre-approval studies for assessing the potential for selecting for resistant bacterial strains, and for selecting optimal dosage rates and intervals. Comparative pharmacokinetic studies involving cattle, sheep and goats will facilitate development of guidelines for conducting future studies under the Minor Use/Minor Species Program (MUMS). Correlations of this type are necessary to determine whether manufacturing changes as measured by Near IR under PAT will be an adequate quality control tool that can be used to assess changes in final product composition and if these changes have a potential impact on drug disposition in vivo. ACCOMPLISHMENTS: • We are currently conducting a pharmacokinetic/pharmacodynamic (PK/PD) study of tilmicosin (a macrolide antibiotic) in 16 beef steers, both in the healthy state and also following induction of pneumonia with Mannheimia haemolytica. Following administration of the drug to all animals in the healthy state, and analysis of plasma and bronchial fluid pharmacokinetics, eight animals will subsequently be infected with M. haemolytica (with eight serving as controls) and the experiment repeated. In addition, the eight control animals from the tilmicosin study will be subjected to a similar protocol (4 infected / 4 controls) using the triamilide antibiotic tulathromycin. These experiments are designed to investigate the effects of infection on active levels and disposition of these two antibiotics. In order to map the possible pathways for drugs injected at the base of the ear to gain access to the cerebral vasculature and cause sudden death or other adverse events, the heads of 6 steers were perfused with an acrylic polymer via the common carotid arteries. In one additional steer a latex-based polymer was used, but the compound fragmented upon digestion of the skull tissues and no useable vascular casts were obtained. Direct injection of the polymers into the superficial ear arteries was not possible due to the small size of the vessels and the viscosity of the compound. Complete anatomical identification of all arteries, and comparison of vessels between animals, has not yet been completed. The anatomical analysis is being done in collaboration with Dr. Larry Freeman at VMRCVM, but has been temporarily delayed. Preliminary analysis of the arteries supplying the ear reveals vessels approximately 1.5 to 2.5 mm in diameter, which narrow substantially as one moves from the base towards the tip of the ear. Tracing the ear vessels proximally toward the skull, a possible pathway to the brain exists via the maxillary artery and the rostral and caudal rete branches of this artery. Cattle do not have a functional internal carotid artery, and therefore back-flush via that pathway is not a possible route to the brain CONTACT: Dr. Jeffrey L. Ward, 301-210-4216, jeffrey.ward@fda.hhs.gov • There are currently no FDA accepted interpretive criteria for antimicrobials in aquatic organisms. During FY 07, we published two methods for determining oxytetracycline concentrations in fish blood. These methods, an HPLC and a microbiological assay will be used to determine PK parameters of OTC in trout. We also used a model for furnunculosis in rainbow trout to examine the effect of disease on the PK of OTC in both healthy and infected fish. We are currently preparing a manuscript detailing these data, which will provide information critical for developing interpretive critieria. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov • A study is being conducted to provide a pharmacokinetic comparison of several approved anthelmintics in a major species (cattle) and minor species (sheep and goats). The drugs to be administered include levamisole, fenbendazole, albendazole, ivermectin, doramectin and moxidectin. Except for doramectin, which is administered subcutaneously, all the other dosage forms will be administered as oral formulations. Two different dosage forms of ivermectin are to be tested in all three species. Plasma samples will be collected over the entire posttreatment period up to and in some cases beyond the specified withdrawal times. Previous studies with the avermectin class of drugs indicated they are easily measured in plasma of calves for 12-16 weeks after treatment. We have completed the animal phase for levamisole, fenbendazole, albendazole, and one dosage of ivermectin. Sample collections after treatments with doramectin and moxidectin are ongoing with the second ivermectin treatment started prior to the end of the fiscal year. However, because of the prolonged elimination phase, sample collection will continue into October and finish at the end of November. Sample analyses are ongoing. CONTACT: Dr. Joseph C. Kawalek, 301-210-4296, joseph.kawalek@fda.hhs.gov Method Development in Support of Minor Use Minor Species INTRODUCTION. The passage of The Minor Use and Minor Species Animal Health Act of 2004 recognized the need to increase the availability of drugs for minor species. A major cost incurred by a drug sponsor is the need to develop analytical methodology to monitor for drug residues. The advancement of LC-MS technology has allowed the development of methods that can detect a wide range of compounds in a single chromatographic analysis. The high specificity of the MS detector also means that simpler extraction and purification procedures may be used. OR is developing “off the shelf” multiresidue methods that can be used by drug sponsors in support of approvals for use in minor species. IMPACT. By developing methods that can be used “off the shelf” for the quantitation and confirmation of a drug in a minor species, the research supports the Agency’s Critical Path initiative. The research benefits the agency by providing methods that utilize resources for monitoring more efficiently. Additionally, it can serve as a model of an alternative more efficient approach for the development of all regulatory drug residue methods. The current approach to the development of drug residue methods is expensive, sometimes delays the approval of needed drugs, and does not provide efficient methods for enforcement. ACCOMPLISHMENTS Multiresidue Methods • Determination and Confirmation of Antibiotic Residues in Honey. A multi-class/multi-residue LC-MS/MS analytical method was developed for the determination and confirmation of 17 antibiotics in honey at levels that would likely be involved in the regulation and surveillance of these drugs in honey. Honey, is a much different matrix than tissue containing sugars, waxes and pollen along with other ingredients. The honey matrix varies considerably depending on the floral source of the nectar. The variations in the honey require additional effort into determining matrix effects on the performance of the method. During method development, it was discovered that the use of a matrix standard was needed to give reliable results. Matrix effects were minimized by matching the shade of darkness of the control honey used for the matrix standards to that of the honey being tested. This project was a collaborative effort between DRC scientists and the Bee Research Laboratory of the U.S. Dept. of Agriculture in Beltsville, Maryland. Initially, only the parent drugs of the approved and the banned antibiotics most commonly found in honey were targeted. The method is designed so it can expanded to include, more banned antibiotics, and new drugs being tested at the Bee Research Laboratory for their efficacy against bee diseases CONTACT: Dr. Mayda López, 301-210-4587, mayda.lopez@fda.hhs.gov Drug Residue Methods INTRODUCTION. The drug residue method development program addresses the needs of CVM's post-approval activities for analytical methods for drug residues in animal-derived foods. While drug sponsors are responsible for developing methods for new animal drugs, these methods are usually developed only for the requested use and will be for a specific species and target organ. Therefore, CVM must also develop analytical methods. For example, it was reported that antiviral drugs were being administered to poultry in China in an effort to control avian influenza. Due to concern that indiscriminate agricultural use of these compounds might lead to the development of resistant viral strains, CVM issued an Order of Prohibition banning the use of adamantanes and neuraminidase inhibitors in poultry. However, currently no analytical methods for these compounds are available in poultry tissues. The Agency’s Pandemic Preparedness Plan calls for the development of such methods. Another example is the extralabel use of animal drugs by veterinarians under certain conditions allowed under Animal Medicinal Drug Use Clarification Act (AMDUCA). To assure no residues remain, it is necessary to measure them; however, analytical methods may not be available for that extralabel use. Also, import products may contain residues of drugs not allowed for use in the United States. FDA and USDA-FSIS require regulatory methods that can detect and measure a broad range of drugs at very low concentrations, yet are rugged, fast, economical, and safe. Addressing these needs involves incorporating new cleanup, separation, and detection technologies into regulatory methods for drug residues. At the completion of method development, a standard operating procedure is prepared and methods are validated. DRC continues to place more emphasis on mass spectrometric methods due to their high degree of specificity, potential for high throughput, or ability to analyze multiple residues in a single procedure. The focus of the current compliance methods development is for enforcement methods developed in response to a specific need. For example, nitrofuran residues have been detected in products from Southeast Asia. When these drug residue problems were detected by other countries, the FDA did not have suitable methods for regulatory analysis. In response to the problem, DRC adapted and validated methods for these compounds to provide the Agency with acceptable methods for regulatory analysis. Drug Residue Methods IMPACT. Validated methods are critical to understanding and monitoring the safety of food products from animals. Needed enforcement methods allow the Agency to respond to emerging drug residue problems. ACCOMPLISHMENTS Detection of antiviral drug residues in poultry products. Recently, a highly pathogenic and virulent strain of avian influenza emerged in Asia. Scientists speculate that an avian influenza could transform into the next human influenza pandemic. In November 2005, the WHO, FAO and OIE jointly urged their Member States to not use antivirals in animals, in order to preserve their efficacy for human use. By March 2006, the U.S. FDA had published a rule prohibiting the extralabel use of adamantanes and neuraminidase inhibitors in chickens, turkeys, and ducks. We, in a collaborative effort between CVM and the Central Science Laboratory of the U.K, are developing an LC-MS/MS method to enforce these prohibitions. Our method target level is in the low µg kg-1 range (10 ppb or less). The analytes of interest are amantadine, rimantadine, oseltamivir phosphate (Tamiflu®), oseltamivir carboxylate (active metabolite of Tamiflu®), and zanamivir (Relenza®). These compounds have diverse chemistries, with the last two being highly hydrophilic zwitterions. A solution of acidified water and acetonitrile (ACN) is an effective extractant of all five analytes from chicken tissue. • Several chromatographic approaches were evaluated. The best results were obtained using the ZIC silica-based HILIC column with an ACN:aqueous gradient. Work is underway to minimize matrix effects by adequate chromatography, sample clean-up, and use of a TurboIonSpray interface on a 4000 Q Trap mass spectrometer. CONTACT: Dr. Mary Carson, 301-210-4652, mary.carson@fda.hhs.gov • Steroid Hormones in Beef Muscle. Steroid hormones are drugs effective in promoting weight gain and in improving feed efficiency in animals. In the United States, six steroid hormones (testosterone, progesterone, estradiol, trenbolone acetate, zeranol, and melengestrol acetate) are approved for use in beef cattle; however, the use of any steroid hormones in the European Union is strictly prohibited. Contamination of meat from animals treated with steroid hormones is a cause of concern for international trade. For this reason, DRC scientists have initiated the development of a multi-residue method for the determination of steroid hormones in beef muscle. In the analysis of steroid hormones, conventional methods have relied on derivatization of steroid hormones followed by gas-chromatographymass spectrometry/mass spectrometry analysis. In this project, DRC scientists explore the use of liquid-chromatography-mass spectrometry/mass spectrometry with focus on the conjugated metabolites. CONTACT: Dr. Pak-Sin Chu, 301-210-4583, pak.chu@fda.hhs.gov Pharmacokinetics and Residue Depletion INTRODUCTION. Better testing methods are required to screen animals for drug residues at slaughter plants. One of the major problems with most current screening strategies for drug residues is the need to test on tissue samples that require processing before testing and are not available prior to slaughter. Appropriate testing of an easily obtained fluid would allow for better testing at the plant and could possibly allow antemortem testing. Penicillin continues to be one of the most important antibiotics used in food animal feedlots. There are ongoing concerns that the drug is being used in an unapproved manner. Although the tolerance for penicillin in swine is zero, the safe level, or negligible residue level, is 50 ppb. The determination of penicillin in tissues and biological fluids will provide information that will allow correlations to be established to allow surrogate fluids to be tested in order to determine if the concentration of the drug has depleted to an acceptable concentration in the tissue. IMPACT. Utilization of pre-slaughter test kits can prevent the waste of animals which have simply been slaughtered too soon after the last injection of antibiotic. ACCOMPLISHMENTS • The first phase of the tissue fluid correlation study for penicillin in swine study has been completed. The purpose of the initial phase was to determine if anesthesia used on the animal would have any effect on the depletion of penicillin from the animal. The analytical methods were based on the methods developed for use in the development of tissue fluid correlations for steers. The methods were adapted and validated for use in swine tissue and fluid. CONTACT: Dr. Philip Kijak, 301-210-4589, philip.kijak@fda.hhs.gov Method Trials and Validation INTRODUCTION. CVM validates analytical methods for use in FDA-ORA field laboratories for compliance testing through a process known as a method trial. The purpose of the method trial is to establish that the method performs as claimed, that this performance is fit for the intended purpose, and that the technology transfer is successful. Residue methods test for violative residues of illegal residues of unapproved drugs. Violative residues may indicate improper drug use that could contribute to antibiotic resistance. Methods may be developed at CVM or submitted by other Federal or state regulatory laboratories for use as enforcement tools. These methods are validated through the non-NADA method trial program. IMPACT. The method trial program provides the FDA-ORA, USDA-FSIS, and others with regulatory methods that are suitable for the intended use with written procedures that are clear, complete, and free of ambiguity. The methods are used in support of regulatory programs, and the data generated using these methods can be used with confidence by the Center when undertaking regulatory actions. ACCOMPLISHMENTS • We coordinated with ORA to begin the evaluation of several methods including several of the OR multiresidue methods. We are working with the Animal Drug Research Center at the FDA Denver District to start a multi-laboratory trial of a method for malachite green and gentian violet in finfish. We have provided the shrimp multiresidue • method to the Denver District Laboratory and are providing samples for a single laboratory validation of the method, and the finfish multiresidue method to the Southeast Regional Laboratory in Atlanta for an evaluation. CONTACT: Dr. Philip J. Kijak, 301-210-4589, philip.kijak@fda.hhs.gov Incursion Services DAR continued providing tissues of fish dosed with a variety of drugs and chemicals to develop methods in several species of fish, including tilapia, Atlantic salmon, rainbow trout and channel catfish. These tissues are necessary to ensure that the methods work for some of the more complex matrices found in fish flesh. Incurred tissues are also used for method validation trials, conducted by multiple laboratories in collaboration with OR scientists. Considerable effort is put into maintaining a population of contaminant free fish which are essential for control tissues. In addition, DAR scientists provided tissues from fish treated with several dosages and varying depletion times. Notably, we provided incurred residues for melamine, cyanuric acid and a 1:1 combination of melamine:cyanuric acid in 4 species of fish at 1, 3, 6 or 10 and 14 days post-dosing. We also provided tissues from chickens and hogs at 1 day post-dosing. The information derived from this work has helped the Agency in its risk analysis. Developing methods for chemicals being used in foreign countries will help prevent contaminated food from entering the U.S. and also will help efforts to develop import tolerance levels of selected drugs. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov PulseNet INTRODUCTION. PulseNet, the national molecular subtyping network for food-borne disease surveillance, was established in 1996 through a collaborative effort of CDC, FDA, USDA, and state health departments. The program uses pulsed-field gel electrophoresis (PFGE) as the DNA fingerprinting method to pinpoint trace the source of food-borne illness outbreak. PulseNet has already been highly successful in preventing and reducing food-borne illness outbreaks. In the past, PulseNet has focused on food-borne pathogens isolated from patients and foods because foodborne pathogen isolates from animals were limited. In a collaboration with USDA, FoodNet, and FDA/ORA, DAFM researchers are obtaining isolates of Salmonella, Campylobacter and E. coli O157:H7 isolates from food animals, and it’s derived meats, fresh produce, and animal feeds.. These isolates are subjected to susceptibility testing, serotyping and are subtyped by PFGE. The DNA fingerprinting patterns of the isolates are shared with PulseNet. IMPACT. CVM’s efforts as part of PulseNet focus on characterizing bacterial strains obtained from food-producing animals and retail meats. Data from these samples provide a critical link with the NARMS program, a sentinel surveillance system focused on the identification, and antimicrobial susceptibility testing of food-borne bacteria. PulseNet studies help to reveal if there is a clonal spread of food-borne pathogens, including resistant isolates, between animals and humans or whether there is widespread dissemination of unrelated strains. Also, Salmonella isolates are examined at the genetic level for the presence of specific resistance determinants, which may spread independently of the bacterial hosts. These studies will help us better understand the genetic diversity of Salmonella and Campylobacter, the link of these pathogens between animals and humans, and whether antibiotic usage in animal husbandry may influence antimicrobial resistance in food-borne pathogens, including the extent of resistance gene transfer between animal and human food-borne pathogens. ACCOMPLISHMENTS • We have established DNA fingerprinting databases for E. coli O157:H7, Salmonella, and Campylobacter. A database is being developed for Vibrio and Bacillus as well. • Databases are being shared with PulseNet at CDC and exchanged with all the PulseNet participants through the web board. • We subtyped bacterial pathogens not only from NARMS/FoodNet and veterinary diagnostic laboratories, but also from the ResistVet surveillance program in Mexico, as well as the USDA-AMS produce survey program. We also analyzed PFGE patterns of Salmonella which are submitted from FDA/ORA field laboratories. Those Salmonella were isolated from animal feed. • To date, CVM PulseNet database has more than 8,000 data entries, which include 5,092 Salmonella, 432 E. coli, 2,723 Campylobacter, 112 Bacillus and 69 Vibrio. • For FY 2007, we have used PFGE to subtype more than 1,000 Salmonella, E. coli, and Campylobacter isolates recovered from food animals, retail meats and human by PFGE. All Salmonella and Campylobacter isolates were subtyped by PFGE using second enzyme. Total of 1,411 PFGE patterns have been submitted to CDC national PulseNet database. Our data suggest that multi-drug resistant Salmonella serotypes other than Typhimurium , Newport, Agona, Uganda, Dublin, and Heidelberg are emergent in the United States, with antimicrobial resistant clones spreading between animals and humans. The new MDR clone that was observed in 2007 was S. Kentucky. The clone showed resistance to ten of 15 antimicrobials tested. The four isolates of this MDR clone were all isolated from chicken breast. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov Retail Meat Surveillance INTRODUCTION. The goal of this surveillance program is to provide data to the National Antimicrobial Resistance Monitoring System (NARMS) on the prevalence and extent of antimicrobial resistance in foodborne bacteria from retail chicken, turkey, pork, and beef products. Retail meat surveillance provides information on isolates at the consumer level by sampling meat products in the 10 FoodNet sites (CA, CO, CN, GA, MD, MN, NY, TN, OR, NM). Each site cultures meat samples for the presence of Salmonella and Campylobacter. In addition, four sites (GA, MD, OR, TN) test samples for E. coli and Enterococcus. All participating laboratories use similar methods adapted from the FDA Bacteriological Analytical Manual and may receive additional training at the Office of Research. Isolates are sent to FDA/OR for confirmatory and additional testing. In the five years (2002-2006) since the NARMS retail meat surveillance program began, over 20,000 samples have been tested Retail Meat Surveillance IMPACT. This program is central to FDA programs designed to limit the development and dissemination of antimicrobial-resistant food-borne pathogens by providing an ongoing surveillance of retail meats. This will help to provide information that is necessary to develop and implement science-based measures to prevent or reduce the transfer of resistant pathogens to humans via the food supply. ACCOMPLISHMENTS • CVM/OR published the 2005 annual report of the NARMS retail meats surveillance, available at: http://www.fda.gov/cvm/NARMSReport2005.htm. This website is updated as new information becomes available. Studies on isolates collected in 2006 are nearly completed. The results should be posted on the CVM web site in mid 2008 CONTACT: Dr. Elvira Hall-Robinson, 301-210-4214 Elvira.Hall- Robinson@fda.hhs.gov. • Salmonella Heidelberg is frequently associated with foodborne illness in humans, and is commonly isolated from poultry and their derived meats. A recent upsurge in antimicrobial resistance in this serovar has also been recognized. We compared the prevalence of S. Heidelberg from retail meats during 2002-2006. A total of 297 S. Heidelberg isolates were recovered, representing 22% (297/1372) of all Salmonella serovars from retail meats. Overall, 178 (60%) from ground turkey, 109 (37%) from chicken breast and 10 (2%) from pork chop; with no S. Heidelberg in ground beef. A total of 197 (66%) of the isolates were resistant to at least one of the 15 antimicrobial, 49 (16%) were resistant to >5 antimicrobials, and 5 isolates (1.7%) were resistant to >9 antimicrobials, the latter being recovered form ground turkey only. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov • In collaboration with Colleagues in Denmark, Thailand and the CDC, 581 Salmonella Schwarzengrund from persons, food, and food animals in Denmark, Thailand, and the United States were compared by antimicrobial drug susceptibility and pulsed-field gel electrophoresis (PFGE) typing. Resistance, including resistance to nalidixic acid, was frequent among isolates from persons and chickens in Thailand, persons in the United States, and food imported from Thailand to Denmark and the United States. This study suggests the spread of multidrug-resistant S. Schwarzengrund from chickens to persons in Thailand, and from imported Thai food products to persons in Denmark and the United States. This highlights the importance of international trade in the spread of foodborne pathogens. CONTACT: Dr. Patrick McDermott, 301-210-4213, patrick.mcdermott@fda.hhs.gov ResistVet INTRODUCTION. ResistVet is a surveillance program for food-borne pathogens in Mexico. Using NARMS as a template, CVM has collaborated with Mexican public health officials to help establish a system for monitoring trends in antimicrobial resistance in isolates of Salmonella, E. coli and Campylobacter from humans (healthy and ill), food animals (poultry, swine) and retail meats (chicken, pork). IMPACT. The ResistVet program has provided data on the prevalence and antimicrobial resistance of food-borne isolates in Mexico. This information assists the FDA in better understanding how the situation in Mexico compares to that is the US, including the microbiological status of imported meats and animals from Mexico. ACCOMPLISHMENTS • In 2007, CVM/OR continued a collaboration with Mexico’s ResistVet Surveillance Program by performing genetic analysis of Salmonella strains collected in their surveillance laboratories. Isolates from retail foods, and healthy and ill people were assayed for antimicrobial susceptibility, analyzed for resistance gene content, and compared using pulsed field gel electrophoresis (PFGE) and plasmid typing. Data from the CVM/ResistVet collaboration showed how extended-spectrum cephalosporing resistant Salmonella Typhimurium infections increased rapidly over the past five years, with many recent isolates showing resistance to a large number of antimicrobials. PFGE analysis suggest that multidrug-resistant S. Typhimurium are arising mainly from pork products. CONTACT: Dr. Patrick McDermott, 301-210 4213, patrick.mcdermott@fda.hhs.gov BSE— Detecting Prohibited Substance INTRODUCTION. In an attempt to prevent the emergence of bovine spongiform encephalopathy (BSE) in U.S. cattle, FDA established a ban on using processed animal proteins in feed for ruminants. However, CVM did not have an analytical method to detect these prohibited proteins in animal feeds. Initially, CVM validated a PCR-based method for the detection of primer pairs that permit detection of DNA derived from either swine, sheep, and goats, poultry, and horse, as well as a primer set capable of simultaneously detecting DNA derived from cattle, sheep, goats, deer, elk, horse, and swine. The PCR method using the bovine-specific primers was transferred to ORA laboratories and has been used for the analysis of regulatory samples. • Work continues on our third generation PCR method for detection of rendered animal proteins in feed. While previous work centered on the detection of a single species in a single reaction, we have been able to develop a multiplex PCR method that will permit detection of materials derived from cattle, sheep, goat, deer, or elk within a single reaction. This approach reduces the need for 5 separate reactions down to one reaction, leading to a reduced cost for the overall analysis for these five ruminants. • A separate line of research focuses on the production of antibodies capable of detecting bovine meat and bone meal. The approach being used would generate antibodies capable of detecting just bovine meat and bone meal, a protein source prohibited from being fed to ruminants, from other bovine proteins exempted under the 1997 Feed Ban. These antibodies would also be species specific, detecting just bovine meat and bone meal. The ultimate goal is to use these antibodies in a new immunochemically-based diagnostic test that has greater sensitivity than found in currently available immunochemicalbased diagnostic tests. This new test could be used as an adjunct test to the two methods currently used by FDA (PCR and feed microscopy) or as a stand-alone test for laboratories that do not have the resources to perform those methods. This test would permit a laboratory to ascertain if their PCR positive result for bovine materials was due to the presence of bovine muscle (positive ELISA test result) or some other bovine protein (negative ELISA test result). CONTACT: Dr. Michael J. Myers, 301-210-4355, michael.myers@fda.hhs.gov Surveillance Methods for Animal Feed INTRODUCTION. Aflatoxins are specific mycotoxins that occur in nature and may contaminate corn and grains. The contamination of corn and grains with aflatoxins may lead to intoxication or death of the animals consuming the feed. Drought conditions will increase the prevalence of aflatoxin as occurred with the current corn crop in several areas of the United States. Feeds must be monitored for aflatoxin. Contamination and the distribution and sale of aflatoxin contaminated feeds must be controlled. The sensitivity and reliability of commercially available aflatoxin screening test kits are being evaluated with fortified and incurred samples of corn. IMPACT. Validating rapid screen test kits will be useful in allowing animal feed regulators to make rapid decisions about the level of aflatoxin contamination of feed and if the feed is safe to support beef and dairy herds. ACCOMPLISHMENTS • The commercially available test kit manufactured by Neogen (Agriscreen) test is rapid, simple field test capable of indicating the absence or presence of greater than tolerance concentrations of the sum total of the aflatoxin components in corn. A batch of naturally incurred aflatoxin in ground corn certified by Trilogy labs to contain tolerance levels of aflatoxin was purchased for the final validation of test kit performance. The test system was challenged with aflatoxin contaminated corn containing normal levels of feed components. The performance of the Agri-Screen test was not affected by the presence of alfalfa, molasses, proteins, beet pulp, or various salts. Agri-Screen was used to estimate the aflatoxin content of a sample of dog food partially composed of corn. An aflatoxin contamination in the dog food was estimated at 30 times tolerance. Testing the highly contaminated dog food required dilution to test the sample within the dynamic range of the test kit. Preliminary studies with the Alfa Test P(Vicam) demonstrated the ability to accurately determine the level of aflatoxin, but the system is more complicated and will require a well established laboratory and a trained technician to perform this test. CONTACT: Jurgen von Bredow, 301-210-4651, jurgen.vonbredow@fda.hhs.gov Chemical Method Development INTRODUCTION. The impact of contaminants in animal feed was seen this past spring and summer when a major recall of pet food occurred due to animal deaths. The deaths were associated with the presence of an industrial chemical, melamine, in the food. There are potential health risks associated with contamination of animal feeds by inappropriate drug levels, insecticides, fungal mycotoxins, industrial contaminants or other harmful chemicals. The sources of feed ingredients are driven by cost and availability. The increased production of ethanol for fuel has led to large amounts of dried distiller’s grains (DDGs) being available for animal feed. Antibiotics are used to prevent bacterial growth in the fermentation process. The amounts and types of antibiotics present in DDGs are unknown. Additionally, information on the fate of aflatoxin and other mycotoxins in the fermentation process is limited. Improved methods are needed to test DDGs and provide better information on the types and amounts of contaminants that might be found. Many compounds of concern are amenable to analysis by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Methods have been developed that will combine simple liquid extractions of animal feeds with sensitive LC-MS/MS or GC/MS surveillance for a wide range of compounds. A standardized set of model feeds was used to challenge the new methods, based on the wide range of protein, carbohydrate, fiber, oil and moisture content that might be present in feed formulations. IMPACT. The LC-MS/MS approach will allow us to efficiently monitor for many suspect compounds in animal feed. In addition, the methods will enable us to verify that such compounds are not present, in cases of suspected contamination. ACCOMPLISHMENTS • During the current phase of this multi-year method development project, a procedure was developed for extraction and analysis of nonpolar pesticides fro the carbamate and organophosphate classes along with the polyether ionophore class. A provisional standard operating procedure was written for solvent extraction followed by solid-phase extraction with analysis by LC-MS/MS. • A literature search was conducted and a promising technical approach was identified for evaluation, based on an LC-MS/MS method for multiple mycotoxins in feeds and feed ingredients. A complete program for safe handling and disposal of mycotoxins was initiated. • Also under this study, OR participated in the Agency response to the finding of melamine in feed ingredients. Provisional extraction methods for melamine or cyanuric acid was developed and written in SOP form. A novel liquid chromatographic system was developed that can analyze for both cyanuric acid and melamine in the same run. The cyanuric acid method was subjected to a second analyst check. Both methods were applied to the testing of animal feeds already in use at OR for presence of melamine and cyanuric acid. The methods were also tested against a range of finished feeds for a variety of species. CONTACT: David N. Heller, 301-210-4579, david.heller@fda.hhs.gov Leveraging, in simplest terms, is working with others outside FDA in ways that will help the Agency meet its public health responsibilities. FDA has been quite successful with its past collaborations and the Agency intends to expand and build upon this solid foundation in developing new partnerships. INTRODUCTION and IMPACT. Leveraging initiatives allow us to devote our scarce resources to those activities that we are uniquely qualified to perform. Such leveraging or cooperative ventures are not a means to shirk our responsibilities but a means to expand our capabilities by allowing us to use our intellect, time, money, and resources in a manner that maximizes their value. We should think of leveraging and other collaborative opportunities, not as last resorts, but as primary strategies for achieving our mission. We also have a long history of collaborating with the external scientific community on a more formal basis, through cooperative agreements, interagency agreements, memoranda of understanding, cooperative research and development agreements, and contracts. But we are now making this kind of leveraging central to our operations. By pooling our financial and intellectual assets we are able to achieve results greater than either organization could have achieved alone. In order for this to be successful, we must have a core of expertise within the Agency that is knowledgeable in the particular area in which we would like to collaborate, and internal activity in the area to serve as a springboard for getting more work done. Formal Activities • Interagency Agreement—CVM established an agreement with USDA/ARS for the purpose of monitoring animal origin Salmonella, E. coli, Campylobacter, and Enterococcus isolates to determine the frequency, characteristics and changes in susceptibility profiles present in these bacterial populations. • Interagency Agreement—CVM established an agreement with CDC to monitor human Salmonella, E. coli, Campylobacter and other bacterial isolates to determine the frequency, characteristics and trends of resistance determinants present in these bacterial populations. • Interagency Agreement—Funds were provided to CVM/OR by USDA’s Agricultural Marketing Service to characterize pathogenic microorganisms isolated in USDA’s Microbiological Data Program. • University of Maryland Contract—The purpose of this project was to examine the genetic relatedness of Enterococcus faecium in retail meats, and health and ill humans to help determine the potential role of foods as a source for human colonization and infections. Informal Activities • AOAC International—This collaborative effort involved the codevelopment and use of standardized test kit validation protocols for the evaluation of screening test systems for the detection of drug residues in fresh bulk tank milk samples. • University of Maryland—This informal collaboration involved the study of genetic mechanisms involved in antimicrobial resistance in salmonellae. • PulseNet—This collaborative effort was initiated by CDC and involves State Departments of Public Health and FDA. It is an epidemiological database focused on the acquisition and storage of DNA fingerprints generated by the procedure known as pulsed-field gel electrophoresis. This database represents a powerful epidemiological tool to conduct trace-back studies during outbreaks of food-borne illness. • USDA and CDC—Informal collaborative effort to characterize Salmonella Typhimurium isolated from the National Antimicrobial Resistance Monitoring System (NARMS). • USDA – Informal collaboration to compare antimicrobial resistance in E. coli isolated from chickens and chicken meat. • Summer Student Intern Program—This is a special program for minority college students provides research experience in the biological and chemical sciences. • The Institute for Genomics Research (TIGR), CFSAN and USDA – This collaboration involves a cooperative effort to establish wholegenome DNA sequence data for 12 salmonella serovars. • FDACS — Personnel of the Division of Residue Chemistry audited the validation data of a method for the analysis of fluoroquinolones in honey developed by the Chemical Residue Laboratories of the Florida Department of Agriculture and Consumer Services (FDACS). Recommendations were made to improve the method SOP. Data of the analysis of regulatory samples found positive by FDACS were reviewed by DRC personnel to corroborate the findings before regulatory actions were taken • ARS/USDA — The Division of Residue Chemistry collaborated with the Bee Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture in studies in developing analytical methodology to monitor for drug residues in support of the Minor Use Minor Species Health Act. The Bee Research Laboratory provided DRC with incurred honey samples required for the development of multiclass/multiresidue methods in honey. CONTACT FOR ALL ABOVE: Mr. Michael H. Thomas, 301-210-4650, michael.thomas@fda.hhs.gov Publications Aarestrup, F.M., McDermott, P.F., Wegener, H.C.. 2008. Transmission of antibiotic resistance from food animals to humans. In: Campylobacter. Nachamkin, I., Blaser, M. (eds.) American Society for Microbiology (ASM Press), Washington, DC. Boerlin, P. and White, D.G. 2007. Antimicrobial drug resistance and its epidemiology. In: Antimicrobial Therapy in Veterinary Medicine, 4th edition. S. Giguere, J.F. Prescott, J.D. Baggot, R.D. Walker, and P.M. Dowling (Eds.). Blackwell Publishing, Professional, Ames, IA. Kaldhone, P., Nayak, R., Lynne, A.M., David, D.E., McDermott, P.F., Logue, C.M., Foley, S.L. Characterization of Salmonella enterica serovar Heidelberg from turkey-associated sources. Applied and Environmental Microbiology. 2008;74 5038-5046. Hong, Y., Liu, T., Lee, M.D., Hofacre, C.L., Maier, M., White, D.G., Ayers, S., Wang, L., Berghaus, R. and Maurer, J.J., Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiology. 2008 9;8:178. Lynne, A. M., Rhodes-Clark, B. S., Bliven, K., Zhao, S., and Foley, S. L. 2008. Antimicrobial resistance genes associated with Salmonella enterica serovar Newport isolates from food animals. Antimicrobial Agents and Chemotherapy. 52:353-356. McDermott, P.F., McMurry, L.M., Podglajen, I., Dzink-Fox, J.L., Schneiders, T., Draper, M.P., and Levy, S.B. 2008. The marC gene of Escherichia coli is not involved in multiple antibiotic resistance. Antimicrobial Agents and Chemotherapy 52(1): 382-383 Parveen, S., M. Taabodi, T. Mohamed, J.P. Schwarz, T.P. Oscar, J. Harter-Dennis, and D.G. White. 2007. Prevalence and antimicrobial resistance of Salmonella spp. recovered from processed poultry. Journal of Food Protection. 70:2466-2472. Rubin, J., Walker, R. D., Blickenstaff, K., Bodeis-Jones, S., and Zhao, S. 2008. Antimicrobial resistance and genetic characterization of fluoroquinolone resistance of Pseudomonas aeruginosa isolated from canine infections. Veterinary Microbiology. 131:164-172. Vila, J., White, D.G., McDermott, P.F., and Levy, S.B. 2008. Bacterial resistance to antimicrobials. In Travelers’ Diarrhea, 2nd Edition. C.D. Ericsson, H.L. Dupont, and R. Steffen (Eds). BC Decker, Hamilton, Ontario, Canada. Whichard, J.M., Gay, K., White, D.G. and Chiller T.M. 2007. Surveillance for antimicrobial resistance among foodborne bacteria: the US approach. In Infectious Disease Surveillance. N. M'ikanatha, R. Lynfield, C. Van Beneden, H. DeValk (Eds.). Blackwell Publishing Professional, Ames, IA. White, D.G. 2008. Laboratory methodologies for bacterial antimicrobial susceptibility testing. Chapter 1.1.10. OIE Manual of Standards for Diagnostic Tests and Vaccines. 6th Edition. Office International des Epizooties, Paris, France. Xi, M., Zheng, J., Zhao, S., Brown, E.W. and Meng, J. 2008. An enhanced discriminatory PFGE scheme for subtyping Salmonella serotypes Heidelberg, Kentucky, Saintpaul, and Hadar. Journal of Food Protection 71:2067-2072. Yang , B., Zheng, J., Brown, E.W. Zhao, S., and Meng, J. 2008. Characterization of antimicrobial resistance associated integrons and mismatch-repair mutation in Salmonella serovars. International Journal of Antimicrobial Agents. 2008 Nov 12. [Epub ahead of print]. Zaidi, M. B., Leon, V., Canche, C., Perez, C., Zhao, S., Hubert, S. K., Abbott, J., Blickenstaff, K., and McDermott, P. F. 2008. Rapid and widespread dissemination of multidrug-resistant blaCMY-2 Salmonella Typhimurium in Mexico. Journal of Antimicrobial Chemotherapy. 60(2):398-401. Zhao, S. 2008. Antimicrobial-Resistant Foodborne Pathogens in Imported Food. In: Emerging issues in Food Safety: Imported Foods Microbiological Issues and Challenges. (Edited by M.P. Doyle and M.C. Erickson). American Society for Microbiology, Washington, DC. Zhao, S., White, D.G., Friedman, S.L., Glenn, A., Blickenstaff, K., Ayers, S.L., Abbott, J.W., Hall-Robinson, E., and McDermott, P.F. 2008. Antimicrobial resistance in Salmonella enterica serovar Heidelberg from retail meat, including poultry, from 2002-2006. Applied and Environmental Microbiology. 74:6656-6662. Zheng, J., Meng, J., Zhao, S., Singh, R,. Ge, A., Fox, J.G. and Song, W. 2008. Campylobacter-induced interleukin-8 secretion in polarized human intestinal epithelial cells requires Campylobacter-secreted CDT and TLR-mediated activation of NF-kB. Infection and Immunity 76:4498-4508. Zheng, J., Cui, S., Teel, L., Zhao, S., Singh, R., O’Brien, A. and Meng, J. 2008. Identification and characterization of shiga toxin type 2 variants in Escherichia coli isolated from animals, food, and humans. Applied and Environmental Microbiology. 74:5645-5652.. Boehmer, J.L., D.D. Bannerman, K. Shefcheck, and J.L.Ward. 2008. Proteomic analysis of differentially expressed proteins in bovine milk during experimentally induced Escherichia coli mastitis. Journal of Dairy Science. 91: 1-13. Shaikh, B., N. Rummel, C. Gieseker, and R. Reimschuessel. 2007. Residue depletion of tritium-labeled ivermectin in reainbow trout following oral administration. Aquaculture. 272: 192-198. Andersen, W.C., S.B. Turnipseed, C.M. Karbiwnyk, S.B. Clark, M.R. Madson, C.M. Gieseker, R.A. Miller, N.G. Rummel, and R. Reimschuessel. 2008. Determination and confirmation of melamine residues in catfish, trout, tilapia, salmon, and shrimp by LC-MS-MS. Journal of Agricultural and Food Chemistry. 56: 4340-4347. Reimschuessel, R., C. Gieseker, R.S. Miller, N. Rummel, J. Ward, J. Boehmenr, D. Heller, C. Nochetto, H. De Alwis, N. Bataller, W. Andersen, S.B. Turnipseed, C.M. Karbinwnyk, R.D. Satzger, J. Crowe, M.K. Reinhard, J.F. Roberts, and M. Witkowski. 2008. Evaluation of the renal effects of experimental feeding of melamine and cyanuric acid to fish and pigs. American Journal of Veterinary Research. 69: 1217- 1228 Reimschuessel, R. 2008. Assessing the human health implications of new drugs used in fish farming. In: Řyvind Lie (ed.), Improving farmed fish for the consumer. pp. 128-156. Yancy, H.F., T.S. Zemlak, J.A. Mason, J.D. Washington, B.J. Tenge, N.T. Nguyen, J.D. Barnett, W.E. Savary, W.E. Hill, M.M. Moore, F.S. Fry, S.C. Randolph, P.L. Rogers, and P.N. Herbert. 2008. The potential use of DNA barcodes in regulatory science: Applications of the regulatory fish encyclopedia. Journal of Food Protection. 71: 210- 217. Shaikh, B., Rummel, N., Gieseker, C., Serfling, S. and Reimschuessel, R. 2006. Metabolism and depletion of albendazole in the muscle tissue of channel catfish following oral treatment. Journal of Veterinary Pharmacology and Therapeutics, 29: 525-530. Simjee, S., McDermott, P.F., White, D.G., Hofacre, C., Berghaus, R.D., Carter, P.J., Stewart, L., Liu, T., Maier, M. Maurer, J.J. 2007. Antimicrobial susceptibility and distribution of antimicrobial resistance genes among Enterococcus and coagulase-negative Staphylococcus isolates recovered from poultry litter. Avian Diseases, vol. 51, 2007. In press. Foley, S.L., Zhao, S. and Walker, R.D.. 2007. Molecular typing methods for determining the source of Salmonella foodborne pathogens. Foodborne Pathogens and Disease. 3: 253-276. Welch, T.J., Florian Fricke, W., McDermott, P.F., White, D.G., Rosso, M-L., Rasko, D.A., Mammel, M.K., Eppinger, M., Rosovitz, M.J., Wagner, D., Rahalison, L., LeClerc, J.E., Hinshaw, J.M., Lindler, L.E., Cebula, T.A., Carniel, E., Ravel, J. 2007. Multiple antimicrobial resistance in plague: An emerging public health risk. PLoS ONE 2(3): e309. Whichard, J.M., K. Gay, D.G. White, and Chiller, T.M. 2007. Surveillance for antimicrobial resistance among foodborne bacteria: the US approach. In: Infectious Disease Surveillance. N. M'ikanatha, R. Lynfield, C. Van Beneden, H. DeValk (Eds.). Blackwell Publishing Professional, Ames, IA. Yancy, H.F., Semlak, T.S., Mason, H.A., Washington, J.D., Tenge, B.J., Nguyen, N.T., Barnett, J.D., Savary, W.E., Hill, W.E., Moore, M.M., Fry, F.S., Randolph, S.C., Rogers, P.L., and Hebert, P.N. 2007. The potential use of DNA barcodes in regulatory science: Applications of the Regulatory Fish Encyclopedia. Journal of Food Protection. In press. Zaidi, M. B., Calva, J.J., Estrada-Garcia, M.T., Leon, V., Vazquez, G., Figueroa, G., Lopez, E., Contreras, J., Abbott, J., Zhao, S., McDermott, P.F., Tollefson, L. 2007. An integrated food chain surveillance system for Salmonella in Mexico: A model for developing countries. Emerging Infectious Diseases. In press. Zaidi, M.B., Leon, V., Canche, C., Perez, C., Zhao, S., Hubert, S.K., Abbott, J., Blickenstaff, K., McDermott, P.F. 2007. Rapid and widespread dissemination of multidrug-resistant blaCMY-2 `Typhimurium in Mexico. Journal of Antimicrobial Chemotherapy. Aug;60(2):398-401. Zhao, S., McDermott, P.F., White, D.G., Qaiyumi, S., Friedman, S.L., Abbott, J.W., Glenn, A., Ayers, S.L., Post, K.W., Fales, W.H., Wilson, R.B., Reggiardo, C., Walker, R.D. 2007. Characterization of multidrug resistant Salmonella recovered from diseased animals. Veterinary Microbiology 123(1-3):122-32. Reports Aarestrup, F.M., McDermott, P.F. Methods for testing Salmonella and Campylobacter. National Food Institute, Technical University of Denmark, Newsletter to the National Reference Laboratories for Antimicrobial Resistance. No. 2, November 2007. Aarestrup, F.M., McDermott, P.F., Kahlmeter, G. Antimicrobial susceptibility testing: clinical break points and epidemiological cut-off values. National Food Institute, Technical University of Denmark, Newsletter to the National Reference Laboratories for Antimicrobial Resistance. No. 2, November 2007. Presentations Harbottle, H. CVM: Challenges to future genomics regulatory and scientific activities. FDA Science Symposium on Genomics. FDA White Oak Campus, Silver Spring, MD. June 27, 2008. Harbottle, H. CVM: Molecular characterization of foodborne pathogens. Food Protection Plan Meeting, FDA Center for Veterinary Medicine, Laurel, MD. September 23, 2008. McDermott, P.F. Antimicrobial resistance in Campylobacter from retail meats in the United States, 2002-2007. Second Workshop on Campylobacter Isolation and Identification from Foods. Auburn University, Auburn AL, May 23, 2008 McDermott, P.F. Antimicrobial resistance in Campylobacter from animals, foods and humans in the U.S. American Society for Microbiology Conference on Antimicrobial Resistance in Zoonotic Bacteria and Foodborne Pathogens. Copenhagen, Denmark. June 16, 2008. McDermott, P.F. The challenge of multi-drug resistant (MDR) foodborne Gram-negative pathogens. 2008 Annual Conference on Antimicrobial Resistance, National Foundation for Infectious Diseases, Bethesda, MD. June 23rd, 2008. McDermott, P.F. Monitoring antimicrobial resistance in foodborne pathogens: Lessons from the National Antimicrobial Resistance Monitoring System. National Institutes of Health, Program Conference on Food and Waterborne Diseases, Calloway Gardens, GA. July 2008. McDermott, P.F. Research in antimicrobial resistance monitoring in foodborne pathogens. Abstracts of the 145th Annual Convention of the American Veterinary Medical Association. New Orleans, LA. July 22, 2008. McDermott, P.F. Antimicrobial resistance in foodborne pathogens. Food Safety Challenges and Detection Technologies, Northwest A&F University, Xian China, September 18, 2008. McDermott, P.F. Monitoring antimicrobial resistance in foodborne bacteria in the U.S. Food Safety Challenges and Detection Technologies, Northwest A&F University, Xian Chin, September 19, 2008. . McDermott, P.F. National surveillance of antimicrobial resistance in foodborne bacteria in the U.S. China International Food Safety and Quality Conference and Expo, Beijing China, September 22, 2008. McDermott, P.F. NARMS Program Update. AHI Regulator Day 2008, Arlington, VA. November 12, 2008. Zhao, S. “Resistance to 3rd Generation Cephalosporins in Salmonella from NARMS Retail Meats Studies”. 95th IAFP Annual Meeting. Colunbus, OH. August 3-6, 2008. Zhao, S. “Characterization of Resistance to 3rd Generation Cephalosporins in Salmonella from NARMS Retail Meats Studies” at the FDA Critical Path Initiative on the move Complexities and Challenges. Bethesda, MD. September 15-16, 2008 Zhao, S. “Characterization of Salmonella Isolated from NARMS Program” at the Symposium of Rapid Detection Technologies and Application for Food and Protection. Laurel, MD. September 23-24. 2008. English, L.L. 2007. Commercial Kits for Rapid Detection of Food Borne Pathogens - Campylobacter Kit for Laboratory Exercises. World Health Organization, Global Salmonella Surveillance, Advanced Workshop on Foodborne Disease Surveillance, St. Petersburg, Russia. English, L.L. 2007. Commercial Kits for Rapid Detection of Food Borne Pathogens - Listeria monocytogenes Kit for Laboratory Exercises. World Health Organization, Global Salmonella Surveillance, Advanced Workshop on Foodborne Disease Surveillance, St. Petersburg, Russia. Fricke, W.F., Welch, T.J., Rasko, D.R., Mammel, M., Eppinger, M., Rosovitz, M., White, D.G., McDermott, P.F., Rahalison, L., LeClerc, J.E., Hinshaw, J.M., Lindler, L.E., Cebula, T.A. Carniel, E., Ravel, J. 2007. Plasmid-Mediated Multidrug Resistance in Plague: An Emerging Risk. Abstracts of the Annual Meeting of the American Society for Microbiology, Toronto, Ontario Canada. Furuno, J.P., Johnson, J.A., McDermott, P.F., Tang, L., Warren, M.S., Strauss, S.M., Perencevich, E.N., Morris Jr., J.G., Blythe, D., Lee, D., Stine, O.C. 2007. Genetic relatedness of enterococci from humans and retail meat and poultry. Abstracts of the 47th Interscience Conference on Antimicrobial Agents and Chemotherapy, Chicago, IL. Gebreyes, W.A., Thakur, S., White, D.G., McDermott, P.F., Zhao, S. and Harbottle, H. 2007. Development of a microarray system for the rapid and simultaneous detection of bacterial and viral foodborne pathogens. Abstracts of the 7th International Symposia on the epidemiology and control of foodborne pathogens in pork (Safe Pork 2007), Verona, Italy. Harbottle, H., Ayers, S., Glenn, A., Hall-Robinson, E., Blickenstaff, K., Gaines, S. McDermott, S., McDermott, P. F. and the NARMS working group. 2007. Antimicrobial resistance among E. coli recovered from retail foods of animal origin, NARMS 2002-2005. The 2nd Symposium on Antimicrobial Resistance in Animals and the Environment. Tours, France. Harbottle, H., Kroft, B., Abbott, J., Friedman, S., Zhao, S., White, D.G. McDermott, P.F. and the NARMS Retail Meat Group. 2007. Pulsed-field gel electrophoresis and antimicrobial susceptibility profiling of Salmonella enterica serotype Kentucky isolates from retail meats and clinical animal infections. Abstracts of the 107th Annual Meeting of the American Society for Microbiology, Toronto, Canada. Harbottle, H., Thakur, S., McDermott, P.F., White, D.G., Yancy, H., Mason, J., Walker, R.D., Gebreyes, W.A., and Zhao, S. 2006. Development of a DNA microarray for detection of enteric pathogens, antimicrobial resistance genes, and virulence determinants. The 10th UJNR International Symposium on Toxic Microorganisms. College Park, MD. McCabe, J.S., White, D.G., McDermott, P.F., Johnston, B., Kuskowski, MA., and Johnson, J.R. 2007. Molecular characteristics of antimicrobial-resistant and susceptible Escherichia coli from retail foods (2002-2004) from the National Antimicrobial Resistance Monitoring System (NARMS). Abstracts of the Annual Meeting of the American Society for Microbiology, Toronto, Ontario Canada. McDermott, P.F. 2006. Development of standardized methods for testing antimicrobial resistance of Campylobacter species. The United States Japan Natural Resources Council (UJNR), College Park, MD. McDermott, P.F. 2007. Antimicrobial Resistance, Policies, & Guidelines – Update on NARMS. Federation of Animal Science Societies, Food Safety, Animal Drugs, and Animal Health Committee. Washington DC. McDermott, P.F. 2007. ESBL producing Salmonella. The 47th Interscience Conference on Antimicrobial Agents and Chemotherapy, Chicago, IL. McDermott, P.F. 2007. NARMS Retail Meat Surveillance. FDA Science Board Subcommittee on the National Antimicrobial Resistance Monitoring System. Rockville, MD. McDermott, P.F. 2007. NARMS Update. FoodNet Vision Meeting, Atlanta, GA McDermott, P.F. 2007. The role of NARMS in detecting and tracking antimicrobial resistance. 2007 Annual Conference on Antimicrobial Resistance, National Foundation for Infectious Diseases, Bethesda, MD. McDermott, P.F. 2007. Antimicrobial Resistance: Present and Future Challenges. FDA Science Symposium, White Oak, MD. McDermott, P.F., English, L.L., Hall-Robinson, E., White, D.G. and Zhao, S. 2007. Antimicrobial Resistance Among Campylobacter from Retail Meats in the United States. The 14th International Workshop on Campylobacter, Helicobacter and Related Organisms. Rotterdam, The Netherlands. Thakur, S., Kroft, B., White, D.G., McDermott, P.F., Zhao, S., Gebreyes, W., Abbott, J., Cullen, P., English, L., Carter, P. and Harbottle, H. 2007. Genotyping of Campylobacter coli isolated from humans and retail meat using multi locus sequence typing and pulsed field gel electrophoresis. Poster at the 107th General ASM Meeting in Toronto, Canada. Thakur, S., Kroft, B., White, D.G., Zhao, S., Gebreyes, W., Abbott, J., Cullen, P., English, L., Carter, P. and Harbottle, H. 2007. Characterization of Campylobacter jejuni and C. coli isolated from humans and retail meat using antimicrobial susceptibility typing, virulence gene profiling, and pulsed field gel electrophoresis. Oral Presentation at the 2nd Annual Antimicrobial Resistance in Animals and the Environment Meeting in Tours, France. Welch, T., Florian Fricke, W., Eppinger, M., Rosovitz, M.J., McDermott, P.F., White, D.G., Wiens, G. and Ravel, J. 2007. Distribution of Yersinia pestis pIP1202-like multidrug resistance plasmids among foodborne pathogens. Abstracts of the Annual Meeting of the American Society for Microbiology, Toronto, Ontario Canada. White, D.G. 2006. Antimicrobial resistance work in the Codex Committee on Residues of Veterinary Drugs in Foods (CCRVDF). 3rd International Workshop on Antimicrobial Resistance, Jeju, Republic of Korea. White, D.G. 2006. FDA/CVM Update. 110th Annual Meeting of the United States Animal Health Association, Committee on Pharmaceuticals, Minneapolis, MN. White, D.G. 2006. Surveillance strategies in the U.S., the National Antimicrobial Resistance Monitoring System (NARMS). 3rd International Workshop on Antimicrobial Resistance, Jeju, Republic of Korea. White, D.G. 2006. The National Antimicrobial Resistance Monitoring System (NARMS). 10th International Symposium on Toxic Microorganisms, United States – Japan Cooperative Program on Development and Utilization of Natural Resources, College Park, MD. White, D.G. 2007. An introduction to bacterial antimicrobial resistance. 11th Annual PulseNet Meeting, Providence, RI.. White, D.G. 2007. Foodborne pathogens, beyond the usual suspects. 2007 Inaugural FDA Science Symposium Series, Living the Future: Global Changes and Public Health, Silver Spring, MD. White, D.G. 2007. Integration of the National Antimicrobial Resistance Monitoring System and PulseNet programs. 11th Annual PulseNet Meeting, Providence, RI. White, D.G. 2007. Molecular mechanisms in the emergence of antimicrobial resistance. 2007 Annual Conference on Antimicrobial Resistance, Bethesda, MD. White, D.G. 2007. Overview of the National Antimicrobial Resistance Monitoring System (NARMS). Subcommittee to the U.S. Food and Drug Administration Science Board Meeting on the National Antimicrobial Resistance Monitoring System, Rockville, MD. White, D.G. 2007. The CCRVDF Code of Practice to Minimize and Contain Antimicrobial Resistance. 2007. The 4th International Workshop on Antimicrobial Resistance, Seoul, Korea. White, D.G. 2007. The National Antimicrobial Resistance Monitoring System. 107th General Meeting of the American Society for Microbiology, Toronto, Canada. White, D.G. 2007. The public health aspects of the National Antimicrobial Resistance Monitoring System. Antimicrobial Resistance Conference, Interface between Human and Animal Health, Columbus, OH. White, D.G. 2007. Using attribution data at retail. Attributing Illness to Food Summit, FSIS, USDA, Arlington, VA. Zaidi, M.B., Leon, V., Zamora, E., Perez, C., Zhao, S., Hubert, S.K., Abbott, J., Blickenstaff, K. and McDermott, P.F. 2007. Emergence and dissemination of Salmonella Typhimurium MDR-AmpC in Mexico. Abstracts of the Annual Meeting of the American Society for Microbiology, Toronto, Ontario Canada. Zhao, S. 2006. Characterization of Antimicrobial Resistance of Foodborne Bacterial Pathogens. Advanced Workshop on Antimicrobial Resistance, Susceptibility Testing, Detection and Surveillance. Beijing, China. Zhao, S. 2006. Mechanisms of Antimicrobial Resistance. Advanced Workshop on Antimicrobial Resistance, Susceptibility Testing, Detection and Surveillance. Beijing, China. Zhao, S. 2006. Molecular Subtyping and PulseNet. Advanced Workshop on Antimicrobial Resistance, Susceptibility Testing, Detection and Surveillance. Beijing, China. Zhao, S. 2007. Antimicrobial Resistance in Non-Typhoidal Salmonella - The US National Antimicrobial Resistance Monitoring System-NARMS. World Health Organization, Global Salmonella Surveillance, Advanced Workshop on Antimicrobial Resistance, Susceptibility Testing, Detection and Surveillance. Guilin, China. Zhao, S. and the Division of Animal and Food Microbiology. 2006. PulseNet at FDA/CVM: Molecular subtyping of antimicrobial resistance foodborne pathogens isolated from food animal and derived meats. The 10th UJNR International Symposium on Toxic Microorganisms. College Park, MD. Zhao, S., McDermott, P.F., White, D.G., Qaiyumi, S., Friedman, S.L., Abbott, J.W., Glenn, A., Ayers, S. L., Post, K.W., Fales, W.H., Wilson, R.B., Reggiardo, C., and Walker, R.D. 2007. Characterization of antimicrobial resistance of Salmonella isolates recovered from diseased animals. Abstracts of the Annual Meeting of the American Society for Microbiology, Toronto, Ontario Canada. Zhao, S., White, D.G., Hall Robinson, E., Ayers, S., Glenn, A., Friedman, S.L., Abbott, J.W., Harbottle, H., McDermott, P.F. and the NARMS retail meat group. 2007. Prevalence and antimicrobial resistance of Salmonella isolated from retail meats: NARMS: 2002-2005. Abstracts of the 94th Annual Meeting of the International Association for Food Protection, Lake Buena Vista, FL. Zheng, J., Keys, C.E., Zhao, S., Meng, J. and Brown, E.W. 2007. An enhance discriminatory scheme for PFGE-based subtyping of Salmonella Enteritidis. Emerging Infectious Diseases. The 94th Annual Meeting of International Association for Food Protection. Lake Buena Vista, FL. Poster Presentations at Scientific Conferences Harbottle, H., Thakur, S., Vaughn, B., Kroft, B., Gebreyes, W., White, D.G., McDermott, P.F., and Zhao, S. The development of a validated DNA microarray for characterization of Salmonella enterica and Campylobacter from retail meats. Abstracts of the 108th General Meeting of the American Society for Microbiology, Boston, MA. June 1-5, 2008. Jackson, S.A.,. Harbottle, H.C., Mammel, M.K., Patel, I.R., Barnaba, T.J., Ayers, S.L., Zhao, S., Cebula, T. A., LeClerc, J.E. Characterization of Salmonella enterica serotypes using a novel high density 85-genome microarray and antimicrobial susceptibility testing. Microbial Genomes Conference, Lake Arrowhead, CA. September 14, 2008. McDermott, P.F., Bodeis-Jones, S., Blickenstaff, K., Gaines, S., Hall-Robinson, E., White, D.G., and Zhao, S., Extended-Spectrum Cephalosporin-Resistant E. coli in Retail Meats: The National Antimicrobial Monitoring System (NARMS) 2002-2006. Abstracts of the 48th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) and the Infectious Diseases Society of America (IDSA) 46th Annual Meeting. Washington DC October 25-28, 2008. Mohamed, T., Parveen, S., White, D. G., Zhao, S., Freidman, S. and Blickenstaff. K. Molecular characterization of antibiotic resistant Salmonella Typhimurium and Salmonella Kentucky recovered from pre- and post-chill whole broiler carcasses. The 95th Annual Meeting of International Association for Food Protection. Columbus, OH. August 3-6, 2008. Thakur, S., White, D.G., McDermott, P.F., Zhao, S., Abbott, J., English, L., Carter, P., Gebreyes, W. and Harbottle, H. Antimicrobial resistance, virulence and genotypic profiling of Campylobacter jejuni and Campylobacter coli isolated from humans and retail meats. International Association for Food Protection in Columbus, OH, August 2008. Wagenaar, J., R. Hendriksen, M. van Bergen, M. Mikoleit, Lai-King Ng, N. Binsztein, A. Aidara-Kane, S. Zhao, S. Karlsmose, N. Maxwell. WHO Global Salm-Surv: laboratory-based surveillance, outbreak response and antimicrobial resistance testing of foodborne pathogens. ASM Conference on Antimicrobial Resistance in Zoonotic Bacteria and Foodborne Pathogens. Copenhagen, Denmark, June 15-18, 2008. Xia, X., Smith, A., Zhao, S., McEvoy, J., Meng, J., Bhagwat, A.A. Characterization of Salmonella isolates from retail foods for biofilm formation, inducible acid-tolerance and Caco-2 cell infectivity. 108th ASM Annual Meeting, Boston, MA. June 1-5, 2008. Zhao, S., Glenn, A., Friedman, S.L., Abbott, J.W., Ayers, S., Hall- Robinson, E., White, D.G., and McDermott, P.F. Prevalence and antimicrobial resistance of Salmonella isolated from retail meat: National Antimicrobial Resistance Monitoring System (NARMS): 2002–2006. The 95th Annual Meeting of International Association for Food Protection. Columbus, OH. August 3-6, 2008. Zhao, S., Glenn, A., Friedman, S.L., Abbott, J.W., Ayers, S., Hall- Robinson, E., White, D.G., and McDermott, P.F. Salmonella enterica serovar Heidelberg from retail meats: Results of the National Antimicrobial Resistance Monitoring System (NARMS): 2002-2006. The 12th Annual PulseNet Update Meeting, St. Louis, MO. April 15- 18, 2008. Zheng, J., Keys, C.E., Ramaseshan, A., Zhao, S., Meng, J., Brown, E.W. Simultaneous Analysis of Multiple Enzymes Sharply Increases the Accuracy of PFGE in Assigning Genetic Relationships among Homogeneous Salmonella Strains. 108th ASM Annual Meeting, Boston, MA. June 1-5, 2008. Zhao, S., Blickenstaff, K., Glenn, A., Ayers, S.L., Friedman, S.L., Abbott, J.W., Hall-Robinson, E., White, D.G., and McDermott, P.F. Characterization of Ampicillin Resistance of Salmonella Isolated from National Antimicrobial Resistance Monitoring System (NARMS) Retail Meats in 2002-2006. Abstracts of the 48th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) and the Infectious Diseases Society of America (IDSA) 46th Annual Meeting. Washington DC October 25-28, 2008. Outside Reports Methods for Antimicrobial Disk Susceptibility Testing of Bacteria Isolated From Aquatic Animals; Guideline (M42-A), Clinical and Laboratory Standards Institute (formerly NCCLS), Wayne, Pennsylvania, August 2006. Methods for Broth Dilution Susceptibility Testing of Bacteria Isolated From Aquatic Animals; Guideline (M49-A), Clinical and Laboratory Standards Institute (formerly NCCLS), Wayne, Pennsylvania, August 2006. Professional Service Mary Carson - Member, Official Methods Board, AOAC International; Chair, Methods Committee for Drugs and Related Topics, AOAC International; CVM Aquaculture Project Advisory Subgroup; Member, Scientific Committee for EuroResidue VI Guest Editor for the Journal of AOAC International; ad hoc reviewer for the Journal of AOAC International and the Journal of Food Protection. Pak Chu – CVM Aquaculture Project Advisory Subgroup, Office of Research Computer Committee, Institutional Animal Care and Use Committee, Committee for the Advancement of FDA Science. Ad hoc reviewer for the Journal of Chromatography B, Journal of the AOAC International, and Journal of Agriculture and Food Chemistry. Heather Harbottle – Member, Microarray Quality Control Project Committee (MAQC); Member, CVM Staff College Scientific Steering Committee; Member, Search Committee for CVM Staff College Scientific Education Specialist; Member, Genomics Committee for FDA Science Series; Reviewer for Foodborne Pathogens and Disease; Editorial Board, The Open Agriculture Journal, CVM Deputy CFC Coordinator 2007. David Heller – ad hoc reviewer for Analytical Chemistry, Journal of Chromatography B, Journal of the AOAC International, Journal of Agricultural and Food Chemistry, and Rapid Communications in Mass Spectrometry. Phil Kijak - Member FDA Milk Steering Committee; Member, U.S. Delegation Codex Committee on Residues of Veterinary Drugs in Food; Member, Interagency Residue Control Group ad hoc reviewer for the Journal of AOAC International. Patrick McDermott –Reviewer, FDA Office of Women’s Health, FY 2008 intramural research projects; Pharmaceuticals in the Environment Workgroup, National Science and Technology Council (NSTC) Committee on Environment and Natural Resources (CENR), Antimicrobial Resistance Subcommittee; Member, Science Advisory Board, National Center for Toxicological Research, Division of Microbiology; Member, Research Peer Review Committee for Research Scientists, CVM.; Member, Research Peer Review Committee for Research Scientists, NCTR; Co-convener, Microbial Resistance in Enteric Pathogens: Clinical and Therapeutical Implications, the 47th Interscience Conference on Antimicrobial Agents and Chemotherapy, Chicago IL; Member; Planning Committee for the 2008 International Conference on Emerging Infectious Diseases, CDC Atlanta, GA; CVM Delegate, Clinical and Laboratory Standards Institute subcommittee on Veterinary Antimicrobial Susceptibility Testing (CLSI/VAST); Editorial Board, Journal of Food Protection; Member, Steering Committee, World Health Organization Global Salmonella Surveillance (WHO Global Salm-Surv) program. Badar Shaikh – FDA/CFSAN Radiation Safety Committee; CVM Master Review Committee; Ad hoc reviewer for Journal of Chromatography B, Journal of the AOAC International, and Journal of Agriculture and Food Chemistry David White - Member, Antimicrobial Resistance Steering Committee, U.S. FDA; Member, U.S. Interagency Task Force on Antimicrobial Resistance; U.S. Delegate, ad hoc Intergovernmental Task Force on Antimicrobial Resistance, Codex Alimentarius; Editorial Board, Veterinary Microbiology; Editorial Board, Foodborne Pathogens and Disease; Editorial Board, Antimicrobial Agents and Chemotherapy; Panel member, NIH, Drug Discovery and Mechanisms of Antimicrobial Resistance Study Section; Panel member, CDC, Special Emphasis Panel on Antimicrobial Resistance. Atlanta, GA; Panel member, Department of Defense, Peer Reviewed Medical Research Program, Antimicrobial Resistance/Neurotoxicity of Mefloquine, Chantilly, VA; Convener, Integration of Federal Food Safety Initiatives, the Time has Come, 107th General Meeting of the American Society for Microbiology, Toronto, Canada; Reviewer, Force Health Protection Research Initiatives, ONR BAA 07-006, Office of Naval Research (ONR) Jurgen von Bredow – Member FDA Milk Steering Committee, Liaison to National Conference on Interstate Milk Shipments Appendix N Committee Shaohua Zhao – Adjunct Faculty, University of Maryland; Member, Laboratory subcommittee, World Health Organization Global Salm- Surv; Member, International Association of Food Protection; Member, Food Safety Education Professional Development Group; Member, American Society for Microbiology; Ad hoc reviewer for Journal of Antimicrobial Chemotherapy, Antimicrobial Agents and Chemotherapy, Journal of Clinical Microbiology; FEMS Microbiology Letters; Epidemiology and Infection; Veterinary Microbiology; Journal of Food Protection; Journal of Veterinary Medicine; Applied Microbiology; Journal of Animal Science; Food Additives and Contaminants Interns and Visiting Scientists College-Level Interns, Graduate Students and Postdoctoral Scientists: Grayson Wallace, Washington and Lee University, Mentor: Jurgen von Bredow Brenda Kroft, Washington State University. Mentor: Heather Harbottle Brooke Whitney, North Carolina State University. Mentor: Heather Harbottle Bethany Vaughn, University of Rochester. Mentor: Heather Harbottle Siddhartha Thakur, North Carolina State University. Mentor: Heather Harbottle Thu-Thuy Tran, University of Maryland University College, Baltimore, MD. Mentor: Karen Blickenstaff Adrienne Noble, Xavier University, New Orleans, LA. Mentor: Althea Glenn, Sharon Friedman Visiting Scientists: Xiuli Zhang. Henan Province Centers for Disease Control, Zhengzhou, China. Mentor: Sharon Friedman, Jason Abbott, Althea Glenn, Linda English. Tagelsir, Mohamed, University of Maryland Eastern Shore, Princess Anne, MD. Mentor: Karen Blickenstaff, Sharon Friedman, Jason Abbott. Reginald Blackwell, Washington DC Public Health Laboratory. Mentor: Jason Abbott, Sharon Friedman. Jonathan Johnston - Maryland Department of Health and Mental Hygiene. Mentor: Jason Abbott Insook Son - USDA Beltsville Agricultural Research Center. Mentor: Jason Abbott Chang Lui, Shanghai Institute for Food and Drug Control, China. Mentors: Pak Chu, Dave Heller, and Hui Li. Jariya Pucharoen and Thanyaporn Kongchan, Fish Inspection and Quality Control Division, Department of Fisheries of Thailand, Mentors: Pak Chu and Hui Li Workshops and Symposia Organized Carter, P. World Health Organization, Global Salmonella Surveillance, Level III Workshop on Foodborne Disease Surveillance. Port of Spain, Trinidad. English, L. World Health Organization, Global Salmonella Surveillance, Advanced Workshop on Foodborne Disease Surveillance. St. Petersburg, Russia. White, D.G.,107th General Meeting of the American Society for Microbiology, Integration of Federal Food Safety Initiatives, the Time has Come. Toronto, Canada. Zhao, S. World Health Organization, Global Salmonella Surveillance Advanced Workshop on Foodborne Disease Surveillance. Guiling, China. Zhao, S. Advanced Workshop on Antimicrobial Resistance, Susceptibility Testing, Detection and Surveillance. Beijing, China. Other Events and Activities Awards: Cullen, P, Outstanding Support Scientist Award, FDA/CVM Honor Awards. Harbottle, H. Scientific Achievement Award: Outstanding Intercenter Scientific Collaboration for the FDA MicroArray Quality Control (MAQC) Project. CVM/FDA Honor Awards. Kijak, P.J., Scientific Achievement Award: Analytical Science Excellence Award, FDA/CVM Honor Awards Heller, D.N, Lopez, M.I. Kijak, P.J. Thomas, M.H. Leveraging/Collaboration Award, Members of FDA Interagency Honey Import Alert Collaboration Group, ORA/FDA Honor Awards White, D.G. Outstanding Service Award, CVM/FDA Honor Awards. Zaidi, M.B., Estrada, M.T., McDermott, P.F., Tollefson, L., Calva, J.J. Mexican National Institutes of Health, 12th Annual Meeting of National Investigators. Third place prize, for outstanding work related to the presentation: “The epidemiology of Salmonella transmitted by food animals: Report of a monitoring system for foodborne pathogens. Group Awards Excellence in Analytical Science. Awarded to the Campylobacter Working Group (P.F. McDermott, S.M. Bodeis). "For the development and validation of a standardized broth microdilution antimicrobial susceptibility testing method for the food borne bacterial pathogen Campylobacter." Shaohua Zhao, Susannah K. Hubert, Jason Abbott, Karen Blickenstaff, Patrick F. McDermott. La Fundación Mexicana para la Salud A.C. Recognizing work with important implications for public health, commerce, and tourism in Mexico. For participation in the published research study “Nontyphoidal Salmonella from human clinical cases, asymptomatic children and raw retail meats in Yucatán, Mexico”. David White, Sherry Ayers, Althea Glenn, Elvira Hall-Robinson, Robert Walker, Patrick McDermott, and the NARMS working group. Sigma Xi Poster Awards, 2006 FDA Science Forum. Antimicrobial resistance among E. coli isolates recovered from retail foods of animal origin, NARMS 2004. Group Recognition Award, Center for Veterinary Medicine Honor Awards, NARMS Retail Meat Group. “For exemplary performance of group members in planning, organizing and successfully executing the first FDA NARMS retail meat annual report.”OR Study 326.04 Scientific Achievement Award Outstanding Inter-center Scientific Collaboration. Working Group on Accumulation of Toxins in Pufferfish from Dietary Sources. Citation: For establishing and maintaining a productive collaboration between CVM and CFSAN that has produced key information to address important issues regarding seafood safety. OR Study 275.26 Title: Florphenicol Method Development Study Director: J. C. Kawalek Abstract: The final procedure for the analysis of FFL in milk provides for a linear response of FFL in EtOAc extracts of skimmed milk in the range of 1 - 100 ppb. We essentially followed the procedure developed by Pfenning et al. (1998, 2000) for the analysis of “phenicol residues” in milk and shrimp. Dried extracts were derivatized with Sylon BFT. Derivatized extracts are analyzed on an Agilent 6890N GLC equipped with split/splitless injector (split ratio was 10:1with total flow = 27ml/min) and capillary column (HP-5, 0.25µm thick, 30m X 0.32mm id). The injector port was set at 280C and the µECD set at 320C. The column oven was programmed from 200 - 290C @ 25C/min with a 3.6min hold. Helium was used as the carrier gas in constant flow mode (2.2ml/min;44cm/s) with 5% methane/argon as the makeup gas at 60mL/min. Injection volume was set at 2µL. The retention time for FFL was 4.02 min. Initially, we had intended to use an internal standard calibration curve that was prepared in milk; however the final procedure uses an external standard curve. Our procedure is based on performing dilutions of the samples and/or standards prior to extraction using milk from untreated cows. However, one could simply extract the standards and unknowns and then remove smaller aliquots of the EtOAc extract for drying down prior to derivatization to adjust for “out of range” samples. If increased sensitivity is required, a larger sample volume could be extracted, but this will only provide an incremental increase in overall sensitivity. Other steps one could take to increase sensitivity would be to reduce the amount of toluene added to extract the TMS derivative, increase the injection volume, and reduce or eliminate the split ratio of the GLC injector. None of these alternatives were tried - primarily because we had no need to do so. The final procedure eliminates essentially all matrix interference allowing analysis of up to 23 samples, 3 controls, and 7 standards (all in triplicate) in two days by one person (extraction on day 1; derivatization and analysis on day 2). A coordinated effort with two individuals could complete the analyses in one day. The major disadvantage is the requirement to dilute the starting milk to keep standards/samples within the linear dose response range. OR Study 301.62 Title: Determination of Nitrofuran Residues in Shrimp Study Director: Pak-Sin Chu Abstract: Analytical methods have been developed to quantitate and confirm the presence of four nitrofuran residues in shrimp, channel catfish, milk, and honey. The methods involve overnight acid hydrolysis and simultaneous derivatization of the released side chains with 2-nitrobenzaldehyde to their nitrophenyl derivatives. After pH adjustment and solid-phase extraction cleanup, the extracts are analyzed on liquid chromatography-tandem mass spectrometry system in the positive ion mode. Validation of the methods is accomplished by fortifying control tissues with the side-chain analytes at levels ranged from 0.5 to 4 ng/g. If available, internal standards are added at the beginning of the procedure to compensate for matrix effects and recovery losses. Method accuracies are > 80% and CVs < 20% for all four analytes in the four matrices. Tissues from dosed animals are also assayed to demonstrate the effectiveness of the method for recovering the analytes OR Study 306.65 Title: Trial of an NADA Method Study Director: David N. Heller Abstract: A laboratory evaluation was conducted of a drug sponsor confirmatory methods for a new animal drug in various animal tissues. The tissues consisted of muscle and liver from swine, cattle, and turkeys. The Division of Residue Chemistry (DRC) was the only government laboratory participating in the evaluation under CVM's Sponsor-Monitored Method Trial program. The trial was performed according to three separate sponsor SOPs. The sample set included extracts of fortified, control and incurred tissues. The method trial was completed after modifying the instrument analysis section of the original procedures. The method should be considered acceptable provided the sponsor revises the SOP according to the nine specific findings of the method trial, including a recommendation to monitor a fourth product ion. The confirmatory method was not designed for quantitation. However, an estimate of concentration in turkey extracts was performed based on external standard calibration. OR Study 327.07 Title: Maintaining Large mouth bass infected with Acolpenteron ureteroecetes Study Director: Renate Reimschuessel Abstract: Largemouth bass (Micropterus salmoides) infected with Acolpenteron ureteroecetes were obtained to develop methods to maintain a population of infected fish in the CVMOR aquaculture facility (building H). Juvenile largemouth bass were also acquired. Different batches of juvenile and adult bass were maintained in the same test system to assess if the infection could be horizontally transferred. Methods were developed to maintain the adult and juvenile infected bass. The transmission and progression of the infection in the posterior kidney was characterized by gross necropsy examination and histopathology. The infection appeared to transfer between different batches of fish, but most of the juveniles came from the same source as the adults. The actual source of the infection was not determined. To clearly determine horizontal transfer, we obtained 1300 largemouth bass fry from a region where A. ureteroecetes infection had not been reported. No infected fish were found in a sample of 300. Largemouth bass (Micropterus salmoides) infected with Acolpenteron ureteroecetes maintained in a recirculating aquaculture system were used to infect these naďve juveniles. Kidneys were examined for parasites and eggs in 20 control and 20 experimental naďve fish monthly for seven months. One fish was infected as early as one month after co-culture. Infection prevalence steadily increased to 85% by month 4, then remained between 75 to 85 % for the remainder of the study. Parasite eggs were not observed until month 3. Between months 4 and 5, egg presence increased substantially and a peak in parasite eggs/fish occurred by month 7. Three gravid parasites were observed during month 4. Histopathology revealed that the collecting ducts of infected fish were moderately dilated during month 5. This dilation was more pronounced in fish sampled during months 6 and 7. Marked chronic inflammation around the collecting ducts and moderate hyperplasia of the collecting duct epithelium began during month 5 and was consistently present during the remaining months. By month 7 the collecting ducts were severely dilated and surrounded by a chronic inflammatory infiltrate (including eosinophilic granulocytes) and extensive fibrosis. OR Study 401.06 Title: Optimizing Dorsal Aortic Catheterization in Fish at CVM-OR Study Director: Renate Reimschuessel Abstract: The purpose of this study was to develop methods for catheterizing fish at CVM’s Office of Research. Prior to doing any surgery, a surgery cart/anesthesia machine was designed and built. Then we examined several published catheterization techniques, observed the surgery in a trout (at Upper Mid West USGS center) and tried several different brands of catheters. BD catheters and Cook catheters (FR3-5) were successfully used in trout and salmon. Catfish were initially too small for those catheters. We attempted the Steidinger technique with no success. Pediatric catheters can be placed in the smaller catfish, but they can migrate into other blood vessels from the aorta. Larger catfish posed other challenges. In these fish the introducers were too short to reach back to the optimal point for placing the catheters. A training video was made to demonstrate the technique and the use of the surgery cart. A follow up study will be conducted to try alternatives to these commercial catheters and to train others how to catheterize fish. Center for Veterinary Medicine 2008 RESEARCH REPORT Center for Veterinary Medicine OFFICE OF RESEARCH FY08 ANNUAL REPORT TABLE OF CONTENTS Table of Contents ............................................................................................................................ 1 About the Office of Research.......................................................................................................... 3 Mission..................................................................................................................................... 3 Research Capabilities................................................................................................................ 3 Facilities ................................................................................................................................... 3 Staff.......................................................................................................................................... 4 Office of Research Highlights....................................................................................................... 10 Division of Animal and Food Microbiology (DAFM) ........................................................... 10 Division of Residue Chemistry (DRC) ................................................................................... 13 Division of Animal Research (DAR)...................................................................................... 15 Premarket/Drug Review................................................................................................................ 19 Animal Drug Safety and Efficacy ........................................................................................... 19 Antimicrobial Resistance Mechanisms ................................................................................... 20 Immunopharmacology ............................................................................................................ 24 Antimicrobial Peptides............................................................................................................ 28 Metabolism and Residue Depletion ........................................................................................ 29 Method Trials: Chemical......................................................................................................... 31 Method Development to Replace Obsolete Procedures.......................................................... 32 Microbiological Methods........................................................................................................ 34 Pharmacokinetics/Pharmacodynamics....................................................................................35 Method Development in Support of Minor Use/Minor Species ............................................. 37 Compliance .................................................................................................................................. 39 Drug Residue Methods............................................................................................................ 39 Pharmacokinetics and Residue Depletion .............................................................................. 41 Method Trials and Validation ................................................................................................. 43 Incursion Services ................................................................................................................... 44 Post-Approval Monitoring ............................................................................................................ 45 PulseNet ................................................................................................................................ 45 Retail Meat Surveillance......................................................................................................... 47 ResistVet ................................................................................................................................ 50 Animal Feed Safety .......................................................................................................................51 BSE—Detecting Prohibited Substances ..................................................................................51 Chemical Method Development ..............................................................................................52 Leveraging FDA Resources...........................................................................................................55 Formal Activities .....................................................................................................................55 Informal Activities...................................................................................................................56 Accomplishments ..........................................................................................................................58 Publications...................................................................................................................................58 Outside Reports .............................................................................................................................62 Presentations .................................................................................................................................63 Professional Service.......................................................................................................................68 Audio Visual Productions..............................................................................................................71 Interns and Visiting Scientists .......................................................................................................71 Other Events and Activities ...........................................................................................................72 OR Final Report Summaries..........................................................................................................74 Mission The Office of Research (OR) conducts applied and basic research in support of current and evolving FDA regulatory issues. We in partnership with federal and state agencies and other center customers provide research solutions that ensure the safety of animal-derived food and animal health products. Within OR, research is conducted by three Divisions: The Division of Residue Chemistry (DRC) conducts analytical research for compounds which pose a potential health risk if found in animal tissue or feed. The Division develops and validates methods for official and research uses. They determine the fate of xenobiotics in animals to answer questions about their safety or efficacy. The Division of Animal Research (DAR) conducts applied and basic research using animals and animal systems in support of current and evolving regulatory issues. They provide research solutions to issues of animal health, food safety of animal-derived products, and other animal industry associated technologies. The Division of Animal and Food Microbiology (DAFM) conducts basic and applied research involving the isolation, identification, and phenotypic and genotypic characterization of microorganisms potentially harmful to animals and humans. In particular, they explore the effects of antimicrobial use in animals on 1) efficacy against pathogens, 2) changes in the environmental microbial ecology, and 3) the basis of antimicrobial resistance in pathogenic and commensal microorganisms. Research Capabilities The Office of Research is a multidisciplinary organization with scientists trained to conduct research in the broad areas of analytical chemistry, biochemistry, pharmacology, toxicology, immunology, microbiology, microbial genetics, animal nutrition, animal science, residue chemistry, and veterinary medicine. Facilities The Office of Research is housed in a state-of-the-art research complex located on 166.5 acres, including approximately 38 acres of pasture in Laurel, MD. The complex consists of offices, laboratories, animal research buildings and support facilities. The laboratories included in the complex are designed and equipped to conduct studies in biochemistry, microbiology, pharmacology, immunology, nutrition, toxicology and various aspects of aquaculture. Specific laboratory capabilities include a radioactive materials lab, mass spectrometry lab, genetic sequencing lab and analytical instrument rooms. The animal research buildings can accommodate a variety of animals such as cattle, both beef and dairy, calves, swine, sheep, poultry, and various fresh and salt water species of fish. The facilities also include surgical suites and recovery rooms for large animals. STAFF DIRECTORY, SEPTEMBER 30, 2008 OFFICE OF THE DIRECTOR (HFV-500) Dr. David G. White, Acting Director 301-210-4187, david.white@fda.hhs.gov Mr. Michael H. Thomas, Acting Deputy Director 301-210-4650, michael.thomas@fda.hhs.gov Dr. Patrick McDermott, Research Microbiologist, Acting Director of National Antimicrobial Resistance Monitoring System (NARMS) 301-210-4213, patrick.mcdermott@fda.hhs.gov Mr. O.J. Cartwright, Quality Assurance Officer 301-210-4219, orton.cartwright@fda.hhs.gov Ms. Carol Cope, Quality Assurance Officer 301-210-4243, carol.cope@fda.hhs.gov Mr. Bruce Bradley, Safety and Occupational Health Manager 301-210-4687, bruce.bradley@fda.hhs.gov Ms. Vivian Vontress, Management Officer 301-210-4153, vivian.vontress@fda.hhs.gov Administrative Staff (HFV-506) Mrs. Denise Durham, Program Support Specialist 301-210-4186, denise.durham@fda.hhs.gov Mr. Neil Schibblehut, Model Maker (retired) Mr. John Schrider, Maintenance Mechanic 301-210-7853, john.schrider@fda.hhs.gov Ms. Karen Taylor, Program Support Assistant 301-210-4760, karen.taylor@fda.hhs.gov Mrs. Gina Weems, Program Support Assistant 301-210-4138, gina.weems@fda.hhs.gov DIVISION OF RESIDUE CHEMISTRY (HFV-510) Dr. Philip J. Kijak, Acting Director 301-210-4589, philip.kijak@fda.hhs.gov Analytical Methods Team (HFV-511) Mr. David N. Heller, Acting Team Leader 301-210-4579, david.heller@fda.hhs.gov Dr. Mary Carson, Chemist 301-210-4651, mary.carson@fda.hhs.gov Dr. Hui Li, Staff Fellow 301-210-4271. hui.li@fda.hhs.gov Ms. Cristina Nochetto, Chemist 301-210-4184, cristina.nochetto@fda.hhs.gov Ms. Shani Smith, Chemist 301-210-4242, shani.smith@fda.hhs.gov Dr. Hemakanthi De Alwis, Chemist 301-210-4263, hemakanthi.dealwis@fda.hhs.gov Metabolism and Diagnostic Team (HFV-512) Dr. Pak-Sin Chu, Research Chemist 301-210-4583, pak.chu@fda.hhs.gov Ms. Tricia Johnson, ORAU Fellow 301-210-4651, tricia.johnson@fda.hhs.gov Dr. Mayda López, Chemist 301-210-4587, mayda.lopez@fda.hhs.gov Mr. Nathan Rummel, Chemist 301-210-4289, nathan.rummel@fda.hhs.gov Dr. Badaruddin Shaikh, Research Chemist 301-210-4653, badaruddin.shaikh@fda.hhs.gov DIVISION OF ANIMAL RESEARCH (HFV-520) Dr. Russell A. Frobish, Director (retired) Mrs. Jamie Boehmer, Biologist 301-210-4281, jamie.boehmer@fda.hhs.gov Mr. Eric R. Evans, Biologist 301-210-4181, eric.evans@fda.hhs.gov Mrs. Dorothy Farrell, Microbiologist 301-210-4470, dorothy.farrell@fda.hhs.gov Mr. Charles Gieseker, Biologist 301-210-4217, charles.gieseker@fda.hhs.gov Ms. Karyn Howard, Biologist 301-210-4244, karyn.howard@fda.hhs.gov Ms. Yolanda Jones, Biologist 301-210-4135, yolanda.jones@fda.hhs.gov Dr. Joseph C. Kawalek, Research Chemist 301-210-4296, joseph.kawalek@fda.hhs.gov Dr. Michael J. Myers, Research Pharmacologist 301-210-4355, michael.myers@fda.hhs.gov Dr. Renate Reimschuessel, Research Biologist 301-210-4024, renate.reimschuessel@fda.hhs.gov Dr. Jeffrey L. Ward, Veterinary Medical Officer 301-210-4216, jeffrey.ward@fda.hhs.gov Dr. Haile Yancy, Research Biologist 301-210-4096, haile.yancy@fda.hhs.gov Animal Care and Use Staff (HFV-521) Mr. Mark McDonald, Animal Scientist 301-210-4658, mark.mcdonald@fda.hhs.gov Mr. Steven Matthews, Animal Caretaker 301-210-7830, steven.matthews@fda.hhs.gov Ms. Virginia Mills, Animal Caretaker 301-210-7830, virginia.mills@fda.hhs.gov Mr. Steven Rill, Animal Caretaker 301-210-7830, steven.rill@fda.hhs.gov DIVISION OF ANIMAL AND FOOD MICROBIOLOGY (HFV-530) Dr. Patrick McDermott, Acting Director 301-210-4246, patrick.mcdermott@fda.hhs.gov Dr. Beth Karp, NARMS Coordinator 301-210-4090, beth.karp@fda.hhs.gov Microbiology and Molecular Biology Team (HFV-531) Dr. Shaohua Zhao, Team Leader 301-210-4472, shaohua.zhao@fda.hhs.gov Mr. Jason Abbott, Microbiologist 301-210-4185, jason.abbott@fda.hhs.gov Mrs. Karen Blickenstaff, Microbiologist, 301-210-4761, karen.blickenstaff@fda.hhs.gov Mrs. Sonya Bodeis-Jones, Microbiologist 301-210-4251, sonya.bodeis@fda.hhs.gov Mrs. Peggy Carter, Microbiologist Mrs. Sharon Friedman, Microbiologist 301-210-4249, sharon.friedman@fda.hhs.gov Mrs. Althea Glenn, Staff Fellow 301-210-4214, althea.glenn@fda.hhs.gov Ms. Sampa Mukherjee, Microbiologist 301-210-4132, sampa.mukherjee@fda.hhs.gov Mr. Jonathan Sabo, Microbiologist 301-210-4133, jonathan.sabo@fda.hhs.gov Ms. Thu-Thuy Tran, ORAU Fellow 301-210-4264, thu-thuy.tran@fda.hhs.gov National Antimicrobial Resistance Monitoring System (NARMS) Team (HFV-532) Dr. Patrick McDermott, Team Leader 301-210-4213, patrick.mcdermott@fda.hhs.gov Mrs. Sherry Ayers, Microbiologist 301-210-4268, sherry.ayers@fda.hhs.gov Ms. Kristin Cameron, Microbiologist 301-210-4350, kristin.cameron@fda.hhs.gov Mrs. Linda English, Microbiologist (retired) Mr. Stuart Gaines, Microbiologist 301-210-4294, stuart.gaines@fda.hhs.gov Dr. Elvira Hall-Robinson, Epidemiologist Dr. Heather Harbottle, Microbiologist 301-210-4246, heather.harbottle@fda.hhs.gov Mr. Shawn McDermott, Microbiologist 301-210-4267, shawn.mcdermott@fda.hhs.gov Mrs. Sadaf Qaiyumi, Visiting Scientist 301-210-4350, sadaf.qaiyumi@fda.hhs.gov Ms. Emily Tong, Epidemiologist 301-210-4762, emily.tong@fda.hhs.gov Contact Information For more information about the Office of Research and its programs contact: Dr. David G. White, Director, Office of Research 301-210-4187, david.white@fda.hhs.gov Mr. Michael H. Thomas, Acting Deputy Director, Office of Research 301-210-4650, michael.thomas@fda.hhs.gov Dr. Philip J. Kijak, Acting Director, Division of Residue Chemistry 301-210-4589, philip.kijak@fda.hhs.gov Dr. Renate Reimschuessel, Acting Director, Division of Animal Research and Research Biologist 301-210-4024, renate.reimschuessel@fda.hhs.gov Dr. Patrick McDermott, Director, Division of Food and Animal Microbiology and Director of National Antimicrobial Resistance Monitoring System (NARMS) 301-210-4213, patrick.mcdermott@fda.hhs.gov Dr. Beth Karp, Coordinator, National Antimicrobial Resistance Monitoring System (NARMS) 301-210-4090, beth.karp@fda.hhs.gov Introduction Division of Animal and Food Microbiology (DAFM) The Office of Research (OR) is the laboratory-based research arm of the Center for Veterinary Medicine (CVM), Food and Drug Administration (FDA). OR’s research priorities are ever changing, being driven by the needs of other CVM offices – i.e., the Office of New Animal Drug Evaluation (ONADE), the Office of Minor Use Minor Species (MUMS) and the Office of Surveillance and Compliance (OSC) and by FDA-wide requirements to thoroughly address the latest food and drug safety concerns. To meet these needs, OR is staffed by researchers with diverse scientific backgrounds – microbiology, biochemistry, toxicology, analytical chemistry, pharmacology, veterinary science, etc. – as well as scientists with specialized training e.g., aquatic science specialists and antimicrobial resistance geneticists. In this section the recent OR studies included are organized by the three OR Divisions in which they were conducted – Division of Animal and Food Microbiology (DAFM), Division of Residue Chemistry (DRC), and Division of Animal Research (DAR). The Division of Animal and Food Microbiology conducts basic and applied microbiological research in support of the Center’s pre-marketing and post-marketing regulatory responsibilities. This research includes: developing standards for measuring the efficacy of antimicrobial agents; surveillance of retail meat commodities for antimicrobial-resistant foodborne bacteria; monitoring of animal feeds and animal production environments for the prevalence and dissemination of select enteric bacteria, including the emergence and spread of antimicrobial-resistant strains; and using DNA fingerprinting and other phenotypic and genetic markers to determine the source and relatedness of enteric pathogens isolated from food animals and humans. DAFM has initiated, and collaborates on, a number of research studies, both internally- and externally-funded, that are aimed at developing approaches to support the safe use of antimicrobial agents in food animals. This research has multiple facets. These include: the development of standardized testing methods to ensure the intra- and inter-laboratory reproducibility of data generated from antimicrobial susceptibility testing; surveillance of foodborne pathogens in retail meats for trends in antibiotic resistance; studies to discover and catalog the genetic traits conferring resistance; assessing the genetic relatedness of strains to support epidemiological investigations. Our goal is to prolong the use of antimicrobial drugs as therapeutic agents and reduce the prevalence of antimicrobial resistant bacteria throughout the food production continuum. Some major areas of work in 2008 are outlined below. Comprehensive Genome Sequencing of Nontyphoidal- Salmonellae CVM scientists continued to collaborate with CFSAN researchers and investigators from the J. Craig Venter Institute and the University of Maryland on a research project sequencing the genomes of 17 strains representing 12 Salmonella serovars of public health importance. The strains chosen for genomic analysis were selected based on their potential to provide information needed for examining pathogenicity, transmission, origin, ecology, evolution, and dissemination of antimicrobial resistance. The majority of the strains chosen for sequencing originated from the NARMS program, which included susceptible and multidrug resistant (MDR) variants. This initial partnership led to the development of several studies with numerous collaborators at CVM, CFSAN, The University of Maryland, and the USDA (Dr. T. Welch, Dr. P. Cray, and Dr. John Maurer) among others, where the DNA sequences of drug resistance plasmids from different sources were compared. In 2008, this work led to the first description of plasmid-borne pathogenic factors from avian E. coli present in chicken isolates of Salmonella enterica serovar Kentucky. In addition, comparison to related plasmids from historical bacteria showed the evolutionary development of resistance in modern variants. This work forms the basis of the microarray platform development, which will allow rapid screening of isolates for genes of biomedical importance, including virulence determinants. Kentucky. In addition, comparison related plasmids from historical bacteria showed the evolutionary development of resistance in modern variants. In addition, this work will form the basis of rapid detection methods for genes of biomedical importance, including virulence determinants, as well as provide a means to rapidly characterize field strains to support animal and public health epidemiology and guide antiinfective therapy. Genetic Analysis of Foodborne Pathogens by DNA Microarray CVM scientists collaborated with investigators from North Carolina State University (Dr. S. Thakur) and Ohio State University (Dr. W. Gebreyes) to develop and validate a DNA microarray capable of detecting foodborne pathogens of concern for human health from samples potentially contaminated with multiple pathogens. Specifically, this microarray was developed to detect Salmonella enterica serotypes, Campylobacter species, Escherichia coli, and Norwalk virus. In addition to pathogen detection, the DNA microarray was developed to concurrently identify all classes of antimicrobial resistance genes and common virulence genes associated with these foodborne pathogens. This tool was developed for rapidly screening isolates from the NARMS program, from feed isolates, and other sources for these genetic determinants. Triplicate 70mer oligonucleotide probes were designed for 272 genes and validated using microarray positive/negative calls for two control strains and using polymerase chain reaction amplification of the 272 genes. Preliminary studies screening multi-drug resistant strains from the NARMS program were begun. The results of this work will lead to rapid molecular diagnostic assays for detecting genes of biomedical importance, including potential virulence determinants. It also will provide a means to rapidly characterize field strains to support animal and public health epidemiology. Introduction Division of Residue Chemistry OR’s Division of Residue Chemistry (DRC) has been responsible for developing and validating monitoring methods used in FDA’s highly effective milk safety program. More recently, DRC has focused on developing methods to measure drug residues in animal feeds, aquacultured species and honey. DRC scientists are developing data to correlate the concentration of drug in fluids such as plasma and urine to the drug concentration in tissue. The information can be used to develop more efficient monitoring programs for drug residues in animals at or prior to slaughter. Method for Antiviral Drugs in Poultry One of the major projects in the division in recent years has been the development of methods to detect antiviral compounds in poultry tissue. The effort involved the studying the metabolism of the antiviral compounds to determine appropriate marker compounds for use of the antiviral drugs and developing sensitive methods for these compounds. The research has been undertaken in support the FDA pandemic flu preparedness initiative. Several years ago, a highly pathogenic strain of flu emerged in birds. Mortality of humans infected with the H5N1 strain of virus responsible is high. However, there is no evidence of human-to-human transmission, and the only cases of the flu seen in humans were associated with prolonged close contact with infected birds. Because of concerns about viral mutations enabling transmission between people, which could lead to a pandemic, efforts were undertaken within the Department of Health and Human Services to prepare for a flu pandemic. Due to concern about the development of viruses with resistance to antiviral compounds, CVM has prohibited the use of antiviral drugs in poultry. Four drugs are approved for use to treat viral viral influenza. As no methods were available that could detect the antiviral compounds in poultry, the Division of Residue Chemistry was tasked with method development and metabolism studies. The method development included the four compounds and one known metabolite, oseltamivir carboxylate. The chemistry of the compounds presented several challenges to the development of a method. The compounds had diverse chemistries; the adamantanes are lipophilic, whereas the neuraminidase inhibitors are very hydrophilic. None of the compounds have strong chromophores. In order to detect misuse of the compounds, low detection limits (<10 µg kg-1) were desired. In order to achieve all of these attributes in a single method, liquid chromatography tandem mass spectrometry was quickly identified as the preferred method of detection. As traditional reverse phase chromatography did not provide the needed separation of the compounds, chromatography based on a ZIC-HILIC (Zwitterionic Hydrophilic Interaction Liquid Chromatography) column was used. Antiviral Drugs Approved for Treatment of Flu Adamantanes Amantadine HCl (Symmetrel, etc.) • Oral drug • Rimantadine HCl (Flumadine) • Oral drug Zanamivir (Relenza) • Inhaled product Neuraminidase Inhibitors Oseltamivir (Tamiflu) H5 • Oral drug XIC of +MRM (12 pairs): 152.2/93. XIC of +MRM (12 pairs): 152.2/93. 1a m u from Sample 1 (Std A) of standar d- s20mM ACNgrad#14.wiff (Turbo Spray) Max. 1.1e5 cps. 1 2 3 4 5 6 7 8 9 10 11 92 183 274 365 455 546 637 728 819 910 1001 Time, min 0.0 5.0e4 1.0e5 1.5e5 2.0e5 2.5e5 3.0e5 3.5e5 4.0e5 4.5e5 5.0e5 5.5e5 6.0e5 6.5e5 7.0e5 7.5e5 7.7e5 Int en sit y, cp Int en sit y, cp 5.22 1.23 ZIC - HILIC -- Gradient: ACN / 20 mM NH4OAc pH 5.5 % ACN 30 ng/mL Standard oseltamivir rimantadine amantadine oseltamivir carboxylate zanamivir 50% 80% 100% • Evaporate (NOT to dryness) • Add ACN so water content 20-40% (oselt. carb., zan.) (oselt., riman., aman.) • Dilute with water • Oasis WCX SPE • Elute with 0.1 M HCl in MeOH • Evaporate to dryness • Reconstitute 80:20 ACN:water “QuEChRS” model: 1 g tissue, preground + 1 mL 1% HOAc in water + 2.5 mL ACN Homogenize, centrifuge Tissue samples are prepared using a simple extraction scheme Using these conditions, all four drugs could be detected in liver, kidney, muscle tissue and eggs. The method is currently being evaluated using incurred tissues from chicken. The method is also being used to support metabolism studies of the antiviral compounds in chicken. Working collaboratively with the Central Sciences Laboratory, part of the United Kingdom Food and Environment Research Agency, the method will be evaluated for use in other species including turkeys. Division of Animal Research (DAR) During the past year, the Division of Animal Research has conducted research in support of the pre-market and post-market programs of the Center. The research efforts are designed to provide information for assessing the safety and efficacy of drugs, supporting the Minor Use/Minor Species program, supporting the preparation of guidance documents, developing analytical methodology necessary to support the Agency’s Feed Ban, and supporting the Agency’s efforts to protect the nation’s food supply from harmful chemicals. Catfish 24oC Trout 12oC Single dose 20 mg/kg BW oral Depletion Melamine CVM’s Office of Research scientists had a critical role in providing the Agency with information during the Pet Food Recall of 2007 during which both pet and livestock feeds were contaminated with melamine and related triazine compounds. This information helped FDA understand the mechanism by which triazines caused renal failure and provided new methods to detect these compounds in foods. A paper describing the emergency response to the pet food recall and this study was prepared and published in FY 2008. Additional articles describing the tissue methods developed for melamine and cyanuric acid were prepared. Because of the potential of continued adulteration of animal feeds, our scientists initiated a proactive study to examine the depletion of melamine in fish tissues. In addition, they began to look for a threshold dose for crystal formation in kidneys of fish dosed with both cyanuric acid and melamine. These studies were begun January 2008. Later, September 2008, melamine was again found in products, milk and infant formula in China, resulting in worldwide recalls of many milk products. This began an immediate response from FDA to develop a new risk assessment for melamine and its analogues. CVM’s studies were extremely valuable to the scientists conducting this assessment. Preliminary data on crystal formation were provided by CVM, along with depletion data in 2 species of fish. This information was subsequently shared with the World Health Organization in their expert meeting on Melamine in Ottawa December 2008. As a result of this proactive approach, FDA’s reputation in the world community was enhanced and it is considered a leader in the area of melamine research. Office of Research’s 2008 investigation of tissue concentrations and depletion of residues over time provided the agency with critical information for assessing risks and withdrawal periods in case of livestock feed contamination by triazine compounds. Further, our work investigating the melamine-related renal toxicosis provided key insights into the concentrations of melamine required to induce crystals to form in kidneys. Aquaculture Aquaculture is a growing industry in the United States and there is a concerted effort to provide information regarding the safety of new therapeutic agents for these Minor Species. Likewise, there is concern about the potential for antimicrobials used in the aquatic environment to cause alterations in the susceptibility of bacteria that could potentially infect humans. CVM scientists analyzed the antibiotic susceptibility of Bacillus cereus isolates from feed and fecal samples taken before, during, and after multiple treatments with oxytetracycline (OTC) medicated feed. Antimicrobial susceptibility to OTC was determined and, in collaboration with DAFM scientists, the genetic relatedness of the isolates was determined using pulse-field gel electrophoresis. OR is now characterizing the tetracycline resistance genes from the isolates. The information provided by this work will help guide FDA in surveillance for antibiotic resistance and in the evaluation of antimicrobials for aquaculture. To continue CVM’s efforts to provide pharmacokinetics and residue data in fish, we updated the Phish-Pharm database was updated in 2008, expanding the number of articles which have been mined to over 450. A bovine pneumonia model was used to investigate the innate immune response to bacterial pneumonia. To date, we have identified sev AMPs by interrogating protein databases with tandem mass spectrom sequence data. The peptides identified are: Cathelicidin -1, Cathelicid 2, Cathelicidin -3, Cathelicidin -4, Cathelicidin -5, Cathelicidin -7, and Beta-defensin C7. Three of the peptides of interest have been synthesized, and in vitro susceptibility testing is currently being performed. Minimal bactericidal concentrations (MBCs) will be determined against the bacterial strain used for infection (M. haemolytica), and for oth Animal Drug Safety & Efficacy INTRODUCTION. Ensuring the safety and efficacy of drugs for animals while protecting our food supply is a core mission for CVM. During reviews of new animal drugs there are frequently regulatory questions which arise that require specialized studies to provide background information for our reviewers. OR conducts applied studies to address regulatory issues confronted during new animal drug application review. Recent studies have been conducted to facilitate minor species drug approvals. IMPACT. Data from current investigations are being used to support of an aquaculture drug application sponsored by another government agency. The goal was to provide pivotal efficacy data for a minor species for which there is limited impetus for industry to conduct drug approval studies. ACCOMPLISHMENTS • A final report was completed for a study evaluating the ability for formalin treatments to reduce mortality associated with fungal (Saprolegnia) infections in channel catfish. This was a GLP study conducted to support an INAD held by US Geological Survey. Other governmental agencies responsible for species restoration and stocking national waterways with cultured fish species need ways to treat fish infected with fungus after the trauma of transport or intensive rearing. • There are no drugs approved for use against internal parasites in fish. In 2008 we completed the final report for a study that developed methods for maintaining a population of largemouth bass infected with the renal parasite Alcopenteron ureteroectes. This model is being used to evaluate the effects of selected anthelmintics against the monogenean in vitro. A manuscript is currently being developed to describe the in vitro testing. • PhishPharm, a database used by FDA reviewers evaluating new animal drug applications and researchers developing new aquatic therapeutics, was updated in 2008 to include information from over 450 articles. The updated Access database is being edited to be 508 compliant and then will be published on-line on the CVM website. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Antimicrobial Resistance Mechanisms INTRODUCTION. For foodborne bacteria, identifying the source of contamination is an essential first step in preventing human infections. In addition, source attribution can help better evaluate the impact of antibiotic use in different animal environments. Each year, it is estimated that there are approximately 76 million food-borne infections leading to 325,000 hospitalizations in the United States. With the large toll attributed to these food-borne pathogens, many of which are associated with food animal products, a reliable method to identify the origin of the pathogen and/or its resistance determinants would help target control measures to improve food safety. IMPACT. The data from these projects help to define and differentiate pathogens and their resistance traits to better understand the dynamics of foodborne infections, including those resistant to antibiotics. ACCOMPLISHMENTS • CVM continues studies to investigate molecular typing tools to help determine the animal origin of food-borne bacterial pathogens. Over 4000 Salmonella and Campylobacter isolates have been characterized using a combination of two or more of the following methods: antibiotic susceptibility testing (AST); serotyping, plasmid profiling; pulsed-field gel electrophoresis (PFGE) using single and multiple enzymes; repetitive element PCR (Rep-PCR); multilocus sequence typing (MLST); fatty acid profiling; and more recently protein profiling, virulence gene profiling, and microarray. Results from serotyping, AST, PFGE, and MLST have provided the following associations between animal hosts and food-borne pathogens: specific serotypes have been found to be associated only with certain food animal groups; AST profiles have shown certain resistance phenotypes to be occurring with particular animal hosts; and PFGE profiles coupled with AST profiles and MLST sequence types have been shown to be associated with particular animal hosts. In the next round of studies, a high-density Affymetrix microarray will be used to identify biomarkers for animal host of origin, and to catalog antibiotic resistant and virulence genes in MDR isolates of Salmonella. CONTACT: Dr. Heather Harbottle, 301-210-4246, heather.harbottle@fda.hhs.gov • Two-enzyme PFGE has been shown to have better discriminatory power than MLST for Campylobacter coli isolates, showing genotypic diversity with some evidence of clonality among isolates recovered from retail chicken breasts and ill humans. Optimization and standardization techniques for a multi-pathogen identification and characterization microarray including Salmonella, Campylobacter, and E. coli identification probes is underway and nearing completion for use in screening virulence genes and antimicrobial resistance genes of isolates from a number of animal sources. PCR validation of this array has been completed and array refinements are underway. Alternative methods are being examined at OR and the Center for Food Safety and Nutrition, Office of Scientific Analysis and Support. CONTACT: Dr. Heather Harbottle, 301-210-4246, heather.harbottle@fda.hhs.gov • We completed analyses of 106 Pseudomonas aeruginosa isolates recovered from clinically ill dogs between 2003 and 2006 in the United States. Antimicrobial susceptibility profiles were determined and the genetic basis of fluoroquinolone resistance was characterized. The presence of class 1 integrons was also screened by PCR. Of the ß-lactams tested, all isolates were resistant to ampicillin, cefoxitin, cefpodoxime, cephalothin and cefazolin, however, less than 10% of isolates were resistant to cefotaxime/clavulanic acid, ceftazidime, piperacillin/tazobactam and cefepime. Two isolates were resistant to the carbapenems, one to imipenem and the other to meropenem. Among the quinolones and fluoroquinolones, most isolates were resistant to nalidixic acid (96%), followed by orbifloxacin (52%), difloxacin (43%), enrofloxacin (31%), marbofloxacin (27%), gatifloxacin (23%), levofloxacin (21%) and ciprofloxacin (16%). The 102 nalidixic acid resistant isolates were screened for QRDR (quinolone resistance determining region) point mutations in the gyrA, gyrB, parC and parE genes; these mutations were present in 34 strains. There was an association between QRDR mutations and increasing fluoroquinolone MICs. The level of resistance found in this study suggests that many of the antimicrobial agents commonly used in companion animal medicine may not constitute appropriate therapy for the treatment of canine Pseudomonas infections. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov • Salmonella enterica may be found in any raw food of animal, vegetable or fruit origin. Different Salmonella serovars vary in their distribution, virulence and host specificity. S. enterica serovar Kentucky (S. Kentucky), though often found in the food supply, is less commonly isolated from ill humans. The multidrug-resistant (MDR) isolate Salmonella Kentucky CVM29188, isolated from a chicken breast sample in 2003, was sequenced to completion. It was found to contain three plasmids (146,811 bp; 101,461 bp; 46,121 bp), two of which carry resistance determinants (pCVM29188_146: strAB, tetRA and pCVM29188_101: blaCMY-2, sugE). Both resistance plasmids were transferable by conjugation, alone or in combination, to S. Kentucky, S. Newport and E. coli recipients. pCVM29188_146 shares a highly conserved plasmid backbone of 106 kb (>90% nucleotide identity) with two virulence plasmids from Avian Pathogenic Escherichia coli strains (pAPEC-O1-ColBM and pAPEC-O2-ColV). Shared APEC virulence factors include iutA/iucABCD, sitABCD, etsABC, iss, and iroBCDEN. PCR analyses of recent (1997-2005) S. Kentucky isolates from food animal, retail meat and human sources revealed that 172 (60%) contained a similar APEC-like plasmid backbone. Notably, though rare in human- and cattle-derived isolates, this plasmid backbone was found at high frequency (50-100%) among S. Kentucky isolates from chickens within the same time span. 94% of the APEC-positive isolates showed resistance to tetracycline and streptomycin. Together, our findings of a resistance-encoding APEC virulence plasmid in a poultry-derived S. Kentucky isolate and of similar resistance/virulence plasmids in most recent S. Kentucky isolates from chickens and, to lesser degree, from humans and cattle highlight the need for additional research in order to examine the prevalence and spread of combined virulence and resistance plasmids in bacteria from agricultural, environmental and clinical settings. CONTACT: Dr. Patrick McDermott, 301-210-4213, patrick.mcdermott@fda.hhs.gov • Extended-spectrum cephalosporin (ESC) resistance in Salmonella is monitored closely, since this class of drugs is used to treat pediatric infections and severe infections in adults. We completed a study of 344 ampicillin-resistant (AmpR) Salmonella isolated from NARMS retail meats. Isolates were tested for susceptibility to 23 antimicrobial agents, and screened for the presence of five beta-lactam resistance genes (blaCMY, blaTEM, blaSHV, blaOXA, blaCTX-M) and class 1 integrons. Filter mating and electroporation were performed to determine the range of resistance phenotypes that were transferable. All isolates were also characterized by pulsed-field gel electrophoresis (PFGE). The results showed that a wide range of susceptibility patterns were noted among the AmpR isolates, with 67% of isolates resistance to >5 antimicrobials and 5% of isolates resistance to > 10 antimicrobials. Co-resistance to other beta-lactams was noted for amoxicillin/clavulanic acid (56%), ceftiofur (50%), cefoxitin (50%), ceftazidime (25%) and ceftazidime/ clavulanic acid (10%), whereas less than 5% of isolates were resistant to piperacillin/tazobactam (5%), cefotaxime (4%), cefotaxime/ clavulanic acid (4%), ceftriaxone (2%), and aztreonam(1%). All isolates were susceptible to cefepime, imipemen and cefquinome, and no ESBLs were present in any of the isolates. Seven percent of isolates displayed the typical MDR-AmpC phenotype which showed resistance to ACSSuT, plus resistance to amoxicillin/clavulanic acid, cefoxitin, and ceftiofur with decreased susceptibility to ceftriaxone (MIC >4ug/ml). Some MDR-AmpC isolates also showed resistance to piperacillin/tazobactam, aztreonam, ceftazidime, and cefotaxime, as well as other classes of drug, such as gentamicin, kanamycin and trimethoprim/sulfamethoxazole. MDR patterns varied within and between serotypes, with the MDR-AmpC phenotype apparent in serovars Dublin, Enteritidis, Heidelberg, I.4,12:r:-, Kentucky, Newport, Saintpaul, and Typhimurium var. Copenhagen. PFGE results showed that some MDR clones were widely dispersed in different types of meats throughout all five sampling years. PCR showed that 50% of isolates contained blaCMY, 47% carried blaTEM-1 and 2.6% carried both genes; but none carried blaSHV, blaOXA, or blaCTX-M genes. Only 15% of isolates contained class I integrons carrying various combinations of aadA, aadB and dfrA gene cassettes. The blaCMY, blaTEM and class 1 integrons were transferable through conjugation and/or transformation in some isolates, along with various combinations of other resistance phenotypes. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov • Understanding how resistant bacteria disseminate through food production systems following antimicrobial treatment is key to limiting the spread of resistance mechanisms. We used broth microdilution and pulse-field gel electrophoresis (PFGE) to analyze 157 Bacillus cereus isolated from feed and fecal samples collected from 2 recirculating aquaculture systems growing hybrid tilapia before, during, and after treatment with oxytetracycline (OTC) medicated feed. Both systems were administered a treatment and the B. ceresus were collected and tested until the resistance isolates subsided then, each system was administered a second treatment and bacteria were monitored again. The PFGE results grouped the isolates into 3 categories: resistant isolates from feed, resistant isolates from fish feces, and susceptible isolates from feed and fish feces. All of the groups were closely related. The resistant population appears to have originated from the feed and passed through the intestines of the fish (with slight genetic differences). Resistant isolates emerged during treatment and then their prevalence would decline post-treatment. The resistant population took longer to decline after a second treatment. This information will help FDA provide guidance on how to limit the spread of antibiotic resistance in aquaculture production systems. DAR scientists are now working with DAFM scientists to characterize the tetracycline resistance genes of these bacteria. CONTACT: Charles Gieseker, 301-210-4217, charles.gieseker@hhs.fda.gov Immuno- Pharmacology INTRODUCTION. Together with ONADE, OR scientists are collaborating on several studies designed to provide scientific data needed in support of the ONADE review functions. One such collaboration involves examining the standards for the manufacturing of sterile, pyrogen-free animal pharmaceuticals. The investigation focuses on determining the permissible levels of endotoxin contamination and the biological relevance of this contamination. Other investigations attempt to identify biomarkers indicative of inflammation or disease in animals. IMPACT. The outcome from these investigations should provide pivotal data to determine if current thresholds for pyrogen contamination are sufficient, or if in vivo data indicate that biologically relevant levels may vary across species. In addition, the discovery of differently expressed proteins indicative of inflammation or other diseases in animals could lead to the establishment of more accurate biomarkers to evaluate drug efficacy and aid in the approval of new veterinary drugs. ACCOMPLISHMENTS • A study is currently underway to investigate and evaluate the lipopolysaccharide (LPS; "endotoxin") doses that the Center for Veterinary Medicine is currently using to set quality standards for pyrogen-free veterinary pharmaceuticals (i.e. containing no feverinducing compounds). The CVM has established industry guidance for the manufacture of pyrogen-free animal drugs, standards which are found in CVM Policy and Procedures Guidance (PPG) 1240.4122. This document adopts several provisions written by U.S. Pharmacopeia (USP). The Guidance utilizes the two industry benchmark procedures for detecting endotoxin and pyrogens: 1) rabbit pyrogen test (RPT; indicates fever due to non-specific pyrogen) and 2) limulus amebocyte lysate test (LAL; "Bacterial endotoxins test"). However, endotoxin limits for animals are more complicated due to the significant differences between species response to endotoxin, and due to the differences in size of mature animals between species, and even within species (such as the dog). Extrapolating and interpreting endotoxin levels as determined in LAL testing is not straight-forward because the level detected may have different magnitudes of physiologic response in the different species, depending on 1) the species' threshold of response, 2) the doseresponse relationship, and 3) the dramatic difference in volumes used to treat mature animals of different species. A compilation of observations from many sources indicate that the febrile response to LPS is similar in humans, rabbits, cats, and horses; however, the dog appears less sensitive and cattle are highly sensitive. It has therefore been suggested to set a product endotoxin limit that would protect the most endotoxin-sensitive species associated with a given parenteral drug approval (LAL Users' Group Newsletter, Vol. 2, No. 2, June 2008).The majority of research with LPS (in humans or animals) has been used in models at elevated doses to promote strong reactions (i.e., shock), with few investigating low LPS concentrations. CVM is interested in determining the LPS threshold in cattle – the lowest LPS dose that stimulates a physiological response (elevated body temperature). A pilot study was completed in 2007, with 23 Holstein steers, that sought to answer the following questions: 1) What are the permissible levels of endotoxin contamination?; 2) How does a LAL test score relate to biological relevance within the animal?; and 3) How does body temperature of cattle respond to low doses (<0.60 µg/kg body weight) of LPS? Results from that study suggested several modifications to be used in the current investigation, and it also suggested that LPS doses below 0.05 µg/kg BW may be required to find the true threshold for response. A study currently underway will evaluate LPS doses down to 0.03 µg/ kg BW, and possibly lower, in 28 steers in order to find the threshold for a response. CONTACT: Dr. Jeffrey L. Ward, 301-210-4216, jeffrey.ward@fda.hhs.gov • We have completed the animal and laboratory phases of a coliform mastitis study in which 24 dairy cattle were inoculated intramammarily with Escherichia coli (strain P4), and administered either flunixin meglumine or carprofen (non-steroidal anti-inflammatory drugs) eight hours post inoculation. Milk samples were collected at regular intervals along with physiological data including rectal temperature and milk somatic cell counts. 2-D gel electrophoresis was used to profile protein expression in whey fractions collected prior to inoculation with Escherichia coli, and at 18 hours post infection. Proteins present in non-mastitic milk samples as well as proteins expressed in milk only during coliform mastitis were excised from 2-D gels, digested with trypsin, and tryptic peptides were evaluated using matrix assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. Proteins expressed during coliform mastitis included the acute phase protein a-1-acid glycoprotein, complement C3, a-2- HS-glycoprotein, and the antimicrobial peptides cathelicidin, indolicidin, and bactenicin 5 and 7. Increases in the serum proteins albumin, serotransferrin, and ß-fibrinogen were maximal at 18 hours post infection, and were correlated to increases in rectal temperature and milk somatic cell measurements. Follow-up investigations were conducted on samples collected over the time course of infection (0, 12, 18, 24, 36, 48, and 60 hours) to identify low abundance proteins in mastitis milk using nano-LCMS/ MS. The number of proteins identified when compared to the 2D-GE MALDI experiments increased significantly, and several additional markers of inflammation were found including the relatively low abundance proteins serum amyloid A and haptoglobin, as well as added complement factors, glycosylation-dependent cell adhesion molecule-1, apolipoproteins, and kinninogen, the precursor to bradykinin. Label-free relative quantification was performed using spectral counts (peptide hits) to track temporal changes in milk proteins during the course of infection and results were compared to ELISA data generated on a select number of low abundance acute phase proteins. Results indicate that label-free quantification could be used to monitor changes over the course of infection in low abundance protein expression without the reliance on antibody-based assays. Follow-up studies will be conducted in dairy goats to analyze the response of some identified candidate markers of inflammation to the administration of non-steroidal anti-inflammatory drugs. CONTACT: Jamie L. Boehmer 301-210-4281, jamie.boehmer@fda.hhs.gov • We have identified 14 biomarkers of inflammation in swine using a validated swine DNA microarray. Seven biomarkers are up-regulated and seven are down-regulated during inflammation. The biomarkers were identified by stimulating swine blood in vitro with LPS. Changes in the expression of these biomarkers were confirmed using reverse-transcriptase real-time PCR (qRT-PCR). These markers would be used as adjunct measures of efficacy to help drug sponsors establish an anti-inflammatory claim for non-steroidal antiinflammatory drugs (NSAID). There currently are no NSAIDs approved with an anti-inflammatory claim. This study will use a combination of clinical, biochemical, and molecular endpoints to identify and develop reliable biomarkers of inflammation which also track with therapeutic outcomes. This work will use two different models of inflammation, a systemic inflammatory model and a model of a local, soft tissue inflammation. We will initiate work with the systemic inflammatory model late spring 2009 and anticipate initiating the soft tissue model work by late summer 2009. CONTACT: Dr. Michael J. Myers, 301-210-4355, michael.myers@fda.hhs.gov Antimicrobial Peptides INTRODUCTION. Antimicrobial peptides (AMPs) are short proteins that possess direct antimicrobial activity. These compounds have been studied extensively in humans and various animal species, where they are expressed largely at the mucosal surfaces of the intestine and lung. They are a component of the innate immune system and demonstrate antibacterial activity across a broad range of both gram-positive and gram-negative bacteria. Interestingly, members of this group of compounds are also synthesized by certain bacterial species, and two have been used extensively for several decades – ambicin (nisin; a food preservative) and polymixin B (an antibiotic). Two of the largest classes of vertebrate AMPs, and those that have been studied most extensively, are the defensins and the cathelicidins. These peptides are very attractive candidates for development as therapeutic agents because of their selectivity, broad-spectrum activity, and speed of action. Additionally, it is believed that bacteria will not easily be able to develop resistance to them because of their mechanism of action, which is to disrupt the basic structure of the bacterial membrane. IMPACT. The development of AMPs for clinical applications is already being seen for human therapeutics, and it is anticipated that veterinary applications soon will ensue. In addition to the evaluation of peptide activity, toxicity, and efficacy/clinical performance, the FDA will also need to be prepared to evaluate such basic issues as dosage form and delivery mode, as well the other standard parameters such as MIC/breakpoint determination. However, in addition to the therapeutic applications of these peptides, they may also have great utility as biomarkers of infection or inflammation, or as surrogates in the evaluation of disease progression or response to treatment with more conventional antimicrobial agents. Subsequent evaluation of these compounds in animal models is anticipated to shed some light on their use in this regard, in both humans and animals. ACCOMPLISHMENTS • The study of these innate defenses against bacterial infections in the lung may be easily investigated using a bovine pneumonia model in which we have direct access to the airways and their secretions. For the past 5 years we have been performing tracheostomies in beef cattle in order to obtain bronchial fluid for PK/PD analyses of approved antimicrobial agents directed against a common form of bacterial pneumonia. For this ongoing study, we used 6 steers that underwent the surgical preparation (tracheostomy), followed by a 7- 10 day recovery period. Bronchial fluid was collected for peptide analysis when the cattle were healthy, and again at 6, 12, and 24 hours after the induction of pneumonia (direct instillation of M. haemolytica into the lungs.) Four steers were infected, with two serving as uninfected (sham) controls. Two-dimensional gel electrophoresis has been performed to identify proteins that are stimulated by the infection. Proteins were excised from the gels and/or raw bronchial fluid, were subjected to trypsin digestion, and the resulting peptides were analyzed by liquid chromatography followed by tandem mass spectrometry (LC-MS/MS). To date, we have identified seven AMPs by interrogating protein databases with MS/MS sequence data. The peptides identified are: Cathelicidin -1, Cathelicidin -2, Cathelicidin - 3, Cathelicidin -4, Cathelicidin -5, Cathelicidin -7, and Beta-defensin C7. Three of the peptides of interest have been synthesized, and in vitro susceptibility testing is currently being performed. Minimal bactericidal concentrations (MBCs) will be determined against the bacterial strain used for infection (M. haemolytica), and for other common respiratory pathogens of ruminant species (Pasteurella multocida, Haemophilus somnus, Actinomyces pyogenes.) Standard bacterial susceptibility protocols will be used and will be critically evaluated for their performance with AMPs. CONTACT: Dr. Jeffrey L. Ward, 301-210-4216, jeffrey.ward@fda.hhs.gov Metabolism and Residue Depletion INTRODUCTION. The current research effort in the program focuses on the determination of marker residue(s) of selected veterinary drugs in aquacultured finfish species In an effort to determine the appropriate marker residue (MR) of ivermectin in various species of fish, we are conducting comparative residue depletion and metabolism studies in those species of fish that are most prevalent and potentially important to the U.S. aquaculture industry. Species being studied include atlantic salmon, tilapia, channel catfish, large mouth bass, hybrid stripped bass, and yellow perch. Literature studies on in-vitro drug metabolizing activities of aquatic species reveal that different species vary considerably in their capacity to metabolize drugs. In order to determine the fate of ivermectin in fish, radio-labeled ivermectin is being used. The use of a radiolabeled compound allows the OR researchers to investigate the distribution and elimination of the drug throughout the fish even if the drug is metabolized. Based on the information gathered from the study, along with information on the identification of metabolites gained from studies using radiolabeled ivermectin and additional studies using ivermectin that has not been labeled, OR scientist can define an appropriate MR for each species. IMPACT. This approach will allow us to ascertain fish species with similar metabolic profiles and subsequently, we will characterize and perhaps identify the MR of ivermectin in various species of fish. Identifying MR will allow us to develop analytical methods for regulatory monitoring. Additional veterinary drugs, based on the need identified by aquaculture sub-groups, may be studied for finding MR in multiple fish species. ACCOMPLISHMENTS • The animal and analytical work for fish species, Atlantic salmon, tilapia and channel catfish was initiated in year 2007 and the remaining portion was completed in 2008. The three species were orally treated with 3H-ivermectin at the dose level of 0.1 mg/kg, with activity of about10 µCi/kg. Atlantic salmon was sacrificed at post dose days 1, 21 and 28; tilapia and catfish were sacrificed at post dose days 1 and 21. Muscle filets with adhering skin were collected and frozen at – 80 şC until assayed. The total radioactive residue (TRR) and high performance liquid chromatographic (HPLC) analysis of 3Hivermectin and its metabolites in the muscle tissues was performed to determine a potential marker residue (MR). The preliminary results indicate that the parent compound ivermectin is the persistent residue in the muscle tissue of the three fish species. The result further suggest that ivermectin is depleted faster in tilapia, followed by catfish and then by Atlantic salmon. • Two fish species, large mouth and hybrid striped bass, were orally treated with 3H -ivermectin at the dose level of 0.1 mg/kg having activity of about 10 µCi/kg. Muscle filets with adhering skin were collected at various post dose intervals and frozen at – 80 şC until assayed. The total radioactive residue (TRR) and HPLC analysis of the muscle tissues of these fish species is in progress. CONTACT: Dr. Badar Shaikh, 301- 210 4654; badaruddin.shaikh@fda.hhs.gov Method Trials: Chemical INTRODUCTION. A drug sponsor must provide FDA with a method to detect residues for new animal drugs intended for use in food producing animals. The methods are submitted by drug developers as part of the approval process for a New Animal Drug Application (NADA). Typically, the method consists of two parts, a determinative procedure to quantify the amount of drug residue present, and a confirmatory procedure to unambiguously identify the presence of the drug residue. Recent advances in analytical chemistry using liquid chromatography/mass spectrometry (LC-MS) have made it possible to combine the two procedures into a single method. The trials for NADA methods are typically coordinated by the drug sponsor in what is known as a Sponsor-Monitored Method Trial. Before the start of the trial, the sponsor is given the option of holding a method demonstration at either the sponsor’s laboratory or the CVM research facility. To ensure that the method is practical for use, the CVM laboratory serves as one of the participants in the method trial for the determinative procedure. CVM/DRC serves as the expert laboratory for all confirmatory procedures. IMPACT: The acceptance of new methods is an integral part of the approval process of NADAs for drugs used in food animals. Approved methods must be suitable for use in FDA-ORA and USDA-FSIS laboratories with written procedures that are clear, complete, and free of ambiguity. The methods are needed to ensure that the approved drugs are not being misused, and the analytical results generated with these methods can be used with confidence by the Center when undertaking regulatory actions. ACCOMPLISHMENTS • DRC completed the evaluation of a multispecies confirmatory method. In this study, the confirmatory method evaluated will be used both in support of a pending New Animal Drug Application (NADA) and to provide updated confirmatory procedures for previously-approved NADAs from the sponsor for the compound. • DRC participated in several meetings with sponsors as part of the review process in preparation for a method trial. CONTACT: Dr. Philip J. Kijak, 301-210-4589, philip.kijak@fda.hhs.gov Method Development to Replace Obsolete Procedures Introduction. In order for FDA to take an action against a producer who sells animals containing drug concentrations in their tissues above the legal tolerance, methods used to measure the concentration that are traceable to the original tolerance. Because technology changes, methods become obsolete. Equipment is no longer available. Some reagents are no longer used because of environmental and occupational health considerations. Simpler, faster, and safer laboratory techniques are available. Some of the oldest methods, developed before the advent of many modern analytical techniques, are based on total microbiological activity of an extract for which the exact composition is unknown. As drug sponsors develop individual methods for each drug approval, regulatory laboratories have spend scare resources switching between methods including the development of the needed quality control and validation data to demonstrate that the analytical result is valid. Often this causes delays in the analysis of product. Because the tolerance developed for a drug is directly linked to the method, the relationship between the concentration measured using the original and any new method must be established. The approach taken in the past to develop the needed information has required the direct comparison of analytical results based on the analysis of split samples containing incurred residues, referred to as a bridging study. While this approach is scientifically rigorous, the complexity and resources required for the needed studies has greatly limited the number of bridging studies that have been conducted. The approach requires bridging studies to be conducted whenever methods are changed. The primary objective of this program is to address both the development of updated methods to replace obsolete methods and to develop improved protocols for future bridging studies. The initial studies under the program will focus on replacing the oldest microbiologically based methods testing total residue of unknown composition with newer chemistry based methods. Because the microbiological activity in the residue may be due to both the drug and metabolites, a linear relationship between a specific marker and the microbiological activity may not exist. A second goal of the research is to develop data that will support the use of rapid screening tests, such as used in the milk industry, to test meat for drug residues. FSIS would be responsible for implementing new multi-residue quantitative or semi quantitative screening tests at the plant. The use of better screening tests would minimize the number of samples tested by traditional chemical based assays for both determination and confirmation. IMPACT: The development of new methods that are directly traceable to the original tolerance will allow USDA/FSIS to implement cost effect multiresidue methods for testing. The results from these methods will be acceptable for FDA to use in taking legal action against producers who have violated the law by offering for sale animals that contain drugs with concentrations above the tolerance. USDA/FSIS will benefit by being able to use modern analytical methods and not have to retest samples using single drug specialized methods to provide FDA with the needed data. ACCOMPLISHMENTS • The first drug included in the program is penicillin G because many of the drug-residue violations in cattle caused by penicillin-G. The official method for the drug is outdated, difficult to use, and cannot be used when multiple antibiotics are present in an animal which is a common occurrence. In order to reduce cost and effort; as well as to expedite surveillance, a modern analytical method capable of quantifying and confirming multiple classes of antibiotics in cattle is needed. The new method has to use current laboratory techniques and instrumentation and must be bridged to the original NADA method. Both managers and scientists from OR, ONADE, and FSIS-USDA held discussions on the requirements of the new method such as performance characteristics, cost, throughput, and turn-around time. In 2008, scientists at the Office of Research started the development of method for penicillin-G. The method has been designed so it can be expanded into a multi-class/multi-residue method for the analysis of other antibiotics in bovine kidney. This method will be used as the starting point to validate and bridge antibiotics to the original NADA microbiological method. In its present form, the method can quantify and confirm the following antibiotics in bovine kidney: chlortetetracycline, oxytetracycline, tetracycline, tylosin, tilmicosin, clarithromycin, erythromycin, sulfathiazole, sulfamerazine, sulfamethazine, sulfaquinoxaline, sulfachlorpyridazine, cloxacillin, dicloxacillin, penicillin G, novobiocin, desacetyl cephapirin, monensin, bacitracin A, ciprofloxacin, danofloxacin, difloxacin, enrofloxacin, and sarafloxacin. CONTACT: Dr. Mayda López, 301-210-4587, mayda.lopez@fda.hhs.gov Microbiological Methods INTRODUCTION. The Biological Methods program seeks to develop, improve, and implement diagnostic methods for the detection and characterization of pathogenic microorganisms from food animals, their environments, and their derived food products. A main objective of this program is to develop and validate standardized in vitro antimicrobial susceptibility testing methods. IMPACT. Once isolated and identified, determining a bacterium's antimicrobial susceptibility profile is of considerable importance to CVM for several reasons. These research activities provide the Agency with up-to-date data on the potential fate of an approved antimicrobial in its usage environment, including its effects on bacteria other than the target microorganisms. Accurate testing methods are essential, and OR scientists are closely involved in validating methods and establishing quality control and interpretative criteria in association with the Clinical Laboratory Standards Institute (CLSI). This has allowed CVM to establish a quality control testing program for NARMS, as well as teach these methods to visiting scientists from other federal agencies. In addition, improvement in early warning systems to notify people of harmful biological conditions that may threaten a food source is integral to the Agency’s mission to protect the food supply. ACCOMPLISHMENTS • In 2008, DAFM scientists completed a multi-laboratory study designed to standardize an in vitro antimicrobial susceptibility testing method for Campylobacter based on disk diffusion. Preliminary results showed that variations in manufactured medium lots can have significant impact on the results. The constituents causing aberrant results are being investigated to amend the method to provide reproducible results. CONTACT: Dr. Patrick McDermott, 301-210 4213, patrick.mcdermott@fda.hhs.gov • CVM OR has developed a protocol to develop standardized antimicrobial susceptibility testing methods for Flavobacteria fish pathogens and conduct a multi-laboratory study to determine quality control ranges. To this end, DAR scientists have developed preliminary methods in collaboration with scientists from Louisiana State University. Standards methods will facilitate clinical testing of these bacteria and surveillance for antibiotic resistance. CONTACT: Charles Gieseker, 301-210-4217, charles.gieseker@fda.hhs.gov Pharmacokinetics and pharmacodynamics INTRODUCTION. Investigations of the pharmacokinetic/pharmacodynamic characteristics of various drugs continue to be carried out in several different animal species and for several different purposes. Essentially all pharmacokinetic data submitted to CVM are generated in normal, healthy animals. Therefore, CVM is unable to validate the assumption that pharmacokinetic parameters are unaltered in the diseased state compared to the healthy state for that drug/disease/animal species. Should this assumption be incorrect we risk not only therapeutic failures, but we also risk the public health via the inadequate exposure of pathogen to the drug. PK/PD studies are also conducted in support of the Center’s Minor Use/ Minor Species (MUMS) program and its Critical Path Initiative involving Process Analytical Technology (PAT). In regards to the MUMS program, there are limited data on the pharmacokinetics of anthelmintics used in the parasite control of small ruminants (sheep and goats). Approvals for use in these minor species rely on data generated in the major species, namely, cattle. In support of PAT, pharmacokinetic studies are necessary to provide in vivo data for correlation with in vitro dissolution data. Pharmacokinetic studies are also conducted in aquaculture species to provide information necessary for the development of interpretive criteria. IMPACT. Results from these investigations will provide the scientific support for the development of guidance documents and regulatory decisions within the Center. This research will help CVM identify those (if any) classes of compounds where we need to factor the disease condition into our human food safety assessments. This information will be invaluable in designing pre-approval studies for assessing the potential for selecting for resistant bacterial strains, and for selecting optimal dosage rates and intervals. Comparative pharmacokinetic studies involving cattle, sheep and goats will facilitate development of guidelines for conducting future studies under the Minor Use/Minor Species Program (MUMS). Correlations of this type are necessary to determine whether manufacturing changes as measured by Near IR under PAT will be an adequate quality control tool that can be used to assess changes in final product composition and if these changes have a potential impact on drug disposition in vivo. ACCOMPLISHMENTS: • We completed the animal phase of a pharmacokinetic/pharmacodynamic (PK/PD) study of tilmicosin (a macrolide antibiotic) in 16 beef steers in 2008, both in the healthy state and also following induction of pneumonia with Mannheimia haemolytica. Following administration of the drug to all animals in the healthy state, and analysis of plasma and bronchial fluid pharmacokinetics, eight animals were subsequently infected with M. haemolytica (with eight serving as controls) and the experiment repeated. In addition, the eight control animals from the initial study were subjected to a similar protocol (4 infected / 4 controls) using the triamilide antibiotic tulathromycin. Laboratory analysis of the plasma and bronchial fluid samples is on-going and should be completed in 2009. These experiments are designed to investigate the effects of infection on active levels and disposition of these two antibiotics. CONTACT: Dr. Jeffrey L. Ward, 301-210-4216, jeffrey.ward@fda.hhs.gov • In order to map the possible pathways for drugs injected at the base of the ear to gain access to the cerebral vasculature and cause sudden death or other adverse events, the heads of 6 steers were perfused with an acrylic polymer via the common carotid arteries. In one additional steer a latex-based polymer was used, but the compound fragmented upon digestion of the skull tissues and no useable vascular casts were obtained. Direct injection of the polymers into the superficial ear arteries was not possible due to the small size of the vessels and the viscosity of the compound. Complete anatomical identification of all arteries, and comparison of vessels between animals, has not yet been completed. In addition, heads obtained from steers being used on other studies have been injected with dye preparations and subjected to computerized tomography (CT) in order to visualize vessels in situ. Preliminary analysis of the arteries supplying the ear reveals vessels approximately 1.5 to 2.5 mm in diameter, which narrow substantially as one moves from the base towards the tip of the ear. Tracing the ear vessels proximally toward the skull, a possible pathway to the brain exists via the maxillary artery and the rostral and caudal rete branches of this artery. Cattle do not have a functional internal carotid artery, and therefore back-flush via that pathway is not a possible route to the brain. CONTACT: Dr. Jeffrey L. Ward, 301-210-4216, jeffrey.ward@fda.hhs.gov • Except for moxidectin which is only formulated for subcutaneous treatment, all of the other anthelmintic products were formulated for oral administration. Ivermectin was administered both orally and subcutaneously to all three species. Plasma samples were collected over the entire post-treatment period up to and in some cases beyond the specified withdrawal times. We have completed the animal phase for all drugs. Sample analyses for levamisole, fenbendazole and albendazole are completed. Analyses for the avermectins (doramectin, moxidectin and ivermectin) are ongoing. Although we’ve not completed the pharmacokinetic analyses, we have visually compared the plasma concentration - time plots for fenbendazole (FBZ) and albendazole (ABZ) in the major species (cattle) and two minor species (sheep and goats). With FBZ there is a clear progression in plasma levels for the substrate (FBZ) and its sulfoxide (primary) and sulfone (secondary) metabolites. Calves and goats cleared all forms of FBZ by 72 – 96 hrs, whereas sheep needed the entire 7-day sampling time to demonstrate complete elimination of FBZ metabolites. For ABZ, the parent drug was not detectable in either species and the two metabolites (sulfoxide and sulfone) were cleared within 72 hrs. In sheep, the maximal levels of sulfone were less than the sulfoxide, whereas in goats they reached the same maximal concentrations. Surprisingly in calves, the maximal levels of sulfone were about twice that of the sulfoxide metabolite. CONTACT: Dr. Joseph C. Kawalek, 301-210-4296, joseph.kawalek@fda.hhs.gov Method Development in Support of Minor Use Minor Species INTRODUCTION. The passage of The Minor Use and Minor Species Animal Health Act of 2004 recognized the need to increase the availability of drugs for minor species. A major cost incurred by a drug sponsor is the need to develop analytical methodology to monitor for drug residues. The advancement of LC-MS technology has allowed the development of methods that can detect a wide range of compounds in a single chromatographic analysis. The high specificity of the MS detector also means that simpler extraction and purification procedures may be used. OR is developing “off the shelf” multiresidue methods that can be used by drug sponsors in support of approvals for use in minor species. IMPACT. By developing methods that can be used “off the shelf” for the quantitation and confirmation of a drug in a minor species, the research supports the Agency’s Critical Path initiative. The research benefits the agency by providing methods that utilize resources for monitoring more efficiently. Additionally, it can serve as a model of an alternative more efficient approach for the development of all regulatory drug residue methods. The current approach to the development of drug residue methods is expensive, sometimes delays the approval of needed drugs, and does not provide efficient methods for enforcement. ACCOMPLISHMENTS Multiresidue Methods • Determination and Confirmation of Antibiotic Residues in Honey. The multi-class/multi-residue LC-MS/MS analytical method developed in 2007 for the determination and confirmation of 17 antibiotics in honey was made available to the public through its publication in the Journal of Agriculture and Food Chemistry in 2008. The method is being evaluated by the Florida Department of Agriculture and Consumer Protection. We received several inquiries from private and state laboratories interested in the potential use of the method at their facilities. CONTACT: Dr. Mayda López, 301-210-4587, mayda.lopez@fda.hhs.gov • Determination of Antibiotic Residues in Shrimp. A multi-class/multiresidue LC-MS/MS analytical method has been under development for the determination of 21 antibiotics (sulfonamides, quinolones, fluoroquinolones, tetracyclines, and cationic dyes) in shrimp at levels that might be monitored by a surveillance program, and/or regulated after approval of their MUMS status for use in shrimp. A generic extraction procedure has been developed to recovery all these drugs of widely different chemo-physical properties in reasonable yield from homogenized shrimp meat. An online-solid-phase-extraction system coupled to LC-MS/MS has been built to automate the sample clean-up step. Challenge remained in that the extent of matrix effect on the early-eluting analytes by HPLC varied significantly among shrimps from various sources. This is likely due to difference in composition and/or freshness of the meat. Merely using matrixmatched calibration can not always adequately correct for this so called “relative matrix effect” phenomenon. Therefore, in addition to controlling the condition of critical steps in shrimp extraction to reduce the variation of matrix content, a “standard addition” QC sample can be readily constituted and analyzed along with the unknown samples to determine whether the quantitative result is acceptable. Currently the method is being validated. CONTACT: Dr. Hui Li, 301-210-4271, hui.li@fda.hhs.gov Drug Residue Methods INTRODUCTION. The drug residue method development program addresses the needs of CVM's post-approval activities for analytical methods for drug residues in animal-derived foods. While drug sponsors are responsible for developing methods for new animal drugs, these methods are usually developed only for the requested use and will be for a specific species and target organ. Therefore, CVM must also develop analytical methods. For example, it was reported that antiviral drugs were being administered to poultry in China in an effort to control avian influenza. Due to concern that indiscriminate agricultural use of these compounds might lead to the development of resistant viral strains, CVM issued an Order of Prohibition banning the use of adamantanes and neuraminidase inhibitors in poultry. However, currently no analytical methods for these compounds are available in poultry tissues. The Agency’s Pandemic Preparedness Plan calls for the development of such methods. Another example is the extralabel use of animal drugs by veterinarians under certain conditions allowed under Animal Medicinal Drug Use Clarification Act (AMDUCA). To assure no residues remain, it is necessary to measure them; however, analytical methods may not be available for that extralabel use. Also, import products may contain residues of drugs not allowed for use in the United States. FDA and USDA-FSIS require regulatory methods that can detect and measure a broad range of drugs at very low concentrations, yet are rugged, fast, economical, and safe. Addressing these needs involves incorporating new cleanup, separation, and detection technologies into regulatory methods for drug residues. At the completion of method development, a standard operating procedure is prepared and methods are validated. DRC continues to place more emphasis on mass spectrometric methods due to their high degree of specificity, potential for high throughput, or ability to analyze multiple residues in a single procedure. The focus of the current compliance methods development is for enforcement methods developed in response to a specific need. For example, nitrofuran residues have been detected in products from Southeast Asia. When these drug residue problems were detected by other countries, the FDA did not have suitable methods for regulatory analysis. In response to the problem, DRC adapted and validated methods for these compounds to provide the Agency with acceptable methods for regulatory analysis. . IMPACT. Validated methods are critical to understanding and monitoring the safety of food products from animals. Needed enforcement methods allow the Agency to respond to emerging drug residue problems. ACCOMPLISHMENTS • Detection of antiviral drug residues in poultry products. This is a project continued from FY07. We, in a collaborative effort between CVM and the Central Science Laboratory of the U.K, are developing an LC-MS/MS method to enforce the prohibition of antiviral drug use in poultry. Our method target level is in the low µg kg-1 range (10 ppb or less). The analytes of interest are amantadine, rimantadine, oseltamivir phosphate (Tamiflu®), oseltamivir carboxylate (active metabolite of Tamiflu®), and zanamivir (Relenza®). These compounds have diverse chemistries, with the last two being highly hydrophilic zwitterions. We developed a provisional method employing hydrophilic interaction liquid chromatography and a generic acidified water and acetonitrile extraction of all five analytes from chicken tissue and eggs. The extracts are analyzed using a TurboIonSpray interface on a 4000 QTrap mass spectrometer. Detection limits are at or below 10 ppb for each compound. Chickens were dosed with each of the four drugs, and the provisional method tested on the incurred tissues and eggs. Chickens were also dosed with 14C-labelled rimantadine, to facilitate metabolite identification. Preliminary results show that hydroxy-rimantadine metabolites are produced, but do not persist longer that the parent drug. CONTACT: Dr. Mary Carson, 301-210-4652, mary.carson@fda.hhs.gov • Steroid Hormones in Beef Muscle. Steroid hormones are drugs effective in promoting weight gain and in improving feed efficiency in animals. In the United States, six steroid hormones (testosterone, progesterone, estradiol, trenbolone acetate, zeranol, and melengestrol acetate) are approved for use in beef cattle; however, the use of any steroid hormones in the European Union is strictly prohibited. Contamination of meat from animals treated with steroid hormones is a cause of concern for international trade. Conventional methods of determining hormone residues typically involve an initial hydrolysis of the phase II conjugates followed by derivatization and detection on gas chromatography-mass spectrometry. Information concerning the identity of the conjugates (glucuronides or sulfates), however, is lost after hydrolysis. Besides developing a multi-residue method for the determination of steroid hormones in beef muscle, DRC scientists are exploring new approaches of detecting and quantifying the intact phase II conjugates using liquid chromatography-tandem mass spectrometry. In addition, DRC scientists will examine the various metabolic pathways of hormones and attempt to characterize and identify unknown in vivo metabolites. CONTACT: Dr. Pak-Sin Chu, 301-210-4583, pak.chu@fda.hhs.gov Pharmacokinetics and Residue Depletion Tissue Fluid Correlations INTRODUCTION. Better testing methods are required to screen animals for drug residues at slaughter plants. One of the major problems with most current screening strategies for drug residues is the need to test on tissue samples that require processing before testing and are not available prior to slaughter. Appropriate testing of an easily obtained fluid would allow for better testing at the plant and could possibly allow antemortem testing. Penicillin continues to be one of the most important antibiotics used in food animal feedlots. There are ongoing concerns that the drug is being used in an unapproved manner. Although the tolerance for penicillin in swine is zero, the safe level, or negligible residue level, is 50 ppb. The determination of penicillin in tissues and biological fluids will provide information that will allow correlations to be established to allow surrogate fluids to be tested in order to determine if the concentration of the drug has depleted to an acceptable concentration in the tissue. IMPACT. Development of tissue fluid correlations allows more easily tested surrogate fluids to be used to identify animals which contain potentially unsafe drug residues and thereby facilitate increase testing and improved testing protocols. Utilization of pre-slaughter test kits can prevent the waste of animals which have simply been slaughtered too soon after the last injection of antibiotic. ACCOMPLISHMENTS • The first phase of the tissue fluid correlation study for penicillin in swine study has been completed. The purpose of the initial phase was to determine if anesthesia used on the animal would have any effect on the depletion of penicillin from the animal. The analytical methods were based on the methods developed for use in the development of tissue fluid correlations for steers. The methods were adapted and validated for use in swine tissue and fluid. CONTACT: Dr. Philip Kijak, 301-210-4589, philip.kijak@fda.hhs.gov Determination of NOEL for Melamine INTRODUCTION. In the 2007 pet food recall event, livestock feeds were found to be contaminated with melamine. Some of this occurred due to use of the contaminated wheat gluten, but addition of melamine or its analogues was apparently a quite common practice of Chinese feed manufacturers. During the recall, the USDA and FDA were faced with questions regarding the disposition of slaughtered hogs, chickens and fish that had consumed these products. Unfortunately, no depletion data existed on melamine or the related triazine, cyanuric acid. As a result, CVM OR scientists began a depletion study in catfish and trout in January 2008 to help regulators evaluate potential risks and propose withdrawal time if a batch of feed is determined to be contaminated with these triazines. OR scientists have also begun studies to determine a no observable effect level (NOEL) and threshold does for crystal formation after exposure to the combination of melamine and cyanuric acid. These studies are being conducted in fish and in pigs. IMPACT. Regulators will have information regarding depletion of melamine and cyanuric acid in a warmwater fish and a coldwater fish. ACCOMPLISHMENTS • The animal phase of the depletion study has been completed. Muscle samples have been provided to our collaborators at the Animal Drug Research Center in the FDA Denver District and preliminary data has been provided to the Agency. CVM OR chemists are validating a method to detect melamine and cyanuric acid in kidneys. This is needed because the matrix is different, especially in trout that normally have a large amount of melanin present in their kidneys. In addition, melamine-cyanurate crystals form in kidneys and are more difficult to get into solution. To date, the method has been validated in trout kidney. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov • The animal phase of the NOEL for combined dosing with melamine and cyanuric acid in catfish and trout has begun and preliminary data has been used to design experiments in pigs at OR and in rats at NCTR. The 1 day NOEL for catfish exposed to melamine and cyanuric acid is 10 mg/kg bw of each compound. The NOEL for 4 daily doses is 2.5 mg/kg bw. The NOEL for 14 day exposures has not yet been determined, but appears to be less than 2.5 mg/kg bw a dose comparable to 500 ppm of each compound in the feed. These findings provided target doses for use in mammalian experiments. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov Method Trials and Validation INTRODUCTION. CVM validates analytical methods for use in FDA-ORA field laboratories for compliance testing through a process known as a method trial. The purpose of the method trial is to establish that the method performs as claimed, that this performance is fit for the intended purpose, and that the technology transfer is successful. Residue methods test for violative residues of illegal residues of unapproved drugs. Violative residues may indicate improper drug use that could contribute to antibiotic resistance. Methods may be developed at CVM or submitted by other Federal or state regulatory laboratories for use as enforcement tools. These methods are validated through the non-NADA method trial program. IMPACT. The method trial program provides the FDA-ORA, USDA-FSIS, and others with regulatory methods that are suitable for the intended use with written procedures that are clear, complete, and free of ambiguity. The methods are used in support of regulatory programs, and the data generated using these methods can be used with confidence by the Center when undertaking regulatory actions. ACCOMPLISHMENTS • We coordinated with ORA to begin the evaluation of several methods including several of the OR multiresidue methods. We are working with the Animal Drug Research Center at the FDA Denver District to start a multi-laboratory trial of a method for malachite green and gentian violet in finfish. We have provided the shrimp multiresidue method to the Denver District Laboratory and are providing samples for a single laboratory validation of the method, and the finfish multiresidue method to the Southeast Regional Laboratory in Atlanta for an evaluation. CONTACT: Dr. Philip J. Kijak, 301-210-4589, philip.kijak@fda.hhs.gov Incursion Services INTRODUCTION. DAR continued providing tissues of fish dosed with a variety of drugs and chemicals to develop methods in several species of fish, including tilapia, Atlantic salmon, rainbow trout and channel catfish. These tissues are necessary to ensure that the methods work for some of the more complex matrices found in fish flesh. Incurred tissues are also used for method validation trials, conducted by multiple laboratories in collaboration with OR scientists. Considerable effort is put into maintaining a population of contaminant free fish which are essential for control tissues. In addition, DAR scientists provided tissues from fish treated with several dosages and varying depletion times. This year we provided tissues from 108 trout and 90 catfish for the melamine, cyanuric acid and combined exposure of melamine and cyanuric acid depletion study. The depletion times examined were 1, 3, 7, 14, 28 and 42 days post dosing. The information derived from this work has helped the Agency in its risk analysis for melamine and related analogues. IMAPCT. Developing methods for chemicals being used in foreign countries will help prevent contaminated food from entering the U.S. and also will help efforts to develop import tolerance levels of selected drugs. CONTACT: Dr. Renate Reimschuessel, 301-210-4024, renate.reimschuessel@fda.hhs.gov PulseNet INTRODUCTION. PulseNet, the national molecular subtyping network for food-borne disease surveillance, was established in 1996 through a collaborative effort of CDC, FDA, USDA, and state health departments. The program uses pulsed-field gel electrophoresis (PFGE) as the DNA “fingerprinting” method to identify the source of food-borne illness outbreak. In the past, PulseNet has focused on food-borne pathogens isolated from patients and foods because food-borne pathogen isolates from animals and foods were limited. In a collaboration with USDA, FoodNet, and FDA/ORA, DAFM researchers are obtaining isolates of Salmonella, Campylobacter and E. coli O157:H7 isolates from food animals, and their derived meats, as well as fresh produce, and animal feeds.. These isolates are subjected to susceptibility testing, serotyping and are subtyped by PFGE. The DNA fingerprinting patterns of the isolates are shared with PulseNet. IMPACT. CVM’s efforts as part of PulseNet focus on characterizing bacterial strains obtained from food-producing animals and retail meats. Data from these samples provide a critical link with the NARMS program (below). These PulseNet studies, along with research on resistance traits, will help us better understand the genetic diversity of Salmonella and Campylobacter, and the burden of illness caused by these pathogens from different sources. To date, CVM PulseNet database has more than 9,000 data entries, which include 5,703 Salmonella, 444 E. coli, 2,863 Campylobacter, 228 Bacillus and 69 Vibrio. ACCOMPLISHMENTS • In FY 2008, we have used PFGE to subtype 1,411 Salmonella, E. coli, and Campylobacter isolates recovered from food animals, retail meats and human by PFGE. All Salmonella and Campylobacter isolates were subtyped by PFGE using second enzyme. All PFGE patterns were submitted to CDC to help populate the national PulseNet database with information on strains from various sources. o 2008 PFGE data showed that multi-drug resistant Salmonella serotypes other than Typhimurium , Newport, Agona, Uganda, Dublin, and Heidelberg are emergent in the United States, with antimicrobial resistant clones spreading between animals and humans. o The new MDR clone that was observed in 2008 was S. Kentucky. The clone showed resistance to ten of 15 antimicrobials tested. The four isolates of this MDR clone were all isolated from chicken breast. o The PFGE results demonstrated that many multiple antibiotic resistant clones of Salmonella have spread in food animals, retail meats and infected humans. • We performed PFGE subtyping on bacterial pathogens not only from NARMS/FoodNet and veterinary diagnostic laboratories, but also from the ResistVet surveillance program in Mexico, as well as the USDA-AMS produce survey program. We also analyzed PFGE patterns of Salmonella from outbreaks, as well as those isolated from animal feeds. • We established a DNA fingerprinting databases for E. coli O157:H7. A new PFGE database is being developed for Vibrio and Bacillus. Databases are being shared with PulseNet at CDC and exchanged with all the PulseNet participants through the web board. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov Retail Meat Surveillance INTRODUCTION. The goal of this surveillance program is to provide data to the National Antimicrobial Resistance Monitoring System (NARMS) on the prevalence and extent of antimicrobial resistance in foodborne bacteria from retail chicken, turkey, pork, and beef products. Retail meat surveillance provides information on isolates at the consumer level by sampling retail meat products multiple states. In 2008, samples were collected in 10 FoodNet sites (CA, CO, CN, GA, MD, MN, NY, TN, OR, NM). Each site cultured meat samples for the presence of Salmonella and Campylobacter. In addition, three sites (GA, MD, OR, TN) tested samples for E. coli and Enterococcus. All participating laboratories use similar methods adapted from the FDA Bacteriological Analytical Manual and may receive additional training at the Office of Research. Isolates are sent to FDA/OR for confirmatory and additional testing. Since its inception in 2002, retail meat data has been gathered from over 25,000 meats AND over 15,000 bacterial isolates. From these bacteria, over 210,000 test results have been added to the NARMS database. IMPACT. Ongoing monitoring of retail meats is central to FDA programs designed to limit the spread of antimicrobial-resistant foodborne pathogens. This will help to provide information that is necessary to develop and implement science-based measures to prevent or reduce the transfer of resistant pathogens to humans via the food supply. ACCOMPLISHMENTS • In 2008, CVM/OR published the 2006 annual report of the NARMS retail meats surveillance, available at: http://www.fda.gov/cvm/2006NARMSAnnualRpt.htm. This website is updated as new information becomes available. Testing of isolates collected in 2007 is completed. The results should be posted on the CVM web site in the Spring of 2009 CONTACT: Emily Tong, 301-210-4762, Emily.tong@fda.hhs.gov • NARMS data showed that resistance to extended-specturm cephalosporins has spread to at least 17 Salmonella serovars. The typical MDR-AmpC phenotype which showed resistance to ACSSuT, plus resistance to amoxicillin/clavulanic acid, cefoxitin, and ceftiofur with decreased susceptibility to ceftriaxone (MIC >4ug/ml) apparent in serovars Agona, Uganda, Dublin, Enteritidis, Heidelberg, I.4,12:r:-, Kentucky, Newport, Saintpaul, Senftenberg and Typhimurium var. Copenhagen. CONTACT: Dr. Patrick McDermott, 301-210-4213, patrick.mcdermott@fda.hhs.gov • Salmonella enterica serovar Heidelberg frequently causes food-borne illness in humans. There are few data on the prevalence, antimicrobial susceptibility, and genetic diversity of Salmonella serovar Heidelberg isolates in retail meats. We compared the prevalences of Salmonella serovar Heidelberg in a sampling of 20,295 meats, including chicken breast (n = 5,075), ground turkey (n = 5,044), ground beef (n = 5,100), and pork chops (n = 5,076), collected during 2002 to 2006. Isolates were analyzed for antimicrobial susceptibility and compared genetically using pulsed-field gel electrophoresis (PFGE) and PCR for the bla(CMY) gene. A total of 298 Salmonella serovar Heidelberg isolates were recovered, representing 21.6% of all Salmonella serovars from retail meats. One hundred seventy-eight (59.7%) were from ground turkey, 110 (36.9%) were from chicken breast, and 10 (3.4%) were from pork chops; none was found in ground beef. One hundred ninety-eight isolates (66.4%) were resistant to at least one compound, and 49 (16.4%) were resistant to at least susceptible to ceftriaxone and ciprofloxacin. All ceftiofur-resistant strains carried blaCMY. PFGE using XbaI and BlnI showed that certain clones were widely dispersed in different types of meats and meat brands from different store chains in all five sampling years. These data indicate that Salmonella serovar Heidelberg is a common serovar in retail poultry meats and includes widespread clones of multidrug-resistant strains CONTACT: Dr. Patrick McDermott, 301-210-4213, patrick.mcdermott@fda.hhs.gov • Shiga toxin-producing E. coli (STEC) including E. coli O157:H7 is the most important group of diarrheagenic E. coli (DEC) and foods of animal origin have been implicated as vehicles of transmission in infection outbreaks. Non-O157 STEC also may be present in food and transmitted to humans. As NARMS program continues to collect E. coli from retail meats, we have collaborated with University Maryland to investigate the potential public health impact of pathogenic E. coli present in retail meats. A total of 7,259 Escherichia coli isolates from retail meats from 2002-2007 were screened for the presence of Shiga toxin genes and other virulence genes. Only 17 isolates (0.2%) were found positive for stx genes. Five of these isolates contained both stx1 and stx2, whereas two harbored stx1 only and 10 had stx2 only. Sixteen STEC isolates were recovered from ground beef and one isolate was recovered from pork chop. Using Immuno-agglutination assay to determine somatic antigen for O157, none of them belonged to O157 group. No STEC isolates were positive for eae, seven STEC isolates bore EHEC-hlyA. All except one STEC isolate exhibited toxic effects on Vero cells. Putative amino acid sequences based on DNA sequence analysis showed that stx2 from five isolates encoded mucus-activatable Stx2, which has been associated with severe human disease. Subtyping of the 17 STEC isolates by PFGE yielded 14 distinct patterns. This study demonstrated that although the prevalence was very low, retail meats, mainly beef products, were contaminated with heterogeneous STEC strains. CONTACT: Dr. Shaohua Zhao, 301-210-4472, shaohua.zhao@fda.hhs.gov ResistVet INTRODUCTION. ResistVet is a surveillance program for food-borne pathogens in Mexico. Using NARMS as a template, CVM has collaborated with Mexican public health officials to help establish a system for monitoring trends in antimicrobial resistance in isolates of Salmonella, E. coli and Campylobacter from humans (healthy and ill), food animals (poultry, swine) and retail meats (chicken, pork). IMPACT. The ResistVet program has provided data on the prevalence and antimicrobial resistance of food-borne isolates in Mexico. This information assists the FDA in better understanding how the situation in Mexico compares to that is the US, including the microbiological status of imported meats and animals from Mexico. ACCOMPLISHMENTS • In 2008, CVM/OR continued collaboration with Mexico’s ResistVet Surveillance Program by performing genetic analysis of Salmonella strains collected in their surveillance laboratories, including those associated with outbreaks. Isolates from retail foods, and healthy and ill people were assayed for antimicrobial susceptibility, analyzed for resistance gene content, and compared using pulsed field gel electrophoresis (PFGE) and plasmid typing. Data from the CVM/ResistVet collaboration showed how common strain types are present in Mexico and the U.S. In addition, the genetic basis of resistance to cephalosporins in isolates from Mexico is very similar to that in the U.S. CONTACT: Dr. Patrick McDermott, 301-210 4213, patrick.mcdermott@fda.hhs.gov BSE— Detecting Prohibited Substances INTRODUCTION. The 1997 Feed Ban enacted by the FDA has emerged as the principle firewall in the US effort to prevent the emergence of bovine spongiform encephalopathy (BSE) in U.S. cattle. When the FDA enacted this ban however, it did not have an analytical method that could detect these prohibited proteins in animal feeds and feed ingredients. CVM validated a PCR-based method for the detection of DNA derived from either swine, sheep, and goats, poultry, and horse, as well as a primer set capable of simultaneously detecting DNA derived from cattle, sheep, goats, deer, elk, horse, and swine. IMPACT. The PCR method using the bovine-specific primers was transferred to ORA laboratories and has been used for the analysis of regulatory samples. Subsequent work has focused on the development of real-time PCR (RT-PCR) based detection in an effort to further simplify this approach while increasing sample throughput. This will permit more timely analysis of potentially violative samples. ACCOMPLISHMENTS • A simplex RT-PCR-based assay successfully passed peer verification, using two state laboratories to conduct the verification. This method uses a new DNA extraction technique, which when coupled with RTPCR This method permits the detection of cattle, sheep or goat derived materials, which might be rendered in either the U.S. or from countries in the European Union (EU). The EU has more stringent rendering conditions which causes those materials to be more difficult to detect. We are currently developing a training course for ORA scientists prior to migrating this method to their laboratories. This new method will also be incorporated into the new field assignment from CVM for BSE testing. • A multiplex RT-PCR assay has been developed, using three sets of PCR primers and probes. One PCR-primer/probe combination detects just cattle derived materials, the second detects sheep and goat materials, and the third set detects materials derived from deer or elk. We have internally validated this method; the next step is to subject this method to peer verification. As the principle difference between the verified simplex RT-PCR and the multiplex RT-PCR is the PCR portion only, we will be able to have the same state laboratories verify this method using the samples from the previous verification trial. This effort is currently underway and should be completed by early summer 2009. Another area of research focuses on the development of an immunochemical test capable of detecting just bovine meat and bone meal. Using a novel approach to produce specific antisera, we have been able to generate two antiseras, each of which binds to a different region of the target protein. We are currently working to develop these two antisera into a functional immunochemical assay that would be used as a confirmatory method to samples found to be positive for bovine materials by either RT-PCR-based assays described above. This test would permit a laboratory to ascertain if their PCR positive result for bovine materials was due to the presence of bovine muscle (positive test result) or some other bovine protein (negative test result). Alternatively, this method could also be a stand-alone method for laboratories that are not able to conduct PCR-based assays CONTACT: Dr. Michael J. Myers, 301-210-4355, michael.myers@fda.hhs.gov Chemical Method Development INTRODUCTION. The increased production of ethanol for fuel has led to large amounts of distillers grains (DGs) becoming available for animal feed. They may be available wet, dried, or as the soluble fraction. Distillers grains are essentially the remainder of corn or other grains once the starch has been removed. DGs have significant nutritional content and their use as animal feed ingredients has become commonplace. However, some residual materials left over from the fermentation process provide concerns when DGs are fed to animals. Antibiotics are used to prevent unwanted bacterial growth in the fermentation process. In this case, the compounds are referred to as antimicrobial processing aids. Information as to which processing aids are used, if at all, may not be clear to the feed processor or livestock producer. Additionally, information on the fate of aflatoxin and other mycotoxins in the fermentation process is limited. The Office of Research is continuing to develop and apply new chemical methods to test DGs for antimicrobial or mycotoxin content, and provide better information on the types and amounts of contaminants that might be found. These methods rely on analysis by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Methods have been developed that combine generic extractions of animal feeds with sensitive LC-MS/MS surveillance for a wide range of compounds. IMPACT. The LC-MS/MS approach has allowed us to efficiently monitor for many suspect compounds in animal feed. The antibiotic method was used during the past year to provide surveillance information for CVM’s Office of Surveillance and Compliance. Analysis of the same DG field samples for mycotoxins is planned for the coming year. ACCOMPLISHMENTS • During the current phase of this multi-year method development project, a procedure was developed for extraction and analysis of thirteen antimicrobials in DGs. These compounds represent a range of chemical classes, including tetrayclines, beta-lactams, macrolides, ionophores, aminoglycosides, and amphenicols. The method is based on an initial solvent extraction followed by a two-track cleanup with (1) hydrophilic polymer solid phase extraction, or (2) weak cation exchange solid phase extraction. The final extracts are analyzed by ion trap LC-MS/MS. A standard operating procedure was written and validated by repetitive analysis of control and fortified samples. Furthermore, the method was challenged by analyzing samples collected from the field. CONTACT: (Antimicrobials in Distillers Grains) Dr. Hemakanthi de Alwis, 301-210-4581, hemakanthi.dealwis@fda.hhs.gov; • A preliminary method for mycotoxins was developed based on a “pass-though” solid phase extraction. This cleanup is acceptable for the analysis of Aflatoxins in dried distillers grains and in a corn reference material, but not fumonisins. A high percentage of the aflatoxin B1 was recovered. A corn-based standard reference material was measured within 10% of the stated value. • A new method for the analysis of multiple mycotoxins is being developed. Four different compounds were selected as representatives from about 20 compounds in three chemical classes of mycotoxins. An LC/MS/MS detection method has been completed for these compounds. The analysis combines ultrahigh pressure liquid chromatography (UPLC) with triple quadrupole mass spectrometry (MS/MS). Development of an extraction procedure is underway to extract all of the compounds at once with acceptable percent recoveries. Due to the range of chemistries involved, the final method will probably require two clean-up steps at different pH values. The target compound list includes the compounds specified in method needs statements by the Association of American Feed Control Officials (AAFCO). • Under the Surveillance Methods for Animal Feed, OR is participating in the Agency response to the finding of melamine in human milk products. The “dilute-and-shoot” LC-MS/MS method for melamine and cyanuric acid in animal feed (published in 2008) was modified to enable analyses in finfish kidney, muscle and plasma. The modified methods are being validated and will be applied to the analysis of tissues from dosed fish (trout, catfish) to gain insight into their depletion rates, and the possible formation of melamine-cyanurate crystals in kidney tubules. • The “dilute-and-shoot” method for melamine and cyanuric acid was adapted for use with powdered infant formula, in collaboration between the Office of Research, the FDA’s Denver District Laboratory, and the Denver Animal Drugs Research Center. CONTACT: Cristina Nochetto, 301-210-4184, cristina.nochetto@fda.hhs.gov. INTRODUCTION. Leveraging, in simplest terms, is working with others outside FDA in ways that will help the Agency meet its public health responsibilities. FDA has been quite successful with its past collaborations and the Agency intends to expand and build upon this solid foundation in developing new partnerships. IMPACT. Leveraging initiatives allow us to devote our scarce resources to those activities that we are uniquely qualified to perform. Such leveraging or cooperative ventures are not a means to shirk our responsibilities but a means to expand our capabilities by allowing us to use our intellect, time, money, and resources in a manner that maximizes their value. We should think of leveraging and other collaborative opportunities, not as last resorts, but as primary strategies for achieving our mission. We also have a long history of collaborating with the external scientific community on a more formal basis, through cooperative agreements, interagency agreements, memoranda of understanding, cooperative research and development agreements, and contracts. But we are now making this kind of leveraging central to our operations. By pooling our financial and intellectual assets we are able to achieve results greater than either organization could have achieved alone. In order for this to be successful, we must have a core of expertise within the Agency that is knowledgeable in the particular area in which we would like to collaborate, and internal activity in the area to serve as a springboard for getting more work done. Formal Activities • Interagency Agreement—CVM established an agreement with USDA/ARS for the purpose of monitoring animal origin Salmonella, E. coli, Campylobacter, and Enterococcus isolates to determine the frequency, characteristics and changes in susceptibility profiles present in these bacterial populations. • Interagency Agreement—CVM established an agreement with CDC to monitor human Salmonella, E. coli, Campylobacter and other bacterial isolates to determine the frequency, characteristics and trends of resistance determinants present in these bacterial populations. • Interagency Agreement—Funds were provided to CVM/OR by USDA’s Agricultural Marketing Service to characterize pathogenic microorganisms isolated in USDA’s Microbiological Data Program. Informal Activities • AOAC International—This collaborative effort involved the codevelopment and use of standardized test kit validation protocols for the evaluation of screening test systems for the detection of drug residues in fresh bulk tank milk samples. • ARS/USDA — The Division of Residue Chemistry collaborated with the Bee Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture in studies in developing analytical methodology to monitor for drug residues in support of the Minor Use Minor Species Health Act. The Bee Research Laboratory provided DRC with incurred honey samples required for the development of multiclass/multiresidue methods in honey. • European Union Community Reference Laboratories – CVM/OR provides quality assurance testing for national reference strains used in laboratory proficiency testing. • Florida Department of Agriculture and Consumer Services — Personnel of the Division of Residue Chemistry audited the validation data of a method for the analysis of fluoroquinolones in honey developed by the Chemical Residue Laboratories of the Florida Department of Agriculture and Consumer Services (FDACS). Recommendations were made to improve the method SOP. Data of the analysis of regulatory samples found positive by FDACS were reviewed by DRC personnel to corroborate the findings before regulatory actions were taken. • PulseNet—This collaborative effort was initiated by CDC and involves State Departments of Public Health and FDA. It is an epidemiological database focused on the acquisition and storage of DNA fingerprints generated by the procedure known as pulsed-field gel electrophoresis. This database represents a powerful epidemiological tool to conduct trace-back studies during outbreaks of food-borne illness. • Summer Student Intern Program—This is a special program for minority college students provides research experience in the biological and chemical sciences. • The Institute for Genomics Research (TIGR), CFSAN and USDA – This collaboration involves a cooperative effort to establish wholegenome DNA sequence data for 12 salmonella serovars. • University of Maryland—This informal collaboration involved the study of genetic mechanisms involved in antimicrobial resistance in salmonellae. • University of Maryland, College Park—This informal collaboration involved the examination of retail meats for the presence of methicillin-resistant Staphylococcus aureus. • University of Maryland School of Medicine, Department of Microbiology & Immunology —This ongoing collaboration, which included the FDA Center for Food Safety and Applied Nutrition (CFSAN), is focused on whole genome sequencing of salmonellae. • University of Minnesota – This informal collaboration involved the study of foodborne isolates of E. coli for traits associated with extraintestinal infections in humans. • USDA and CDC—Informal collaborative effort to characterize Salmonella and Campylobacter isolated from the National Antimicrobial Resistance Monitoring System (NARMS). • USDA – Informal collaboration to compare antimicrobial resistance in E. coli isolated from chickens and chicken meat. • USDA and CDC—Informal collaborative effort to characterize Salmonella Typhimurium isolated from the National Antimicrobial Resistance Monitoring System (NARMS). CONTACT FOR ALL ABOVE: Mr. Michael H. Thomas, 301-210-4650, michael.thomas@fda.hhs.gov Publications Aarestrup, F.M., McDermott, P.F., Wegener, H.C.. 2008. Transmission of antibiotic resistance from food animals to humans. In: Campylobacter. Nachamkin, I., Blaser, M. (eds.) American Society for Microbiology (ASM Press), Washington, DC. Andersen, W.C., S.B. Turnipseed, C.M. Karbiwnyk, S.B. Clark, M.R. Madson, C.M. Gieseker, R.A. Miller, N.G. Rummel, and R. Reimschuessel. 2008. Determination and confirmation of melamine residues in catfish, trout, tilapia, salmon, and shrimp by LC-MS-MS. Journal of Agricultural and Food Chemistry 56: 4340-4347 Boehmer, J.L., D.D. Bannerman, K. Shefcheck, and J.L.Ward. 2008. Proteomic analysis of differentially expressed proteins in bovine milk during experimentally induced Escherichia coli mastitis. Journal of Dairy Science 91: 1-13. Boerlin, P. and White, D.G. 2007. Antimicrobial drug resistance and its epidemiology. In: Antimicrobial Therapy in Veterinary Medicine, 4th edition. S. Giguere, J.F. Prescott, J.D. Baggot, R.D. Walker, and P.M. Dowling (Eds.). Blackwell Publishing, Professional, Ames, IA. Chu, P.S., Lopez, M.I., Abraham, A., El Said, K.R., Plakas, S.M. 2008. Residue Depletion of Nitrofuran Drugs and Their Tissue-Bound Metabolites in Channel Catfish (Ictalurus punctatus) after Oral Dosing. Journal of Agricultural and Food Chemistry 56: 8030-8034. Dobson, R. L. M., Motlagh, S., Quijano, M., Cambron, R. T., Baker, T. R. Pullen, A. M., Regg, B. T., Bigalow-Kern, A. S., Vennard, T, Fix, A., Reimschuessel, R. , Overmann, G., Shan, Y, Daston, G. P. Identification and characterization of toxicity of contaminants in pet food leading to an outbreak of renal toxicity in cats and dogs. Toxicological Sciences 106:251-262. 2008. Foley, S.L., Zhao, S. and Walker, R.D. 2007. Molecular typing methods for determining the source of Salmonella foodborne pathogens. Foodborne Pathogens and Disease 3: 253-276. Gieseker, C. M., Serfling, S. G., Poynton, S. L., Reimschuessel, R. 2007. Laboratory transmission of the monogenean Alcopenteron ureteroecetes infecting the posterior kidneys of largemouth bass: time course and pathology. Journal of Aquatic Animal Health. 19:141-150. 2007. Heller, D.N. and Nochetto, C.B. 2008. Simultaneous determination and confirmation of melamine and cyanuric acid in animal feed by zwitterionic hydrophilic interaction chromatography and tandem mass spectrometry. Rapid Communications in Mass Spectrometry. 22 : 3624-3632. Hong, Y., Liu, T., Lee, M.D., Hofacre, C.L., Maier, M., White, D.G., Ayers, S., Wang, L., Berghaus, R. and Maurer, J.J. 2008. Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiology 98:178. Kaldhone, P., Nayak, R., Lynne, A.M., David, D.E., McDermott, P.F., Logue, C.M. and Foley, S.L. 2008. Characterization of Salmonella enterica serovar Heidelberg from turkey-associated sources. Applied and Environmental Microbiology 74: 5038-5046. Lopez, M.I., Pettis, J.S., Smith, I.B., and Chu, P.S. 2008. Multiclass Determination and Confirmation of Antibiotic Residues in Honey Using LC-MS/MS. Journal of Agricultural and Food Chemistry. 56: 1553- 1559. Lynne, A. M., Rhodes-Clark, B. S., Bliven, K., Zhao, S., and Foley, S. L. 2008. Antimicrobial resistance genes associated with Salmonella enterica serovar Newport isolates from food animals. Antimicrobial Agents and Chemotherapy 52: 353-356. McDermott, P.F., McMurry, L.M., Podglajen, I., Dzink-Fox, J.L., Schneiders, T., Draper, M.P. and Levy, S.B. 2008. The marC gene of Escherichia coli is not involved in multiple antibiotic resistance. Antimicrobial Agents and Chemotherapy 52: 382-383. Parveen, S., M. Taabodi, T. Mohamed, J.P. Schwarz, T.P. Oscar, J. Harter-Dennis, and D.G. White. 2007. Prevalence and antimicrobial resistance of Salmonella spp. recovered from processed poultry. Journal of Food Protection. 70: 2466-2472. Reimschuessel, R., C. Gieseker, R.S. Miller, N. Rummel, J. Ward, J. Boehmer, D. Heller, C. Nochetto, H. De Alwis, N. Bataller, W. Andersen, S.B. Turnipseed, C.M. Karbinwnyk, R.D. Satzger, J. Crowe, M.K. Reinhard, J.F. Roberts, and M. Witkowski. 2008. Evaluation of the renal effects of experimental feeding of melamine and cyanuric acid to fish and pigs. American Journal of Veterinary Research 69: 1217- 1228. Reimschuessel, R. 2008. Assessing the human health implications of new drugs used in fish farming. In: Řyvind, Lie (ed), Improving farmed fish for the consumer. Woodhead publishing Limited, Cambridge England, pp 128-156. 2008. Rubin, J., Walker, R. D., Blickenstaff, K., Bodeis-Jones, S., and Zhao, S. 2008. Antimicrobial resistance and genetic characterization of fluoroquinolone resistance of Pseudomonas aeruginosa isolated from canine infections. Veterinary Microbiology 131:164-172. Rubin, J., Walker, R. D., Blickenstaff, K., Bodeis-Jones, S., and Zhao, S. 2008. Antimicrobial resistance and genetic characterization of fluoroquinolone resistance of Pseudomonas aeruginosa isolated from canine infections. Veterinary Microbiology 131:164-172. Rummel, N. and Shaikh, B. 2008. Determination of albendazole and its metabolites in the muscle tissue of hybrid striped and largemouth bass using liquid chromatography with fluorescence detection. Journal of the AOAC International 91: 469-477. Shaikh, B., N. Rummel, C. Gieseker, and R. Reimschuessel. 2007. Residue depletion of tritium-labeled ivermectin in reainbow trout following oral administration. Aquaculture 272: 192-198. Shaikh, B., Rummel, N., Gieseker, C., Serfling, S. and Reimschuessel, R. 2006. Metabolism and depletion of albendazole in the muscle tissue of channel catfish following oral treatment. Journal of Veterinary Pharmacology and Therapeutics 29: 525-530. Simjee, S., McDermott, P.F., White, D.G., Hofacre, C., Berghaus, R.D., Carter, P.J., Stewart, L., Liu, T., Maier, M. and Maurer, J.J. 2007. Antimicrobial susceptibility and distribution of antimicrobial resistance genes among Enterococcus and coagulase-negative Staphylococcus isolates recovered from poultry litter. Avian Diseases, vol. 51, 2007. In press. Vila, J., White, D.G., McDermott, P.F., and Levy, S.B. 2008. Bacterial resistance to antimicrobials. In Travelers’ Diarrhea, 2nd Edition. C.D. Ericsson, H.L. Dupont, and R. Steffen (Eds). BC Decker, Hamilton, Ontario, Canada. Welch, T.J., Florian Fricke, W., McDermott, P.F., White, D.G., Rosso, M-L., Rasko, D.A., Mammel, M.K., Eppinger, M., Rosovitz, M.J., Wagner, D., Rahalison, L., LeClerc, J.E., Hinshaw, J.M., Lindler, L.E., Cebula, T.A. and Carniel, E., Ravel, J. 2007. Multiple antimicrobial resistance in plague: An emerging public health risk. PLoS ONE 2(3): e309. Whichard, J.M., K. Gay, D.G. White, and Chiller, T.M. 2007. Surveillance for antimicrobial resistance among foodborne bacteria: the US approach. In: Infectious Disease Surveillance. N. M'ikanatha, R. Lynfield, C. Van Beneden, H. DeValk (Eds.). Blackwell Publishing Professional, Ames, IA. White, D.G. 2008. Laboratory methodologies for bacterial antimicrobial susceptibility testing. Chapter 1.1.10. OIE Manual of Standards for Diagnostic Tests and Vaccines. 6th Edition. Office International des Epizooties, Paris, France. Xi, M., Zheng, J., Zhao, S., Brown, E.W. and Meng, J. 2008. An enhanced discriminatory PFGE scheme for subtyping Salmonella serotypes Heidelberg, Kentucky, Saintpaul, and Hadar. Journal of Food Protection 71: 2067-2072. Yancy, H.F., T.S. Zemlak, J.A. Mason, J.D. Washington, B.J. Tenge, N.T. Nguyen, J.D. Barnett, W.E. Savary, W.E. Hill, M.M. Moore, F.S. Fry, S.C. Randolph, P.L. Rogers, and P.N. Herbert. 2008. The potential use of DNA barcodes in regulatory science: Applications of the regulatory fish encyclopedia. Journal of Food Protection 71: 210- 217. Yancy, H.F., Semlak, T.S., Mason, H.A., Washington, J.D., Tenge, B.J., Nguyen, N.T., Barnett, J.D., Savary, W.E., Hill, W.E., Moore, M.M., Fry, F.S., Randolph, S.C., Rogers, P.L., and Hebert, P.N. 2007. The potential use of DNA barcodes in regulatory science: Applications of the Regulatory Fish Encyclopedia. Journal of Food Protection. In press. Yang , B., Zheng, J., Brown, E.W. Zhao, S., and Meng, J. 2008. Characterization of antimicrobial resistance associated integrons and mismatch-repair mutation in Salmonella serovars. International Journal of Antimicrobial Agents 33: 120-4 Zaidi, M. B., Leon, V., Canche, C., Perez, C., Zhao, S., Hubert, S. K., Abbott, J., Blickenstaff, K., and McDermott, P. F. 2008. Rapid and widespread dissemination of multidrug-resistant blaCMY-2 Salmonella Typhimurium in Mexico. Journal of Antimicrobial Chemotherapy 60: 398-401. Zaidi, M. B., Calva, J. J., Estrada-Garcia, M. T., Leon, V., Vazquez, G., Figueroa, G., Lopez, J. Contreras, E., Abbott, J., Zhao, S., McDermott, P. F., and Tollefson, L. 2008. An integrated food chain surveillance system for Salmonella in Mexico: A model for developing countries. Emerging Infectious Diseases 14: 429-435. Zhao, S. 2008. Antimicrobial-Resistant Foodborne Pathogens in Imported Food. In: Emerging issues in Food Safety: Imported Foods Microbiological Issues and Challenges. (Edited by M.P. Doyle and M.C. Erickson). American Society for Microbiology, Washington, DC. Zhao, S., White, D.G., Friedman, S.L., Glenn, A., Blickenstaff, K., Ayers, S.L., Abbott, J.W., Hall-Robinson, E., and McDermott, P.F. 2008. Antimicrobial resistance in Salmonella enterica serovar Heidelberg from retail meat, including poultry, from 2002-2006. Applied and Environmental Microbiology 74: 6656-6662. Zhao, S. 2008. Antimicrobial-Resistant Foodborne Pathogens in Imported Food. In: Emerging issues in Food Safety: Imported Foods Microbiological Issues and Challenges. (M.P. Doyle and M.C. Erickson, Eds.). American Society for Microbiology, Washington, DC. Zhao, S., McDermott, P.F., White, D.G., Qaiyumi, S., Friedman, S.L., Abbott, J.W., Glenn, A., Ayers, S.L., Post, K.W., Fales, W.H., Wilson, R.B., Reggiardo, C., Walker, R.D. 2007. Characterization of multidrug resistant Salmonella recovered from diseased animals. Veterinary Microbiology 123: 122-32. Zheng, J., Cui, S., Teel, L., Zhao, S., Singh, R., O’Brien, A. and Meng, J. 2008. Identification and characterization of shiga toxin type 2 variants in Escherichia coli isolated from animals, food, and humans. Applied and Environmental Microbiology 74: 5645-5652. Zheng, J., Keys, C. E., Zhao, S., Meng, J., and. Brown, E. W 2007. An enhanced discriminatory scheme for PFGE-based subtyping of Salmonella Enteritidis. Emerging Infectious Diseases 13: 1932-1935. Zheng, J., Meng, J., Zhao, S., Singh, R,. Ge, A., Fox, J.G. and Song, W. 2008. Campylobacter-induced interleukin-8 secretion in polarized human intestinal epithelial cells requires Campylobacter-secreted CDT and TLR-mediated activation of NF-kB. Infection and Immunity 76: 4498-4508. Outside Reports Aarestrup, F.M., McDermott, P.F. Methods for testing Salmonella and Campylobacter. National Food Institute, Technical University of Denmark, Newsletter to the National Reference Laboratories for Antimicrobial Resistance. No. 2, November 2007. Aarestrup, F.M., McDermott, P.F., Kahlmeter, G. Antimicrobial susceptibility testing: clinical break points and epidemiological cut-off values. National Food Institute, Technical University of Denmark, Newsletter to the National Reference Laboratories for Antimicrobial Resistance. No. 2, November 2007. Presentations Andersen, W. C., Turnipseed, S. B., Karbiwnyk, C.M., Clark, S. B., Madson, M. R., Gieseker, C. M., Miller, R. A., Rummel, N. G., and Reimschuessel, R. Analysis of melamine residues in catfish, trout, tilapia, salmon and shrimp – Determination and confirmation by LCMS- MS. Euroresidue VI Egmond aan Zee, Netherlands. May 2008 De Alwis, G. K. H. and Heller D.N., “Development of an Automated SPE Method for Cyanuric Acid in Animal Feed for Highly-sensitive Detection by HPLC-MS/MS”, Poster presentation, AOAC International Annual Meeting and Exposition, Dallas, TX, September 2008 De Alwis, G. K. H. and Heller D.N., “Development of an HPLCMS/ MS method for the determination of antibiotic residues in distiller’s grain”, Poster presentation, AOAC International Annual Meeting and Exposition, Dallas, TX, September 2008 Harbottle, H. CVM: Challenges to future genomics regulatory and scientific activities. FDA Science Symposium on Genomics. FDA, Silver Spring, MD. June, 2008. Harbottle, H. CVM: Molecular characterization of foodborne pathogens. Food Protection Plan Meeting, FDA Center for Veterinary Medicine, Laurel, MD. September, 2008. Harbottle, H., Thakur, S., Vaughn, B., Kroft, B., Gebreyes, W., White, D.G., McDermott, P.F., and Zhao, S. The development of a validated DNA microarray for characterization of Salmonella enterica and Campylobacter from retail meats. Abstracts of the 108th General Meeting of the American Society for Microbiology, Boston, MA. June, 2008. Heller, D.N. and Lopez, M. “A Study of the Matrix Enhancement of Streptomycin's Electrospray LC/MS Response in Honey Extracts,” 56th ASMS Conference on Mass Spectrometry, Denver, CO, June, 2008 Jackson, S.A.,. Harbottle, H.C., Mammel, M.K., Patel, I.R., Barnaba, T.J., Ayers, S.L., Zhao, S., Cebula, T. A., and LeClerc, J.E. Characterization of Salmonella enterica serotypes using a novel high density 85-genome microarray and antimicrobial susceptibility testing. Microbial Genomes Conference, Lake Arrowhead, CA. September, 2008. Karbiwnyk, C.M., Andersen, W. C., Turnipseed, S. B., Storey, J.M, Madson, M. R., Gieseker, C. M., Miller, R. A., Rummel, N. G., and Reimschuessel, R. Determination of cyanuric acid residues in fish and shrimp tissues by LC/MS/MS. Euroresidue VI Egmond aan Zee, Netherlands. May, 2008. Kijak, P.J. “Fit for Purpose: Method Validation Strategies US Perspective” CSL / JIFSAN Joint Symposium on Food Safety and Nutrition, York, UK, June 2008. McDermott, P.F. Antimicrobial resistance in Campylobacter from retail meats in the United States, 2002-2007. Second Workshop on Campylobacter Isolation and Identification from Foods. Auburn University, Auburn AL, May, 2008 McDermott, P.F. Antimicrobial resistance in Campylobacter from animals, foods and humans in the U.S. American Society for Microbiology Conference on Antimicrobial Resistance in Zoonotic Bacteria and Foodborne Pathogens. Copenhagen, Denmark. June, 2008. McDermott, P.F. The challenge of multi-drug resistant (MDR) foodborne Gram-negative pathogens. 2008 Annual Conference on Antimicrobial Resistance, National Foundation for Infectious Diseases, Bethesda, MD. June, 2008. McDermott, P.F. Monitoring antimicrobial resistance in foodborne pathogens: Lessons from the National Antimicrobial Resistance Monitoring System. National Institutes of Health, Program Conference on Food and Waterborne Diseases, Calloway Gardens, GA. July 2008. McDermott, P.F. Research in antimicrobial resistance monitoring in foodborne pathogens. Abstracts of the 145th Annual Convention of the American Veterinary Medical Association. New Orleans, LA. July, 2008. McDermott, P.F. Antimicrobial resistance in foodborne pathogens. Food Safety Challenges and Detection Technologies, Northwest A&F University, Xian China, September, 2008. McDermott, P.F. Monitoring antimicrobial resistance in foodborne bacteria in the U.S. Food Safety Challenges and Detection Technologies, Northwest A&F University, Xian Chin, September, 2008. McDermott, P.F. National surveillance of antimicrobial resistance in foodborne bacteria in the U.S. China International Food Safety and Quality Conference and Expo, Beijing China, September, 2008. Mohamed, T., Parveen, S., White, D. G., Zhao, S., Freidman, S. and Blickenstaff. K. Molecular characterization of antibiotic resistant Salmonella Typhimurium and Salmonella Kentucky recovered from pre- and post-chill whole broiler carcasses. The 95th Annual Meeting of International Association for Food Protection. Columbus, OH. August, 2008. Reimschuessel, R., Gieseker, C., Miller, R.A., Rummel, N., Heller, D., Nochetto, C., De Alwis , H., Andersen, W., Karbiwnyk, C. M. Turnipseed. S., Satzger, R D., Crowe, J. Witkowski, M., Melamine in combination with Cyanuric Acid Induces Renal Crystal Formation in Fish. Aquaculture 2008, Lake Buena Vista, Florida, February 2008. Reimschuessel, R., Andersen, W., Turnipseed. S., Karbiwnyk, C., Madson, M.R., Schwartz, M.H., Gieseker, C., Miller, R.A., Rummel, N. Melamine residue determination in trout, tilapia, salmon and shrimpusing liquid chromatography tandem mass spectrometry. Aquaculture 2008, Lake Buena Vista, Florida, February 2008. Reimschuessel, R., Karbiwnyk, C. Andersen, W., Turnipseed. S., Storey, J.M., Madson, M.R., Gieseker, C., Miller, R.A., Rummel, N. Determination of Cyanuric Acid Residue in Fish Tissue by LC-MS-MS. Aquaculture 2008, Lake Buena Vista, Florida, February 2008. Shaikh, B., Rummel, N., Gieseker, C., Cheely, C.S. and Reimschuessel, R. Total radioactive residue depletion of tritium labeled ivermectin in finfish. Euroresidue Egmond aan Zee, Netherlands. May 2008 Shaikh, B.; Rummel, N.; Gieseker, C.; Christie-Sue Cheely, C.-S. and Reimschuessel, R. “Total radioactive residue depletion of tritium labeled ivermectin in finfish.” EuroResidue VI Conference on Residues of Veterinary Drugs, Egmond aan See, Netherlands. May 2008 Smith, M.; Smith, S.; Carson, M.C.; Tarbin, J. and Sharman, M. “Development of a Method to Detect Antiviral Drug Residues in Poultry” Presentation at EuroResidue VI, Egmond aan See, Netherlands. May 2008 Thakur, S., White, D.G., McDermott, P.F., Zhao, S., Abbott, J., English, L., Carter, P., Gebreyes, W. and Harbottle, H. Antimicrobial resistance, virulence and genotypic profiling of Campylobacter jejuni and Campylobacter coli isolated from humans and retail meats. International Association for Food Protection in Columbus, OH, August 2008. Wagenaar, J., R. Hendriksen, M. van Bergen, M. Mikoleit, Lai-King Ng, N. Binsztein, A. Aidara-Kane, S. Zhao, S. Karlsmose, N. Maxwell. WHO Global Salm-Surv: laboratory-based surveillance, outbreak response and antimicrobial resistance testing of foodborne pathogens. ASM Conference on Antimicrobial Resistance in Zoonotic Bacteria and Foodborne Pathogens. Copenhagen, Denmark, June, 2008. Wekell, M. “Melamine/Cyuranic Acid Response” CSL / JIFSAN Joint Symposium on Food Safety and Nutrition, York, UK, June, 2008. Wekell, M.M., Gieseker C.M., Miller R.A., Ward, J., Boehmer, J., Rummel, N.G., Heller, D.N., Nocetto, C., De Alwis, H., Andersen, W., Karbiwnyk, C.M., Turnipseed, S.R., Satzger, R D., Crowe, J.B., Witkowski, M.R., Reimschuessel, R. The Melamine Story. UJNR Aquaculture Panel Japan, November, 2007 Xia, X., Smith, A., Zhao, S., McEvoy, J., Meng, J., Bhagwat, A.A. Characterization of Salmonella isolates from retail foods for biofilm formation, inducible acid-tolerance and Caco-2 cell infectivity. 108th ASM Annual Meeting, Boston, MA. June, 2008. Zhao, S. “Resistance to 3rd Generation Cephalosporins in Salmonella from NARMS Retail Meats Studies”. 95th IAFP Annual Meeting. Colunbus, OH. August, 2008. Zhao, S. “Characterization of Resistance to 3rd Generation Cephalosporins in Salmonella from NARMS Retail Meats Studies” at the FDA Critical Path Initiative on the move Complexities and Challenges. Bethesda, MD. September, 2008 Zhao, S. “Characterization of Salmonella Isolated from NARMS Program” at the Symposium of Rapid Detection Technologies and Application for Food and Protection. Laurel, MD. September. 2008. Zhao, S. The U.S. NARMS retail meat program and antimicrobial resistance in non-typhoidal Salmonella. US Instructor, WHO-Global Salm Surv International Training Course, Program for Enhanced Salmonella Surveillance Projects, Guilin, China, November, 2007. Zhao, S. “Characterization of resistance to 3rd generation cephalosporins in Salmonella from NARMS retail meat studies”. FDA Critical Path Initiative on the Move: Complexities and Challenges. Bethesda, MD. September, 2008. Zhao, S., Glenn, A., Friedman, S.L., Abbott, J.W., Ayers, S., Hall- Robinson, E., White, D.G., and McDermott, P.F. Prevalence and antimicrobial resistance of Salmonella isolated from retail meat: National Antimicrobial Resistance Monitoring System (NARMS): 2002–2006. The 95th Annual Meeting of the International Association for Food Protection. Columbus, OH. August, 2008. Zhao, S., Glenn, A., Friedman, S.L., Abbott, J.W., Ayers, S., Hall- Robinson, E., White, D.G., and McDermott, P.F. Salmonella enterica serovar Heidelberg from retail meats: Results of the National Antimicrobial Resistance Monitoring System (NARMS): 2002-2006. The 12th Annual PulseNet Update Meeting, St. Louis, MO. April, 2008. Zheng, J., Keys, C.E., Ramaseshan, A., Zhao, S., Meng, J., Brown, E.W. Simultaneous Analysis of Multiple Enzymes Sharply Increases the Accuracy of PFGE in Assigning Genetic Relationships among Homogeneous Salmonella Strains. 108th ASM Annual Meeting, Boston, MA. June 1-5, 2008. Zheng, J., Keys, C.E., Ramaseshan, A., Zhao, S., Meng, J., Brown, E.W. Simultaneous Analysis of Multiple Enzymes Sharply Increases the Accuracy of PFGE in Assigning Genetic Relationships among Homogeneous Salmonella Strains. 108th ASM Annual Meeting, Boston, MA. June 1-5, 2008. Zhao, S., Blickenstaff, K., Glenn, A., Ayers, S.L., Friedman, S.L., Abbott, J.W., Hall-Robinson, E., White, D.G., and McDermott, P.F. Characterization of Ampicillin Resistance of Salmonella Isolated from National Antimicrobial Resistance Monitoring System (NARMS) Retail Meats in 2002-2006. Abstracts of the 48th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) and the Infectious Diseases Society of America (IDSA) 46th Annual Meeting. Washington DC October 25-28, 2008. Professional Service Office of Research staff served on professional, international, government, Agency and Center committees in FY08. Pak Chu – CVM Aquaculture Project Advisory Subgroup, Office of Research Computer Committee, Institutional Animal Care and Use Committee, Committee for the Advancement of FDA Science. Ad hoc reviewer for the Journal of Chromatography B, Journal of the AOAC International, and Journal of Agriculture and Food Chemistry. Mary Carson - Member, Official Methods Board, AOAC International; Chair, Methods Committee for Drugs and Related Topics, AOAC International; CVM Aquaculture Project Advisory Subgroup; Member, Scientific Committee for EuroResidue VI Guest Editor for the Journal of AOAC International; ad hoc reviewer for the Journal of AOAC International and the Journal of Food Protection. David N. Heller – ad hoc reviewer for Analytical Chemistry, Journal of Chromatography B, Journal of the AOAC International, Journal of Agricultural and Food Chemistry, and Rapid Communications in Mass Spectrometry Heather Harbottle – Member, Microarray Quality Control Project Committee (MAQC); Member, CVM Staff College Scientific Steering Committee; Member, Search Committee for CVM Staff College Scientific Education Specialist; Member, Genomics Committee for FDA Science Series; Member, Committee for the Advancement of FDA Science; Member, Critical Path Steering Committee; Reviewer for Foodborne Pathogens and Disease; Editorial Board, The Open Agriculture Journal, CVM Deputy CFC Coordinator 2007 Philip J. Kijak - Member FDA Milk Steering Committee; Member, U.S. Delegation Codex Committee on Residues of Veterinary Drugs in Food; Member, Interagency Residue Control Group ad hoc reviewer for the Journal of AOAC International. Hui Li – ad hoc reviewer for Analytical Chemistry Jamie Boehmer- Reviewer for Analytical Chemistry and The Journal of Dairy Science. Mayda López – ad hoc reviewer for Apidiologie, J. Separation Science, Journal of Apicultural Research, and J. Agriculture and Food Chemistry Michael Myers - Reviewer, Journal of Food Protection, Journal of Agriculture and Food Chemistry, Drug Metabolism Letters, American Journal of Veterinary Research, Pakistan Journal of Scientific and Industrial Research Patrick McDermott –Reviewer, FDA Office of Women’s Health, FY 2008 intramural research projects; Pharmaceuticals in the Environment Workgroup, National Science and Technology Council (NSTC) Committee on Environment and Natural Resources (CENR), Antimicrobial Resistance Subcommittee; Member, Science Advisory Board, National Center for Toxicological Research, Division of Microbiology; Member, Research Peer Review Committee for Research Scientists, CVM.; Member, Research Peer Review Committee for Research Scientists, NCTR; Co-convener, Microbial Resistance in Enteric Pathogens: Clinical and Therapeutical Implications, the 47th Interscience Conference on Antimicrobial Agents and Chemotherapy, Chicago IL; Member; Planning Committee for the 2008 International Conference on Emerging Infectious Diseases, CDC Atlanta, GA; CVM Delegate, Clinical and Laboratory Standards Institute subcommittee on Veterinary Antimicrobial Susceptibility Testing (CLSI/VAST); Editorial Board, Journal of Food Protection; Member, Steering Committee, World Health Organization Global Salmonella Surveillance (WHO Global Salm-Surv) program. Renate Reimschuessel - Editorial Board: The Journal of Veterinary Pharmacology and Therapeutics, Joint Section Editor: Toxicologic Pathology; FDA Aquaculture Subgroup-Seafood Research Task Force; CVM Aquaculture Coordinating Committee; United States Joint Subcommittee on Aquaculture and JSA Aquaculture Effluents Task Force Member; (co-chair of the National Aquaculture Drug Research Forum, a subgroup of the Joint Subcommittee on Aquaculture (JSA) Working Group for Quality Assurance in Aquaculture Production (WGQAAP)); Technical Subgroup Member: Drugs and Chemicals; site reviewer: “Fish Health in the Chesapeake Bay” Maryland Sea Grant. http://www.mdsg.umd.edu/fishhealth/index.html Badar Shaikh – FDA/CFSAN Radiation Safety Committee; CVM Master Review Committee; Ad hoc reviewer for Journal of Chromatography B, Journal of the AOAC International, and Journal of Agriculture and Food Chemistry David White - Member, Antimicrobial Resistance Steering Committee, U.S. FDA; Member, U.S. Interagency Task Force on Antimicrobial Resistance; U.S. Delegate, ad hoc Intergovernmental Task Force on Antimicrobial Resistance, Codex Alimentarius; Editorial Board, Veterinary Microbiology; Editorial Board, Foodborne Pathogens and Disease; Editorial Board, Antimicrobial Agents and Chemotherapy; Panel member, NIH, Drug Discovery and Mechanisms of Antimicrobial Resistance Study Section; Panel member, CDC, Special Emphasis Panel on Antimicrobial Resistance. Atlanta, GA; Panel member, Department of Defense, Peer Reviewed Medical Research Program, Antimicrobial Resistance/Neurotoxicity of Mefloquine, Chantilly, VA. Shaohua Zhao – Adjunct Faculty, University of Maryland; Member, Laboratory subcommittee, World Health Organization Global Salm- Surv; Member, International Association of Food Protection; Member, Food Safety Education Professional Development Group; Member, Interagency FoodNet Attributions WG; Member of Western Center for Food Safety (WCFS) FDA Advisory Board; Member, American Society for Microbiology; Ad hoc reviewer for Journal of Antimicrobial Chemotherapy, Antimicrobial Agents and Chemotherapy, Journal of Clinical Microbiology; FEMS Microbiology Letters; Epidemiology and Infection; Veterinary Microbiology; Journal of Food Protection; Journal of Veterinary Medicine; Applied Microbiology; Journal of Animal Science; Food Additives and Contaminants Renate Reimschuessel – Editorial Board: The Journal of Veterinary Pharmacology and Therapeutics, Joint Section Editor: Toxicologic Pathology; FDA Aquaculture Subgroup-Seafood Research Task Force; CVM Aquaculture Coordinating Committee; United States Joint Subcommittee on Aquaculture and JSA Aquaculture Effluents Task Force Member; (co-chair of the National Aquaculture Drug Research Forum, a subgroup of the Joint Subcommittee on Aquaculture (JSA) Working Group for Quality Assurance in Aquaculture Production (WGQAAP)); Technical Subgroup Member: Drugs and Chemicals; site reviewer: “Fish Health in the Chesapeake Bay” Maryland Sea Grant. Http://www.mdsg.umd.edu/fishhealth/index.html Audio Visual Productions Reimschuessel, R., Stewart, L., Squibb, E., Hirokawa, K., Brady, T., Brooks, B., Shaikh, B. and Hodsdon, C. Phish-Pharm – 2008 update http://www.fda.gov/cvm/addaquainfo.htm Interns and Visiting Scientists College-Level Interns, Graduate Students and Postdoctoral Scientists: Denisse Aybar, Purdue University Mentor: Mayda Lopez Shonette Grant, Claflin University Mentor: Michael Myers Erinna Kinney, University of Maryland, College Park Mentor: Linda English Fabio Le Neve, University of Torino Mentor: Michael Myers Tamara Mayer, University of Miami Mentor: Renate Reimschuessel Haley F. Oliver, Cornell University Mentor: Haile Yancy Heidi L. Swaim, St. Mary's College Mentor: Michael Myers Daniel Tadesse, Ohio State University Mentor: Heather Harbottle Other Events and Activities Awards: Renate Reimschuessel, 2008 Service to America Awards finalist. For her work during the pet Food Recall of 2007 – Achievement: Made the scientific breakthrough to identify the cause of the largest pet food recall in history and is currently conducting critical research to guarantee the safety of imported foods. Shaohua Zhao Excellence in Laboratory Science: FDA Scientific Achievement Award – for exceptional and outstanding contributions to protecting public heath through CVM’s food safety surveillance, research and training programs. Michelle L. Smith Outstanding Support Scientist: CVM Scientific Achievement Award – for outstanding contributions supporting method development for contaminants in animal feed and antiviral drugs in poultry tissue; and sample analysis supporting tissue fluid correlation studies. Cristina B. Nochetto CVM Excellence in Mentoring Award: for ongoing and continuous excellence in the professional development of fellow employees. O.J. Cartwright CVM Administrative Excellence Award: for the ongoing and continuous excellence in management of the QA/QC Program for CVM/OR and for guidance in developing a program for the agency. David N. Heller CVM Communications Excellence Award: for continued excellence in communicating complex scientific information to both technical and general audiences. Group Awards: Commissioner’s Special Citation: Adulterated Protein Investigations, Analysis, Planning, Scientific Review and Emergency Response Team (Office of Regulatory Affairs) Charles M. Gieseker, David N. Heller, Philip J. Kijak, Cristina B. Nochetto, Renate Reimschuessel, Nathan G. Rummel, and Marleen M. Wekell – for exemplary performance to protect the public health from adulterated protein through actions of investigations, sample analyses, method development, assignment planning, emergency response, scientific review and risk assessment. Outstanding Service Award: CVM Office of Research Institutional Animal Care and Use Committee – Jamie Boehmer, Bruce Bradley, Pak Chu, Patrick McDermott, Michael Myers and Jeff Ward – for sustained outstanding performance and oversight of the animal research program at CVM’s Office of Research. Group Recognition Award: CVM National Antimicrobial Resistance Monitoring System (NARMS) Team – Jason Abbott, Sherry Ayers, Karen Blickenstaff, Sonya Bodies-Jones, Peggy Carter, Linda English, Sharon Friedman, Stuart Gaines, Althea Glenn, Heather Harbottle, Beth Karp, Patrick McDermott, Shawn McDermott, Sadaf Qaiyumi, David White and Shaohua Zhao – for sustained excellence in monitoring antibiotic resistance in foodborne pathogens from retail meats to better assure the safety of the U.S. food supply. Group Recognition Award: Pet food and Animal Feed Contaminant Response Group (Office of the Commissioner) – David N. Heller, Philip J. Kijak, Cristina B. Nochetto, Renate Reimschuessel, Jeffrey L. Ward, and Marleen M. Wekell – for superior performance in response to the contamination of pet food and animal feed products. Outstanding Inter-center Scientific Collaboration: Tissue Method Development and Implementation Working Group (Office of Regulatory Affairs) Charles M. Gieseker, David N. Heller, Philip J. Kijak, Cristina B. Nochetto, Renate Reimschuessel, Nathan G. Rummel, and Marleen M. Wekell – For extraordinary contribution to rapidly developing melamine test methodologies in seafood, studying melamine accumulation in fish and implementing a seafood testing program for melamine contamination. OR Study 325.15 Title: Establishing Culture Conditions for Multiple Fish Species at OR Study Director: Renate Reimschuessel Abstract: The purpose of this study was to renovate CVM’s Aquaculture Facility, to make it a state-of-the-art facility for multiple fish species. Initial tests indicated that copper water lines in the existing facility leached copper into system water at levels that are toxic to salmonids and young life stages of other fish species. Since there are also sub-lethal effects on fish health, CVM decided to remove all copper pipes from the facility. In addition, recirculation systems, holding systems, chemical exposure systems, infectious studies areas, radioactive chemical study room and necropsy laboratory rooms needed to be constructed and equipped. The first fish (large mouth bass) were introduced into systems in fall 1999, and additional species were obtained as appropriate husbandry systems were constructed. This report provides a short synopsis of the condition of the facility and the renovations conducted between 1999 and 2004. OR Study 401.17 Title: Incurred Erythromycin A in Salmon Study Director: Renate Reimschuessel Abstract: The purpose of this study was to renovate CVM’s Aquaculture Facility, to make it a state-of-the-art facility for multiple fish species. Initial tests indicated that copper water lines in the existing facility leached copper into system water at levels that are toxic to salmonids and young life stages of other fish species. Since there are also sub-lethal effects on fish health, CVM decided to remove all copper pipes from the facility. In addition, recirculation systems, holding systems, chemical exposure systems, infectious studies areas, radioactive chemical study room and necropsy laboratory rooms needed to be constructed and equipped. The first fish (large mouth bass) were introduced into systems in fall 1999, and additional species were obtained as appropriate husbandry systems were constructed. This report provides a short synopsis of the condition of the facility and the renovations conducted between 1999 and 2004. Atlantic salmon (Salmo salar) were exposed to erythromycin A or erythromycin thiocyanate to obtain incurred samples to bridge microbiological methods to detect erythromycin (ERY) with chemical detection methods. Incurred tissues were requested by HFV-150 at 3 levels, 0.05, 0.1, and 0.2 ppm. Fish were dosed with 5, 10, 20, 50, and 100 mg/kg. The dosage regime and withdrawal times were varied to get the desired concentration in the final tissue. Control fish were sampled from the holding tanks. Two studies were conducted to bridge methods. Bridging Study I: The frozen filets were homogenized, the target concentration analyzed, and then incurred tissues were blended with control tissue to achieve the desired final concentrations. The 20 and 50 mg/kg doses corresponded to 0.8 and 2.5 ppm ERY, respectively by HPLC. The 20 mg/kg incurred tissue was diluted 1:16, 1:8, and 1:4 with control tissue to achieve the corresponding target concentrations of 0.05, 0.1, and 0.2 ppm. The 50 mg/kg incurred tissue was diluted 1:50 (0.05 ppm), 1:25 (0.1 ppm), and 1:12.5 (0.2 ppm). Blended samples and samples of incurred tissues were sent to Dr. Moffitt (U. Idaho) and Dr. Billedeau (FDA, NCTR) for testing with a microbiological method and HPLC, respectively. The samples with 0.2 ppm ERY yielded 0.212 (20 mg/kg) and 0.197 (50 mg/kg) ppm by HPLC, and 1.067 (20 mg/kg) and 1.054 (50 mg/kg) ppm by the microbiological method. Only the 0.2 ppm ERY samples were analyzed with HPLC due to resource issues. HFV-150 concluded that the HPLC and microbiological methods did not provide equivalent results. Bridging Study II: The fish were dosed and sampled at 1, 3, 7, 14, 20, and 28 day withdrawal times. The frozen filets were given to Dr. Carson (FDA, CVM) for LC-MS analysis. The LC-MS detected 2 metabolites as well as the parent compound, erythromycin A. Only the 100 mg/kg dose was administered with 1, 3, 7, 14, 20, and 28 day withdrawal times. After her analysis, Dr. Carson sent tissues to the FDA Denver District Laboratory (C. Kiessling) for testing with a microbiological method. The LC-MS method detected 13.12 (1d), 7.22 (3d), 2.12 (7d), 0.40 (14d), 0.06 (20d), and 0.02 (28d) ppm ERY A. The FDA microbiological method detected 26.60 (1d), 15.35 (3d), 7.30 (7d), 1.98 (14d), 0.43 (20d), 0.03 (28d) ppm ERY A. Regression analysis showed the best correlation between the FDA microassay and LC-MS results of the parent ERY A with 10% of the combined metabolites. Center for Veterinary Medicine (CVM) Three-Year Research Plan FY2009 – FY2011 Letter from the Office of Research's Director The Office of Research’s Mission Statement states our commitment to conduct applied research in support of FDA regulatory issues and ensure the safety of animal derived food and animal health products. Another equally important goal is to involve our customers. The main goal of this document is to strengthen the relationship that we have with our customers by seeking their help in developing this and future three-year plans. The staff of the Office of Research (OR) is committed to providing quality science to address regulatory issues of the Center for Veterinary Medicine (CVM) and the Agency. To increase customer involvement, the OR Leadership Team is formalizing the process of prioritizing the Center’s research programs. This 2008 CVM Three-Year Research Plan initiates the Center’s research planning process for FY 2009. This formal process will inform our customers of research plans for the next three years and serve as the resource base for subsequent research plans. The process will also provide our customers with the ability to establish research priorities and be involved in research plan approval. While the CVM Three-Year Research Plan represents the culmination of the annual planning process, the annual CVM Research Report is another component of the planning process. This report is designed to provide our view on progress and accomplishments. This report also provides our customers and management the opportunity to view progress in terms of priorities for competing resources. Certainly, as stewards of the resources provided, we must continually view our work from the perspective of value added to the safety of the products we regulate. The OR is committed to its mission of providing research and scientific expertise to the Center and Agency. The OR staff, with your input in establishing priorities, is focused on our mission and the value our work brings to the safety of the United States food supply. We are excited about our research programs and the opportunity we have for contributing to public health. We encourage your involvement. Marleen Wekell, Ph.D. Director Office of Research TABLE OF CONTENTS Introduction The Three-Year Plan ......................................................................................................... vi Impacts of CVM Research............................................................................................................................. vii Maintains a Strong Science Base ................................................................................................................... viii Resolves Cutting Edge Issues..........................................................................................................................ix Answers CVM Needs .......................................................................................................................................ix Provides Microbiogical Food Safety Research ................................................................................................x Collaborative Research ...................................................................................................... xi Formal Arrangements.......................................................................................................................................xi Informal Arrangements ...................................................................................................................................xii Research Prioritization .................................................................................................... xiv Document Organization .................................................................................................. xvi Abbreviations Used in This Document ...................................................................................................... xvii Premarket/Drug Review Introduction ......................................................................................................................1-2 Animal Drug Safety and Efficacy......................................................................................1-3 Test Anthelmintics in Largemouth Bass Infected with Acolpenteron ureteroecetes...................................... 1-4 Examine Effectiveness of Formalin Treatment of Fungal Disease in Catfish ....................................... 1-6 Develop Criteria for Establishing Aquatic Animal Disease Models ........................................................ 1-7 Examine Depletion and Crystal Formation in Fish Following Administration of Melamine and Cyanuric Acid.................................................................................................................................... 1-8 Investigate specific questions for select Aquaculture INAD agents........................................................ 1-9 Evaluate the Safety of Using the Ear as an Injection Site for Parenteral Drug Delivery in Cattle........................................................................................................................................................1-10 Investigate the Effects of Late-Term Gestation on Blood Levels of Doramectin ..............................1-11 Develop a Model System to Identify Anti-Inflammatory and Analgesic Drug Cytotoxicy Biomarkers Using Pharmacogenomics ................................................................................................1-12 Develop Alternative Ivermectin-Sensitive Model Systems – A Critical Path Study ............................1-13 Antimicrobial Resistance Mechanisms .......................................................................... 1-14 Determine Microbial Ecology of Antibiotic Resistance Development and Dissemination in the Food Animal Production Environment........................................................................................1-15 Use Molecular and Biochemical Methods to Determine the Animal Origin of Foodborne Bacterial Pathogens................................................................................................................................1-17 Interrogate Salmonella Diversity Using a Novel 35 Genome Salmonella Species Microarray – A Critical Path Study .................................................................................................................................1-19 Investigate Effects on Microbial Flora of Oxytetracycline Fed to Tilapia Held in a Recirculating System..............................................................................................................................1-20 Immunopharmacology ................................................................................................... 1-21 Determine Effects of Endotoxin and NSAIDs on Inflammatory Cytokines.......................................1-22 Metabolism and Residue Depletion ...............................................................................1-25 Determine Marker Residues of Selected Veterinary Drugs in Edible Aquatic Species.......................1-26 Method Development for Improved Drug Residue Testing ..........................................1-28 Providing Better Regulatory Methods........................................................................................................1-29 Develop Drug Specific Methods.................................................................................................................1-30 Method Development in Support of Minor Use Minor Species ..................................... 1-31 Develop Multiresidue Methods...................................................................................................................1-31 Method Trials: Chemical ................................................................................................1-33 Perform Method Trials for the Analysis of New Animal Drugs ............................................................1-34 Microbiological Methods ............................................................................................... 1-35 Develop Antimicrobial Susceptibility Testing Methods and Interpretive Criteria for Aquatic Animal Microflora..................................................................................................................................1-36 Develop Standardized In vitro Antimicrobial Susceptibility Testing Methods for Bacterial Pathogens................................................................................................................................................1-38 Conduct Molecular Characterization of Foodborne Bacterial Pathogens Isolated from Animals and Retail Meats by Microarray Technology .......................................................................1-39 Pharmacokinetics/Pharmacodynamics......................................................................... 1-40 Investigate Antimicrobial Pharmacokinetic Differences Between Normal and Diseased Animals....................................................................................................................................................1-40 Compare Pharmacokinetics of Small-Ruminant Antiparasitics of Clinical Importance......................1-42 Characterize and Functionally Analyze Bronchial Antimicrobial Peptides Using an Animal Pneumonia Model – A Critical Path Study..........................................................................................1-43 Compliance Introduction ..................................................................................................................... 2-2 Drug Residue Methods .................................................................................................... 2-3 Develop Needed Enforcement Methods.....................................................................................................2-4 Method Trials and Validation .......................................................................................... 2-5 Perform Method Trials to Determine Drug Residues from Unapproved Uses.....................................2-6 Pharmacokinetics and Residue Depletion....................................................................... 2-7 Use Tissue-Fluid Correlations to Predict Drug Residue Levels in Edible Tissues from Food- Producing Animals...................................................................................................................................2-8 Screening Tests .............................................................................................................. 2-10 Evaluate Screening Test Performance........................................................................................................2-11 Incursion Services .......................................................................................................... 2-12 Post-Approval Monitoring Introduction ..................................................................................................................... 3-2 Static and Non-Static Surveys........................................................................................................................3-2 Current Survey Activities...............................................................................................................................3-3 Individual Programs......................................................................................................... 3-4 Participate in PulseNet: DNA Fingerprint Foodborne Pathogens by Pulsed-Field Gel Electrophoresis (PFGE) ..........................................................................................................................3-4 Characterize Antimicrobial Resistance among Bacteria Isolated from Retail Meats .............................3-6 Characterize Antimicrobial Resistance among Historical Isolates of Foodborne Pathogens...............3-8 Survey Susceptibility of Foodborne Pathogens from Humans, Food, and Animals in Mexico...........3-9 Characterize Antimicrobial Resistance Mechanisms of Animal Bacterial Pathogens..........................3-10 Molecular Serotyping of Salmonella spp. by using the Luminex multianalyte profiling (xMAP) technology...............................................................................................................................................3-12 Determine the prevalence of pathogenic Escherichia coli recovered from NARMS Retail Meats........................................................................................................................................................3-13 Animal Feed Safety Introduction ..................................................................................................................... 4-2 Individual Programs......................................................................................................... 4-3 Use PCR and Immunochemical-Based Methods to Detect Natural and Rendered Materials that May Potentially be Used in Animal Feedstuffs.............................................................................4-3 Evaluate Commercial Test Kits for Detecting Rendered Materials that May Potentially be Used in Animal Feedstuffs ......................................................................................................................4-5 Survey Microbiology of Animal Feed and Feed Commodities.................................................................4-6 Develop Feed Security Tests .........................................................................................................................4-8 INTRODUCTION The Three-Year Plan ......................................................................................................... vi Impacts of CVM Research............................................................................................................................. vii Maintains a Strong Science Base ................................................................................................................... viii Resolves Cutting Edge Issues..........................................................................................................................ix Answers CVM Needs .......................................................................................................................................ix Provides Microbiogical Food Safety Research ................................................................................................x Collaborative Research ...................................................................................................... xi Formal Arrangements.......................................................................................................................................xi Informal Arrangements ...................................................................................................................................xii Research Prioritization .................................................................................................... xiv Document Organization .................................................................................................. xvi Abbreviations Used in This Document ...................................................................................................... xvii The Three-Year Plan The Center for Veterinary Medicine (CVM) Three-Year Research Plan describes the proposed research programs of the Office of Research (OR). This research plan is designed to meet the needs of CVM over the next three years. CVM promotes both public health and animal health through the approval of new animal drugs and feed additives and the post-approval monitoring of the use of these products. The main offices of CVM include the following groups who are both major OR customers and stakeholders: Office of New Animal Drug Evaluation (ONADE) and Office of Surveillance and Compliance (OS&C). OR also accepts assignments from the Director of CVM and collaborates with other organizations and researchers on issues related to CVM’s mission and initiatives. The following sections describe impacts made by OR research, CVM goals to be fulfilled, and longterm benefits that CVM will receive with this proposed Research Plan. Impacts of CVM Research The following list describes how OR’s research has positively impacted CVM and FDA regulatory programs. OR scientists evaluated three commercially available test kits used to detect prohibited proteins in animal feeds. These evaluations provided the Agency with information regarding the accuracy and usefulness of such tests in support of the Feed Ban. OR scientists tested the antimicrobial susceptibility of over 200 strains of Aeromonas salmonicida, providing information to determine epidemiologic cutoff values for this important fish pathogen. These data will help the Agency when it begins the process of determining clinical breakpoints for antimicrobials used to treat this disease. OR scientists developed an HPLC method to detect oxytetracycline in fish serum. Such methods are needed to determine the concentrations of drug that can be reached using a proposed dose and thus help determine if the drug would be clinically effective for specific organisms with known MIC values. The Agency uses such information when deciding what MIC levels to include on drug labels. OR scientists provided incurred residue tissues to develop methods to identify melamine and cyanuric acid in fish, swine and chicken tissues. In addition, they provided crucial information to the agency on the development of renal crystals as a result of combined administration of those two compounds. OR scientists published the first description of a laboratory transmission of an internal monogenean in fish. This disease model can be used to define methods to run efficacy drug trials for parasitic infections in fish. OR scientists have developed new multiclass drug residue screening methods that can simultaneously detect and differentiate between 20 to 40 different compounds in eggs, fish and shrimp. These methods use the specificity and sensitivity of liquid chromatography-tandem mass spectrometry (LC-MS/MS) combined with modern computing techniques to accomplish this feat. Building on the multiclass drug residue method in fish, OR scientists developed an LC-MS/MS method for erythromycin and its metabolites in fish. This chemical method provided greater selectivity than the microbiological inhibition method that was provided in support of the NADA. The chemical method was bridged to the micro method using tissue from erythromycin-dosed fish. OR scientists have developed standardized testing methods for the in vitro antimicrobial susceptibility testing of aquatic microorganisms, Group 1 species. These methods include both disk diffusion and broth microdilution techniques. These testing methods have recently been published by the Clinical and Laboratory Standards Institute (CLSI- formerly the National Committee for Clinical Laboratory Standards, NCCLS). These methods are being adopted by aquatic laboratories world-wide. OR scientists provided the pivotal effectiveness study for the use of formalin in rainbow trout. The data filled a critical gap in this important MUMS project. OR scientists, responding to urgent Agency requests, developed a method for confirming residues of nitrofurans, banned animal drugs, in shrimp and transferred this technique to an ORA laboratory. Nitrofurans are antimicrobial agents that are banned for use in food animals OR scientists coordinated the NARMS testing of retail meats, which supports FDA’s surveillance activities geared to monitor the safe use of antimicrobials in food animals. This study allows CDC and CVM to monitor the antibiotic susceptibility profiles of foodborne bacterial pathogens at the point of purchase by the consumer. The results from this study, in combination with those data from USDA and CDC, will serve as an early warning system for resistance should foodborne bacterial pathogens begin to show decreased susceptibility to various antibiotics being used in animal husbandry and human clinical medicine. OR scientists completed testing of over 150 animal feeds for antimicrobial resistant E. coli and Enterococcus. These data provide baseline data for the microbial status of animal feeds as it relates to antimicrobial resistance. OR scientists improved and validated a polymerase chain reaction (PCR) method for the detection of rendered bovine-derived materials in animal fees. The validation of this method provides an important tool for enforcing the Agency’s ban on feeding cattle certain types of animal-derived protein. This methodology was transferred to ORA laboratories for use as a confirmatory procedure for the official feed microscopy method. OR scientists, working with collaborators at the Florida Department of Agriculture and ORA, validated methods for the screening and confirmation of chloramphenicol residues in shrimp. This drug is known to cause aplastic anemia in susceptible people. OR scientists began development of a standardized disk diffusion method to test Campylobacter species for resistance to 4 antimicrobials. Such a standard will provide a simple and inexpensive method for routine susceptibility testing of these organisms for surveillance purposes, as well as routine susceptibility testing in the clinical setting. OR scientists compiled a pharmacokinetic literature database containing information from over 350 articles regarding drug and chemical metabolism in over 100 different fish species. This resource provides a wealth of rapidly retrievable information to CVM reviewers of drug applications, as well as those trying to conduct minor species drug approval studies. OR scientists determined that a commercial milk test kit for beta-lactam drugs did not perform consistently. These data provided the basis for OS&C to issue a warning letter to the firm. As a result, only test kits meeting independent laboratory lot release testing can be sold in the US. OR scientists have built up the largest PFGE DNA fingerprinting database of Campylobacter in the US, and shared the database with the national molecular subtyping network for food borne disease surveillance program-PulseNet. The national DNA fingerprinting plays a significant rule in detecting and tracing the source of foodborne illness outbreaks. Data generated from the National Antimicrobial Resistance Monitoring System (NARMS) provide information for use by sponsors and CVM in the preapproval review process of new animal drugs as outlined in Guidance for Industry #152. Maintains a Strong Science Base The Three-Year Research Plan ensures that CVM maintains a productive research program. This enhances OR’s ability to recruit and retain scientists with the appropriate scientific base. Involvement with state-of-the-art techniques and current problems provides CVM scientists with the necessary scientific competencies to effectively interact with their industry and academic counterparts. It also makes it easier for CVM to recognize shifts in the technology and scientific fields that regulated industry relies on for future products. Resolves Cutting Edge Issues The Research Plan includes both intramural and extramural components. When expertise on a cutting edge issue resides outside of OR, we fund and monitor these extramural studies when funding is available. However, if one of the following criteria is met, importance, timeliness, or responsibility, intramural research is conducted. Intramural research provides OR with the ability to rapidly develop and conduct research studies in response to pressing needs. This is one of the strengths of OR’s research program. For example, a research question or issue may be so important that CVM chooses to conduct intramural research even though others may have reported results or are actively pursuing a problem. For these issues, where a regulatory decision or policy change will occur, CVM independently confirms new findings. Often, because of regulatory deadlines or public health emergencies, there is not sufficient time to make use of grants, contracts, or cooperative agreements with academic or industrial researchers. The intramural program can change priorities rapidly to facilitate such research. Intramural research is also conducted if no one sponsor may be legally responsible to address the issue or if an industry is too small, e.g., minor species producers or animal diagnostic tests, to support a research effort and address the concerns of CVM. Answers CVM Needs The Three-Year Plan includes research designed to answer some of CVM’s immediate needs: Develop and validate test methodologies, including methods for newly prohibited drugs such as antiviral drugs in poultry. Survey drug residues in animal-derived foods. Evaluate animal diagnostic tests. Monitor changes in antimicrobial susceptibility profiles of selected foodborne bacterial pathogens On a slightly longer time horizon, a number of research programs will help CVM develop policy or produce guidelines for industry. These programs are described in section 1 and include: Effects of CVM approved drugs on efficacy and animal safety Immunopharmacology Metabolism and residue depletion Pharmacokinetics Provides Microbiogical Food Safety Research The FDA is mandated to ensure the microbiological safety of foods, including those derived from animals. CVM’s research program identifies and investigates microbiological hazards associated with food produced by animal agriculture. Even though the American food supply is among the safest in the world, the program’s goal is to further reduce the incidence of foodborne disease to the greatest extent possible. The role of CVM in this research relates to microbial hazards associated with pre-harvest phases of the animal production environment, including animal feeds. The Research Plan includes research programs to resolve these issues: Evaluate animal feeds for the presence of human foodborne bacterial pathogens. Identify factors associated with the presence and persistence of zoonotic bacterial pathogens in the animal production ecosystem. Survey various food products for the presence of zoonotic foodborne bacterial pathogens. Apply genetic typing methods to track the spread of specific zoonotic foodborne bacterial pathogens. Identify and compare antimicrobial resistance genes in foodborne pathogens isolated from different sources to better understand the spread of resistant bactiera in the food chain. Collaborative Research We in the Office of Research (OR) believe that it is extremely important to be involved in collaborative research and outreach programs. These programs help us to make better use of our resources and facilities. They also provide us with a more diverse viewpoint of how best to accomplish our objectives. The collaborative research programs that we are currently supporting include both formal and informal arrangements, as described in the following sections. Formal Arrangements Formal collaborative research programs include: Analytical Methods Development Contract - This contract was funded to help the Center conduct method trials for new and improved analytical methods for animal drug residues. Joint Institute for Food Safety and Applied Nutrition (JIFSAN) – CVM/OR collaborated with the University of Maryland on food safety projects funded by JIFSAN including a project (1) to evaluate the in vitro metabolic profiles as a method to predict residue depletion of drugs in different species of fish University of Maryland Contract – CVM has provided funds to examine the prevalence of and genetic relatedness of Enterococcus samples from retail meats and humans. Office of Science & Health Coordination (OSHC) (FDA Collaborative Science Project Application) – OSHC funds CVM/OR’s collaborative effort with FDA/CDRH scientists to evaluate the safety and effectiveness of drug-device combinations for treatment of vascular disease. CVM/OR’s contribution is to perform the analytical chemistry to determine by liquid chromatography-mass spectrometry the drug levels in blood and vascular tissues resulting from device implantation. USDA Interagency Agreement – CVM and USDA, Science and Technology Office and the USDA Monitoring Programs Office are collaborating on the determination of antimicrobial susceptibility profiles and generic relatedness of E coli, Salmonella and Shigella isolates recovered from the USDA-AMS produce surveys. The ultimate objective is to collect data that will be used to establish “benchmarks” by which to evaluate the efficacy of procedures to reduce or eliminate harmful food borne microorganisms. Memorandum of Understanding – CVM and CFSAN have established an MOU with the Central Sciences Laboratory of the United Kingdom to provide for the cooperative exchange of scientific expertise, assistance, and information to enhance our capabilities to carry out our responsibilities in consumer protection and public health with regard to issues of food safety. Critical Path Initiative - Interrogating Salmonella Diversity Using a Novel 35 Genome Salmonella Species Microarray – The FDA Critical Path Initiative awarded funds to CVM and CFSAN to investigate Salmonella enterica serotypes of importance to food safety for antimicrobial resistance genes, virulence genes, mobile genetic elements, single nucleotide polymorphisms, and evolutionary relatedness using a newly developed and highly dense affymetrix microarray platform. The goal of this study is to generate data to provide information to increase timeliness and specificity of public health monitoring of FDA regulated food and animal feed products. Informal Arrangements Informal collaborative research programs include: AOAC International (formerly Association of Official Analytical Chemists) - This collaborative effort involved the co-development and use of standardized test kit validation protocols for the evaluation of screening test systems used in the detection of drug residues in fresh bulk tank milk samples. University of Maryland – (1) This informal collaboration provided for the study of the prevalence and antibiotic resistance profiles of food pathogens from conventional and organic production facilities. (2) Completed a joint project to evaluate and potential of the food supply to serve as a reservoir of Enterococcus infecting humans. (3) Began a trial to determine the prevalence of methicillin-resistant Staphylococcus aureus in retail raw meats. (4) Began a joint project to identify the carriage of virulence factors in E. coli from retail raw meats. University of Massachusetts – This collaboration will provide for the development of fish models for testing veterinary drugs against major aquaculture bacterial diseases. University of Maryland/USDA/CFSAN/J. Craig Ventner Institute - Completed a study to sequence the genomes of 17 Salmonella strains, representing 12 serotypes. Reported the complete DNA sequence of a large multi-drug resistance plasmid from Salmonella enterica serotype Newport and its distribution in enteric bacteria in retail meats. PulseNet – This collaborative effort was initiated by CDC and involves State Departments of Health and FDA and USDA. It is an epidemiological database focused on the acquisition and storage of DNA fingerprints of bacterial pathogens generated by the procedure known as pulsedfield gel electrophoresis. This database represents a powerful epidemiological tool to conduct trace-back investigation during outbreaks of foodborne illness leading to faster intervention and establishment of control measures. The food borne bacterial pathogens subtyped by OR’s laboratory are obtained from ten FoodNet sites and six state veterinary diagnostic laboratories. Invitrogen - The goal of this collaborative project is to develop and validate test kits for use with Real-Time PCR in the detection of plant and animal proteins. Consortium for the Barcode of Life – This project will focus on the development of DNA barcoding systems that will revolutionize taxonomy by enabling prompt and reliable identification of species regardless of the life stage examined or the condition of the specimen. Dr. Mussaret Zaidi, Dept de Investigacion, Hospital General O’Horan, Merida, Yucatan, Mexico – Completed a collaborative project to characterize resistance among salmonellae and initiated a joint project to characterize resistance among E. coli and Campylobacter from humans, animals and retail meats in Mexico. USDA – IAG to measure antimicrobial susceptibility of food borne pathogens isolated from produce via the Agricultural Marketing Service’s program. Summer Student Intern Program – This is a special program for minority college students which gives them experience in biological and chemical research. CFSAN/UMD – This collaborative effort is to use six –enzyme pulsed-field gel electrophoresis (PFGE) analysis of S. Typhimurium and S. Enteritidis to determine phylogenetic and taxonomic accuracy of the strain relationships. The plasmid-mediated antimicrobial resistance among these strains will be investigated. Max Plank Institute – This project compares Salmonella enterica serotype Newport isolates from similar time periods from Germany and the United States by MLST type and antimicrobial susceptibility profile and investigates the development of the multidrug phenotype MDR of this serotype. This work is performed in collaboration with Dr. Mark Achtman,at the Max Plank Institute in Berlin, Germany, curator of the international Salmonella MLST database. Ohio State University/North Carolina State University – Continued a project to compare microarray, and other strain typing methods, for characterizing Campylobacter jejuni and C. coli isolates obtained from the NARMS program and the animal production environment. Washington State University – OR scientists are participating in a multi-lab validation of a microarray chip developed by Dr. Margaret Davis at Washington State University identifying antimicrobial resistance genes in bacteria of veterinary importance. University of Minnesota - The goal of this study is to assess how resistance to various antimicrobials may relate to the virulence potential and phylogenetic background of clinical Escherichia coli isolates from retail meats. Also, initiated a collaborative study to investigate the evolution of florfenicol resistance genes in E. coli and Salmonella. JMI Laboratories – Completed preliminary studies to develop a disk diffusion testing method for Campylobacter. Central Science Laboratory – This collaboration will be for the joint development and validation of methods to determine and confirm antiviral drug residues in poultry. Research Prioritization The CVM Three-Year Research Plan is the final product of an annual review and prioritization of research programs and activities. As stated in the Office of Research Director’s letter at the beginning of this document, OR is formalizing this review process that includes input from OR scientists and managers, the other offices in CVM, external stakeholders, and CVM’s Senior Management Team (SMT). The following figure summarizes the annual review and selection/prioritization of research activities. Figure 1. Selecting and Prioritizing Research Activities In December of each year, the Office of the Center Director, the Offices of New Animal Drug Evaluation and Surveillance and Compliance, and external stakeholders are requested to assess the current Research Plan. They determine which activities should continue, and which areas need redirecting. Secondly, they identify and prioritize their own research needs. Typically, these needs include: Data to support guideline development Product investigations Generic data gaps Feasibility studies Surveys Method development The next step in the prioritization process is for OR scientists and management to review these requests and comments. Requests are sorted into those that either can or cannot be accomplished with OR’s expertise, resources, and facility. For those requests that cannot be accomplished at OR, we provide suggestions (cooperative agreements, contracts, etc.) and estimated costs for meeting them. Those requests that we believe OR can address are evaluated in terms of the necessary resources and time. From this, OR develops multiple options for the revision of the plan. These options and their associated costs are presented to the SMT in April. They review the current plan and the options presented for update and revision. They select, modify, and approve various proposals. OR uses this guidance to revise the Three-Year Plan and submits the updated plan to the SMT for its approval in August. Upon approval by the SMT, the updated Three Year-Plan is released and is effective October 1, the start of the new fiscal year. Also at this time, OR scientists and management prepare the annual report of research activities of the prior fiscal year. This is distributed by December 1 so that the other offices in CVM and external stakeholders can consider it in formulating their proposals in the next cycle of research prioritization. .. Document Organization The CVM Three-Year Research Plan is organized into four sections. These groupings of research recognize the connection between research and the respective pre- or post-approval activities of the Center. They are also the four core components of the Center’s “Back to Basics” strategic initiative. Premarket/ Drug Review Compliance Post-Approval Monitoring Animal Feed Safety Each section introduces the category of research, and then describes the active research programs, the participating researchers and organizations in each program, the resource commitments, and the objectives for the next three years. Abbreviations Used in This Document The following table presents a list of abbreviations that appear in this document. Abbreviation Description AOAC Formerly Association of Official Analytical Chemists ARS Agricultural Research Service AST Antimicrobial susceptibility testing BAM Biological Analytical Manual CDER Center for Drug Evaluation and Research CDRH Center for Devices and Radiological Health CFSAN Center for Food Safety and Applied Nutrition CLSI Clinical and Laboratory Standards Institute (Formerly NCCLS) CVM Center for Veterinary Medicine CYP Cytochrome P450 DAFM Division of Animal and Food Microbiolgy DNR Department of Natural Resources FDA Food and Drug Administration FSIS Food Safety and Inspection Service FTE Full time equivalent FY Fiscal year GLP Good laboratory practices HAB Harmful Algal Blooms HACCP Hazard analysis and critical control points IACUC Institutional animal care and use committee IND Investigational new drug JIFSAN Joint Institute for Food Safety NADA New animal drug application NCCLS National Committee for Clinical Laboratory Standards NOH Notice of Hearing OLT Office Leadership Team ONADE Office of New Animal Drug Evaluation OR Office of Research ORA Office of Regulatory Affairs OS&C Office of Surveillance and Compliance PAG Project Advisory Group PCR Polymerase chain reaction PD Pharmacodynamics PI Principal Investigator PK Pharmacokinetics PO Project officer SMT Senior Management Team SOP Standard operating procedure UMB University of Maryland at Baltimore USDA United States Department of Agriculture ` 1 PREMARKET/DRUG REVIEW Introduction..................................................................................................................................... 1-2 Animal Drug Safety and Efficacy..................................................................................................... 1-3 Test Anthelmintics in Largemouth Bass Infected with Acolpenteron ureteroecetes ...................................... 1-4 Examine Effectiveness of Formalin Treatment of Fungal Disease in Catfish........................................ 1-6 Develop Criteria for Establishing Aquatic Animal Disease Models......................................................... 1-7 Examine Depletion and Crystal Formation in Fish Following Administration of Melamine and Cyanuric Acid.................................................................................................................................... 1-8 Investigate specific questions for select Aquaculture INAD agents ........................................................ 1-9 Evaluate the Safety of Using the Ear as an Injection Site for Parenteral Drug Delivery in Cattle........................................................................................................................................................1-10 Investigate the Effects of Late-Term Gestation on Blood Levels of Doramectin...............................1-11 Develop a Model System to Identify Anti-Inflammatory and Analgesic Drug Cytotoxicy Biomarkers Using Pharmacogenomics ................................................................................................1-12 Develop Alternative Ivermectin-Sensitive Model Systems – A Critical Path Study.............................1-13 Antimicrobial Resistance Mechanisms.......................................................................................... 1-14 Determine Microbial Ecology of Antibiotic Resistance Development and Dissemination in the Food Animal Production Environment........................................................................................1-15 Use Molecular and Biochemical Methods to Determine the Animal Origin of Foodborne Bacterial Pathogens................................................................................................................................1-17 Interrogate Salmonella Diversity Using a Novel 35 Genome Salmonella Species Microarray – A Critical Path Study..................................................................................................................................1-19 Investigate Effects on Microbial Flora of Oxytetracycline Fed to Tilapia Held in a Recirculating System..............................................................................................................................1-20 Immunopharmacology.................................................................................................................. 1-21 Determine Effects of Endotoxin and NSAIDs on Inflammatory Cytokines.......................................1-22 Metabolism and Residue Depletion .............................................................................................. 1-25 Determine Marker Residues of Selected Veterinary Drugs in Edible Aquatic Species........................1-26 Method Development for Improved Drug Residue Testing......................................................... 1-28 Providing Better Regulatory Methods ........................................................................................................1-29 Develop Drug Specific Methods.................................................................................................................1-30 Method Development in Support of Minor Use Minor Species.................................................... 1-31 Develop Multiresidue Methods ...................................................................................................................1-31 Method Trials: Chemical................................................................................................................ 1-33 Perform Method Trials for the Analysis of New Animal Drugs ............................................................1-34 Microbiological Methods ............................................................................................................... 1-35 Develop Antimicrobial Susceptibility Testing Methods and Interpretive Criteria for Aquatic Animal Microflora..................................................................................................................................1-36 Develop Standardized In vitro Antimicrobial Susceptibility Testing Methods for Bacterial Pathogens................................................................................................................................................1-38 Conduct Molecular Characterization of Foodborne Bacterial Pathogens Isolated from Animals and Retail Meats by Microarray Technology .......................................................................1-39 Pharmacokinetics/Pharmacodynamics......................................................................................... 1-40 Investigate Antimicrobial Pharmacokinetic Differences Between Normal and Diseased Animals....................................................................................................................................................1-40 Compare Pharmacokinetics of Small-Ruminant Antiparasitics of Clinical Importance......................1-42 Characterize and Functionally Analyze Bronchial Antimicrobial Peptides Using an Animal Pneumonia Model – A Critical Path Study..........................................................................................1-43 1 Introduction The mission statement for Agency research states “FDA uses innovative science-based decisionmaking to efficiently evaluate and make available beneficial new products, to develop sound safety standards and guidance, and to rapidly identify and address emerging public health needs.” Research programs at CVM’s Office of Research follow the direction set by the Agency by enabling the Center to resolve regulatory issues on a scientific plane based on principles and data. Resolution of these issues sometimes takes the form of guidance documents or Center policies. These documents and policies direct the regulated industry in the drug approval process or in the proper use of drugs and feed additives. The Premarket/Drug Review research program ensures that these guidelines and policies are based on sound science, as in 1996 when the Animal Drug Availability Act (ADAA) modified a section of the Food, Drug, and Cosmetic Act. The section pertained to how the regulatory standard for demonstrating drug effectiveness was defined. Congress amended the definition due to substantial evidence. The amended definition permitted the FDA more flexibility in determining the types of studies required to demonstrate that a particular new animal drug was effective for its intended uses and conditions of use. Current OR research programs will help the Center develop policies or guidelines that allow for this flexible approach to demonstrate efficacy. Research programs for the Three-Year Plan include: Animal Drug Safety and Efficacy – We are supporting the availability of new aquaculture drugs by performing safety and efficacy studies. Antimicrobial Resistance Mechanisms – As part of our food safety programs, OR scientists are evaluating issues related to the use of antimicrobial drugs in both humans and animals to develop new animal drug requirements and policies that protect the public health. Immunopharmacology – Efforts are underway to identify biomarkers of disease within the immune system that could demonstrate the effectiveness of drugs. Metabolism and Residue Depletion – To aid in the review of new aquaculture drugs, we are examining the comparative metabolism and depletion of select veterinary drugs in several species of fish. Method Development – OR scientists are developing regulatory methods in support of minor species drugs and investigating new approaches to regulatory methods. Method Trials – OR scientists participate in the laboratory evaluation of regulatory methods submitted in NADAs. Microbiological Methods – To ensure uniform and reproducible data on microbiological safety in submissions, OR scientists are developing standardized antimicrobial susceptibility test methods. Pharmacokinetics/pharmacodynamics – Recent investigations compared the pharmacokinetics of drugs in two production classes of animals in the same species and the bioavailability of drug formulations across species. Animal Drug Safety and Efficacy FDA uses innovative science-based decision-making to efficiently evaluate and make available beneficial new products, to develop sound safety standards and guidance, and to rapidly identify and address emerging public health needs. Research programs at CVM’s Office of Research follow the direction set by the Agency by enabling the Center to resolve regulatory issues on a scientific plane based on principles and data. Resolution of these issues sometimes take the form of guidance documents or Center policies to direct the regulated industry in the drug approval process or in the proper use of drugs and feed additivies. It is imperative that these guidelines and policies be based on sound science. In addition, we have been asked to conduct studies to provide pivotal data to support public master files of selected, potential drugs for aquatic species. We are developing protocols for efficacy and safety studies. We have developed a fungal infection model in catfish to facilitate anti-mycotic drug efficacy studies and a bacterial infection model for trout A. salmonicida, an important aquaculture pathogen. This latter model will help us develop criteria with which to judge the potential effectiveness in vivo of antimicrobials showing in vitro effectiveness against this pathogen. We have recently published a fish model for internal parasite infection in which to test the efficacy of anthelmintic drugs. This work will help support the Center’s goal to increase minor species drug availability. Test Anthelmintics in Largemouth Bass Infected with Acolpenteron ureteroecetes Acolpenteron ureteroecetes is a monogenetic trematode, a that parasite requires only one host in its life cycle. As intensive aquaculture of largemouth bass is increasing, this parasite has been reported as an emerging disease, especially in recirculating culture systems At this time, there is no approved effective treatment for these internal trematodes, in fact there are no FDA approved treatments for any internal parasites of fish. Since parasites are a major source of fish mortalities and aquaculture production loss, there is a need for effective theraputic agents. However, CVM has no guidance for industry to aid investigators trying to conduct aquatic parasite efficacy studies. The ultimate purpose of the current project is to develop specific test methods to evaluate the effectiveness of parasiticides on infected fish. By conducting such work at CVM we will be able to provide insight into design aspects of such studies in aquatic species. This information is very valuable to obtain for reviewers in the Aquaculture Drug Team in ONADE as they are frequently called upon to comment on study design by drug sponsors. We will increase our stocks of infected animals to conduct this study since infected fish have a much higher mortality rate than uninfected fish. Such studies require maintaining a colony of infected animals at CVM, a rare recourse for such investigations. We are in the process of evlauating extensive video microscopic data to determine drug candidates that will be used for the in vivo part of the study. Preliminary data indicate several drugs have effect on motility and survival of these trematodes. Effectiveness within the target organ (kidney) must, however, be evaluated in the living fish. Questions to be addressed in our study will be – What is the level of ambient infection (prevalence and intensity) necessary to demonstrate clear response post treatment? What dosages show response? What criteria for efficacy are acceptable if the parasite cannot be completely eradicated in a fish population? The following personnel are responsible for this study: Renate Reimschuessel Charles Gieseker Eric Evans OR staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.3 10 0.3 11 0.2 Analyze video images of parasite responses to anthelminics in vitro to determine potential candidate drugs for in vivo testing. Obtain and infect more large mouth bass juveniles. Develop protocol for in vivo testing of A. ureterectes as a model for parasite efficacy studies for internal parasites. Begin effectiveness study using candidate drugs based on in vitro data. Complete effectiveness study using candidate drugs based on in vitro data Examine Effectiveness of Formalin Treatment of Fungal Disease in Catfish Aquatic fungi (Saprolegniales) are ubiquitous in natural water supplies of fish hatcheries and can cause serious disease problems. Saprolegnia infections (saprolegniasis) in fish are promoted by poor water quality, malnutrition, injuries occurring during handling, crowding, temperature shock, spawning, and external parasitism. Saprolegniasis can also occur as a secondary infection to existing bacterial or viral infections. The resulting infections on fish generally occur to the epidermis, dermis, and possibly the superficial musculature causing osmoregulatory failure. Some preliminary studies and hatchery trials with formalin show promise that formalin could be effective in preventing or controlling mortalities associated with saprolegniasis in fish. Definitive controlled studies are needed, though, to clearly define efficacy and determine optimal treatment regimes. We completed studies in rainbow trout, which have been accepted by ONADE in support of a publically sponsored INAD. We were asked to provide similar information for channel catfish to compare with the trout data. We have completed the laboratory phase of this GLP study. Once the data has undergone QA/QC review, we will write a final report, which will be submitted to ONADE. This study will provide pivotal data on the efficacy of formalin to treat fungal infections in fish. Recently ONADE has requested that our laboratory also evaluate the appropriateness of a Fish and Wildlife Service (UMESC) fungal infection model being used to evaluate other therapeutants. Our scientists will collaborate with UMESC scientists to compare the 2 infection models. The following personnel are responsible for this study: Renate Reimschuessel Charles Gieseker Eric Evans OR staff Joan Gotthardt, CVM/MUMS Joan Gotthardt, CVM/ONADE The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.2 10 0.6 Complete QA/QC of GLP study and prepare final report Compare UMESC disease model with CVM model Develop Criteria for Establishing Aquatic Animal Disease Models Clinical efficacy trials of natural disease outbreaks are very difficult to complete in aquatic species. This is due to several factors, including the rapidity that many disease outbreaks progress to death, the fact that most hatcheries are ill equipped to run well controlled clinical trials and the difficulties in documenting the disease status of individual animals or their consumption/exposure to the drug. Increasingly, there is a need to develop well controlled disease models for aquatic animal drug efficacy trials, which do not suffer from the limitations found in natural outbreaks. There are, however, many variables which need to be defined when developing a disease model. For example, what routes are acceptable for infecting the animals, what percent of exposed animals should become ill, is it necessary (and/or preferable) for the disease to be created in 100% of the animals, how severe should the disease be (i.e. what percent mortality in untreated controls), how soon after the disease has been diagnosed should the treatment be initiated. These are just some of the questions that arise and as sponsors begin to develop models, they will come to CVM for guidance on these and other points. The goal of this project is to begin to develop criteria that can be used for developing a CVM guidance document for developing aquatic animal disease models. It is not one specific model we will develop, but to define the method of determining appropriate infection rates, infection severities, time frames and treatment options within a disease model so that the model provides a true means of predicting clinical outcomes in natural infections. As a first model, we will work on parasite enumeration and treatement evaluation. Additional questions to be addressed in following stages of this project are an examination of Gyrodactylid and Dactylogyrus species to determine if all species can be grouped together with the expectation that treatement response within genus will be consistent. The following personnel are responsible for this study: Renate Reimschuessel Charles Gieseker Eric Evans OR staff Don Prater, CVM/ONADE The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.3 10 Evaluate genus vs species level response to treatments 0.5 11 0.5 Develop Protocol for defining specific criteria of concern in collaboration with ONADE reviewers. Initiate studies to demonstrate methods for obtaining data. Obtain and infect appropriate fish species and parasites as identified by ONADE and OR Conduct effectiveness study using model drugs Examine Depletion and Crystal Formation in Fish Following Administration of Melamine and Cyanuric Acid Melamine, cyanuric acid and a combination of these compounds recently were found in pet feeds, livestock feeds and fish feeds. There is little-to-no information regarding depletion of these triazines in fish tissues. In May 2007, livestock feeds (hog/chicken/fish) were adultereated with the triazines melamine and cyanuric acid. Thousands of animals had eaten these feeds and producers asked the Agency if they could sell the animals for slaughter. There was an outcry for information regarding how long residues remain in tissues and FDA preformed a risk-assessment using the limited information that was available at that time. There was no data about whether residues form in hogs, chickens or fish, nor were there any methods to measure residues in their edible tissues. CVM scientists conducted a rapid study to provide incurred samples for developing methods in fish tissues, and demonstrated that feeding both compounds caused crystal formation in fish kidneys, similar to those that caused renal failure in cats and dogs. Methods for melamine and cyanuric acid have now been validated, but many questions about how extensively fish accumulate these compounds, residue depletion and no-effect levels remain. One goal of this research program is to determine what residues can be expected when fish consume relatively low doses of these compounds. We will determine depletion rates for these triazines in two species of fish, a warmwater and a coldwater species since depletion rates can vary depending on temperature. In addition, we will determine the threshold dose for development of crystals in fish following triazine administration. Finally we will the effects of sequential administration of individual chemicals. The data may be used by FDA in conducting risk assessments and will help other centers (such as NCTR) as they develop protocols to explore triazine effects in mammals, with the fish serving as a non-mammalian model representing the worst case senario for residue accumulation. The following personnel are responsible for this study: Renate Reimschuessel Charles Gieseker Eric Evans ORAU Fellow The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.8 10 0.2 Complete depletion study in trout and catfish. Prepare preliminary agency report. Conduct sequential dosing studies and threshold dosing studies. Prepare final report.. Investigate specific questions for select Aquaculture INAD agents Aquaculture drugs are unique in that many of the compounds used to treat fish diseases are compounds not traditionally considered therapuetic agents in mammalian medicine. As a result, personnel reviewing data from studies to support a drug claim will not have adequate background information available to make decisions based on sound science. Diquat is a contact herbicide that produces desiccation and defoliation. It has also been used to treat fish with presumptive external flavobacteriosis and bacterial gill disease (BGD). There is, however, little documention regarding appropriate dosages and duration of treatment. We will begin to assess this issue by examining the current disease models for BGD and external flavobacteriosis. We will test selected models in our laboratory to find one appropriate for effectiveness trials in catfish. This model will be optimized and then used to evlauate different dosage regimens for diquat. The following personnel are responsible for this study: Renate Reimschuessel Charles Gieseker Eric Evans OR staff ONADE reviewers. The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 10 0.5 11 0.6 Evaluate infection models for BGD and Flavobacterial disease, obtain appropriate isolates, conduct in vitro tests for susceptiblity to diquat Optimize a laboratory disease model and dosing regimen for diquat Evaluate the Safety of Using the Ear as an Injection Site for Parenteral Drug Delivery in Cattle The ear has become an increasingly common site for the injection of therapeutic and production drugs in cattle. This primarily is because the problem of extended drug residues at the injection site is avoided, and it is also less likely to result in carcass damage and trimming required at the time of slaughter. The CVM Office of New Animal Drug Evaluation (ONADE) currently has several drug products approved, or under review, that designate the ear pinna as the site for subcutaneous injection. However, field safety studies with some of these drugs have resulted in several reports of acute death following administration. These cases have been attributed to inadvertent injection of the drug into an artery, resulting in back-flush into the cerebral blood supply, leading to embolism and death. While CVM/ONADE has requested that the drugs in question be studied, in order to determine if the adverse events are volume-related or due to physical/chemical properties of the drug/carrier, it has become apparent that few anatomical references exist that describe the blood vessels on the posterior aspect of the bovine ear and the most likely pathway for injected material to access the cerebral circulation. The purpose of the initial study is to perform an anatomical investigation of the blood vessels in and around the bovine ear, which will be completed prior to initiating a study to investigate the drugs in question. The results of this study should: 1) provide a detailed vascular map of the ear region, 2) indicate the feasibility of back-flush into the cerebral blood supply by inadvertent arterial injection, and 3) aid in estimating the approximate injection volume required for back-flush to occur. The following personnel are responsible for this study: Jeffrey Ward Jamie Boehmer DAR Staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.3 Complete anatomical study in steers and consider the need for a drug safety study Investigate the Effects of Late-Term Gestation on Blood Levels of Doramectin The FDA has become aware of recent incidents involving the misuse of the anthelmintic Doramectin (Dectomax®) to treat dairy cattle. Doramectin is not approved for use in female dairy cattle 20 months of age or older. If a lactating cow is exposed to Doramectin, milk from the cow may have detectable residues of the drug for as long as 60 days. Furthermore, the blood levels that the drug achieves in late-gestation heifers (not lactating), as compared to non-pregnant animals, is not known. Because the drug can be legally administered to pregnant heifers, the current study will be undertaken to evaluate the effects of late gestation on the blood levels of Doramectin. Subsequent studies may investigate the effects of first lactation on blood and milk levels of the drug. The following personnel are responsible for this study: Jamie Boehmer Jeffrey Ward DAR Staff Janis Messenheimer, CVM/ONADE The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.2 10 0.4 Initiate study in dairy cows Complete pharmacokinetic study and prepare final report. Develop a Model System to Identify Anti-Inflammatory and Analgesic Drug Cytotoxicy Biomarkers Using Pharmacogenomics There is a need for biomarkers of damage that can be used to compare toxic responses among species. Toxicogenomics may be the most promising approaches to identifying such markers. Using peripheral blood is of specific interest because blood is easily available. Previous studies have shown that sufficient number of nucleated cells supplying mRNA offers the possibility to use peripheral blood for gene expression studies. After a compound has been delivered, blood cells are exposed to significant concentrations of this target agent because drugs or chemicals are distributed via the blood stream and ‘direct’ blood functions such as immunomodulation can be studied by gene expression analysis. More intriguing is the search for biomarkers in the blood that are predictive for toxic events in target organs, which cannot regularly be studied by gene expression analysis. Identifying cross-organ biomarkers is the first step in identifying cross-species biomarkers. One class of cross-organ biomarkers consists of genes that are simultaneously altered in both blood and the target organ. Nucleated cells of peripheral blood and the cells of the true target organ must have a similar transcriptional response. Since basic mechanisms of toxicity are described in a variety of organs, it is likely that different cell types should exhibit overlapping gene expression responses to toxic stimuli. Additional classes of biomarkers have been identified by studying pathways instead of single genes; however, the number of genes and their signaling pathways that have been linked to toxicological mechanisms is minimal. Finally, peripheral blood is systemically delivered to almost all organs through the body, allowing communication between blood cells and diverse target or effector cells of the entire organism. Therefore, gene expression in blood cells may respond to changes in other organs. This study will generate genomic anti-inflammatory and analgesic drug toxicity biomarkers for major and minor species. The goals of this study are to 1) generate pharmacogenomic data sets and identify biomarkers for dexamethasone and acetaminophen toxicity using FDA’s ArrayTrack and Gene Logic’s BioExpress® System data analysis tools; 2) validate gene sets by RT-PCR; and 3) develop assays to provide molecular toxicity evidence beyond traditional endpoints. The following personnel are responsible for this study: Haile F. Yancy DAR staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 1.0 09 1.0 10 0.3 Establish toxicity levels for dexamethasone and acetaminophen in cow blood cultures, , generate toxicogenomics data, identify biomarkers, and validate gene sets by RT-PCR. Initiate validation of dexamethasone and acetaminophen toxic biomarkers in dog, rat, mouse, chicken, and pig. Complete validation study. Develop Alternative Ivermectin-Sensitive Model Systems – A Critical Path Study The MDR-1 gene encodes for P-gp, a transmembrane efflux protein that affects the absorption, distribution and elimination of certain drugs. P-gp is a member of the ATP-Binding Cassette (ABC) transport protein family, which are efflux pumps that remove select agents from within the cell. P-gp is part of a family of efflux transporters found along the intestinal tract, in the kidneys, biliary system, brain and other organs. A mutation in the MDR-1 gene is known to occur in several dog breeds. Since P-gp is an important efflux transporter for a wide range of compounds, dogs homozygous recessive for the MDR-1 mutation may have altered pharmacokinetic and toxicity profiles for P-gp substrates including avermectins. Most importantly, life threatening toxicity has been reported when certain P-gp substrates are administered to dogs that are known to be homozygous for the MDR-1 mutation. In addition, there are anecdotal reports of heterozygote animals also expressing toxicity to some P-gp substrates and a small set of homozygous recessive genotype animals do not express the expected sensitive phenotype. Currently, using Collies is the only avenue of establishing if new drugs can be toxic. Due to a diminishing number of available ivermectin-sensitive Collie colonies, it is becoming difficult for drug sponsors to get the dogs needed to test the safety of new avermectins. Therefore alternative screening procedures are needed to identify potential P-gp substrates and to address safety concerns. This project will develop alternative in vivo and in vitro models that may be used in lieu of ivermectinsensitive collies to confirm the safety of new and combination new animal drug products. The goals of this project are to 1) determine whether the comparative pharmacokinetics of several known P-gp substrates are substantially different when administered to dogs that are homozygous recessive, heterozygous or the wild-types; 2) develop in vivo and in vitro systems that can be used to identify P-gp substrates; and 3) to validate the new model systems as a suitable replacement for the ivermectin-sensitive Collies. The following personnel are responsible for this study: Haile F. Yancy Yolanda Jones Nadia Francis (ORAU Fellow) Michael Myers The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 Design and create the MDR1 Knock-in/MDR1 beta Knock-out mouse line expressing canine MDR1 mutated cDNA. 2.5 0.3 10 0.2 Determine whether the comparative pharmacokinetics of several known P-gp substrates are substantially different when administered to dogs that are homozygous recessive, heterozygous or the wild-types. Continue creating the MDR1 Knock-in/MDR1 beta Knock-out mouse line expressing canine MDR1 mutated cDNA and begin validation studies. Antimicrobial Resistance Mechanisms Since the introduction of antimicrobials into veterinary medicine some 60 years ago, animal health and food animal productivity have improved significantly. Due to the emergence and dissemination of antibiotic-resistant foodborne bacterial pathogens, there is an increased public and scientific interest in the public health impact of agricultural antimicrobial use. Bacterial antimicrobial resistance is a serious problem worldwide in both the medical and agricultural fields. Resistance mechanisms have been identified and described for all known antimicrobial agents currently available for clinical use. This situation is being addressed by FDA, AVMA, and USDA who have developed judicious use guidelines and implementing strategies to head off this potential threat to veterinary medicine. The development of bacterial antimicrobial resistance increases the potential to distribute multiple antimicrobial resistance genes to susceptible bacterial populations. Bacterial antimicrobial resistance usually develops by means of chromosomal mutations or by the acquisition of large, transferable, extrachromosomal DNA elements called plasmids, which may carry many resistance detemrinants. Plasmids may contain additional DNA mobile elements such as transposons and integrons. Integrons contain one or more contiguous resistance genes, acquired as mobile gene cassettes. These cassettes are inserted in various arrangements between two conserved DNA regions, creating tandem arrays of different antimicrobial resistance genes. Over 50 gene cassettes and four distinct classes of integrons have been identified to date. The various DNA mobile elements possess genetic determinants for several different antimicrobial resistance mechanisms, and may be responsible for the rapid dissemination of resistance genes among different bacterial genera and species. In addition to antibiotics, some of these elements contain genes encoding resistance to disinfectants and heavy metals. This raises the possibility that there multiple selection pressures that maintain these linked phenotypes. As is the case for related bacterial infections in humans, therapeutic options for treatment of some animal diseases are decreasing. It is, therefore, essential that we identify, evaulate, and implement prevention strategies and infection control measures to reduce or eliminate the health hazard posed by antimicrobial resistance. Understanding the molecular basis of antimicrobial resistance gene acquisition and transmission among veterinary bacterial pathogens will help improve antimicrobial treatments strategies and management practices to preserve the potency of antimicrobials for future use. Determine Microbial Ecology of Antibiotic Resistance Development and Dissemination in the Food Animal Production Environment Animal production practices rely on the use of antimicrobials to treat and prevent infectious diseases. The extent to which antimicrobial use in animals influences the development of resistance among zoonotic pathogens is unclear. These studies seek to address some of the gaps in our understanding by examining the consequences of antibiotic use in animals on susceptibility changes among the animal’s intestinal flora. The goal of this research is to determine the effects of antimicrobial use in animals on the development of resistant bacteria within the context of a normal production environment. We will first establish the baseline susceptibilities of important endogenous bacteria, then study the emergence and spread of resistance following antimicrobial treatment. In addition, we will study the dissemination and stability of antibiotic resistant organisms once they are established in the environment. This identification of specific organisms involves sampling the animals, their water, excreta, feed, and other possible routes by which these bacteria can enter the environment. This project will help answer a number of questions using the basic protocol and changing one dependent variable at a time: What are the dynamics of resistance in this environment once the drug of choice is removed from the environment? Do the resistant organisms persist or do they disappear or diminish in the environment? What happens to the resistance determinants after they appear in the environment? Are they transferred to other organisms present? Which organisms? And at what rate? How well do these organisms survive in litter/bedding? How important is feed as a source of pathogenic or resistant bacteria? How does the continuous use of litter/bedding between flocks or herds affect the flora of newly placed animals? Is there any intervention strategy that can be used to minimize or eliminate resistance in this environment? Can selective pressures reinstate the prevalence of the resistant bacteria? Many factors must be considered in designing these studies, such as the animal species being treated, the bacterium being targeted, and the antibiotic being administered. The large number of veterinary drugs, some with human analogues, require investigations designed according to the particular usage considerations. These studies address basic questions about the impact of drug use in a normal foodanimal production environment, and help establish a framework for designing mitigation strategies to reduce resistance. The following personnel are responsible for this study: Patrick McDermott OR Staff The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 1.0 10 1.0 11 1.0 Initiate new studies examining the impact of drug use in food animal species Initiate studies different antimicrobials used in food animal species Complete laboratory phase of in vivo work Use Molecular and Biochemical Methods to Determine the Animal Origin of Foodborne Bacterial Pathogens Bacteria belonging to the genus Salmonella cause a majority of the cases of acute bacterial diarrhea in the US and other countries throughout the world. The vast majority of these infections originate in foods of animal origin. This bacterium is part of the normal intestinal microflora of a large number of animals, including those raised for human consumption. Thus, it is not uncommon for foods derived from animals to become contaminated with Salmonella. Consequently, improper cooking or handling of animal derived food products can result in human illnesses. These illnesses range from mild self-limiting cases to severe systemic illness that may be fatal. In recent years, 31% of the deaths resulting from bacterial foodborne illnesses have been caused by Salmonella. In order to elucidate possible sources of Salmonella attributable to human foodborne disease, phenotypic typing methods such as serotyping, antibiograms, and biochemical profiling have been applied to isolates from animal and environmental sources, as well as clinical strains. Because bacteria from diverse sources may have the same biochemical profile or antibiogram, epidemiological traceback conclusions based on only these typing methods are often tentative. To better identify reservoirs of infection and to strengthen the links between pathogens from various sources, numerous genetic typing methods have been investigated. These methods exploit differences in the DNA base sequence between different strain types. By using a combination of genotypic and phenotypic methods, it has been possible to identify evolutionary clusters of strains and to monitor the spread and persistence of strains within defined environments (e.g., poultry houses). This research program will examine relationships between genetic characteristics (e.g., DNA sequence Multi-Locus Sequence Typing (MLST) and genetic relatedness tree modeling, Multi-Locus Variable Number Tandem Repeat Analysis (MLVA), single and second enzyme pulsed-field gel electrophoresis (PFGE), microarray, and phenotypic characteristics (e.g., serotype, antimicrobial resistance) of Salmonella isolates from various sources in order to identify characteristics that will enable epidemiologists to determine the animal of origin of a Salmonella isolate associated with a human illness. Identifying the source of Salmonella associated with a specific human illness is a prerequisite for intervention and infection control. The utility of a particular characteristic for typing is related to its stability within a strain and it's diversity within the species. Since reproducibility is one of several criteria in evaluating the usefulness of a typing system, a large number of strains will be examined so that inferences about clonal ancestry can be formed. The following personnel are responsible for this study: Heather Harbottle DAFM staff The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 1.0 10 1.0 11 1.0 Continue 08 studies. Test other methods for source tracking. Expand the number of strains/serotypes of animal origin to be typed. Expand the study to examine isolates of other Salmonella serotypes and other foodborne zoonotic bacteria. Continue development and testing of a DNA microarray platform Continue the studies with human isolates and compare the results with isolates from food animals. Continue analysis using differentmicroarray designs Analyze large numbers of strains from various sources using microarray and other methods to detect genetic differences. Interrogate Salmonella Diversity Using a Novel 35 Genome Salmonella Species Microarray – A Critical Path Study In order to elucidate possible sources of Salmonella attributable to human foodborne disease, phenotypic typing methods such as serotyping, antibiograms, and biochemical profiling have been applied to isolates from animal and environmental sources, as well as clinical strains. Because bacteria from diverse sources may have the same biochemical profile or antibiogram, epidemiological traceback conclusions based on only these typing methods are often tentative. To better identify reservoirs of infection and to strengthen the links between pathogens from various sources, numerous genetic typing methods have been investigated. These methods exploit differences in the DNA base sequence between different strain types. By using a combination of genotypic and phenotypic methods, it has been possible to identify evolutionary clusters of strains and to monitor the spread and persistence of strains within defined environments (e.g., poultry houses). This research program will examine relationships between genetic characteristics (e.g., DNA sequence Multi-Locus Sequence Typing (MLST) and genetic relatedness tree modeling, Multi-Locus Variable Number Tandem Repeat Analysis (MLVA), single and second enzyme pulsed-field gel electrophoresis (PFGE), microarray, and phenotypic characteristics (e.g., serotype, antimicrobial resistance) of Salmonella isolates from various sources in order to identify characteristics that will enable epidemiologists to determine the animal of origin of a Salmonella isolate associated with a human illness. Identifying the source of Salmonella associated with a specific human illness is a prerequisite for intervention and infection control. The utility of a particular characteristic for typing is related to its stability within a strain and it's diversity within the species. Since reproducibility is one of several criteria in evaluating the usefulness of a typing system, a large number of strains will be examined so that inferences about clonal ancestry can be formed. The following personnel are responsible for this study: Heather Harbottle DAFM staff The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 1.0 10 1.0 11 1.0 Continue 08 studies. Test other methods for source tracking. Expand the number of strains/serotypes of animal origin to be typed. Expand the study to examine isolates of other Salmonella serotypes and other foodborne zoonotic bacteria. Continue development and testing of a DNA microarray platform Continue the studies with human isolates and compare the results with isolates from food animals. Continue analysis using differentmicroarray designs Analyze large numbers of strains from various sources using microarray and other methods to detect genetic differences. Investigate Effects on Microbial Flora of Oxytetracycline Fed to Tilapia Held in a Recirculating System All drugs approved for aquaculture must be reviewed for potental effects on the environment and non-target species. In addtion, there have been concerns about the potential for aquaculture drug use to induce changes in antimicrobial susceptibility in aquatic bacteria, with potential negative impact on human health. Few studies exist which have investigated the effects of antibiotics in aquaculture systems on the fish’s bacterial flora and the pattern of antibiotic susceptibility in those bacteria. In addition, there is limited information on the effects of antibiotic use in aquaculture on bacteria located in the water column and sediments. Tilapia are a very important aquaculture species raised for human consumption. Currently, there are no antimicrobials approved for use in tilapia and there is an effort to expand the current approval for oxytetracycline to other fish species, including tilapia. This study is designed to investigate the effects of oxytetracycline (OTC) medicated feed on bacteria isolated from tilapia housed in a recirculating life-support system. Specifically, we are examining the effect of repeated OTC treatment (2.5 – 3.75 grams per 100 pounds of fish per day for ten days /kg) on bacteria (B. cereus) isloated from the feces and filter water. Organisms will be identified by fatty acid methyl ester (FAME) analysis and genetic relatedness using enzyme pulsed-field gel electrophoresis (PFGE). Antimicrobial susceptibility will be assessed using E-test and microbroth dilution test methods which were developed by CVM scientists. These organisms will be compared to (B. cereus) isolated from feeds used in this study. This study will provide data about antimicrobial susceptibility profiles during and after treatment, that will be useful for developing guidance for industry, which defines protocols that can be used for pre-approval studies discussed in the CVM framework document. The following personnel are responsible for this study: Renate Reimschuessel Charles Gieseker Eric Evans ORAU Fellow The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.5 10 0.5 Complete FAME analysis of all B. cereus strains, complete antimicrobial susceptibilty testing of all isolates using E test and microbroth dilution methods, Complete final report Immunopharmacology Immunopharmacology focuses on the bi-interaction of drugs used in veterinary medicine and the immune system. The purpose of this program is to determine the effect of infectious diseases, e.g., viral, bacterial, parasitic, on pharmacokinetic parameters typically associated with drug use in domestic animals. An immune response initiates the cascade production of numerous cytokines and other mediators of inflammation. Mediators released in response to infection and disease, especially cytokines, show in rodent models and in man to alter the components responsible for drug disposition, metabolism and elimination. Thus, initiation of an immune response to microbial infections will potentially lead to altered pharmacokinetics and or drug efficacy. Changes such as these could potentially result in either unacceptable violative residues in animal-derived food or drugs which now have altered efficacy or toxicity. Results from this program will aid the mission of the Agency to assure a safe food supply by identifying factors affecting drug safety and efficacy in target animals and human food safety. Work performed in rodent models and in humans has clearly demonstrated that almost all infections, whether bacterial, viral, parasitic, or fungal, can affect various aspects of drug pharmacokinetics. The basic mechanism for this effect is the appearance of cytokines and other inflammatory mediators produced as a consequence to microbial invasion. The infectious agent itself does not usually affect pharmacokinetic parameters. The production of these host factors influences drug disposition in two distinct manners. The first mechanism involves active suppression of the production of Phase 1 and Phase 2 drug metabolizing enzymes. The second mechanism involves the alteration of various pharmacokinetic parameters distinct from the effect on metabolism, e.g., volume of distribution, clearance. During an infectious disease, either or both mechanisms may be in effect, depending upon the drug. Changes in drug metabolism are a consequence of cytokine action at the gene level, whereas changes in other pharmacokinetic parameters may be due to either temporary changes, e.g., altered blood flow, or permanent changes, e.g., end organ damage. The net effect of all these changes is either elevated, and possibly violative, drug residue levels, even though FDA approved withholding times were followed, decreased drug efficacy, or increased drug toxicity. However, apart from a few other published studies, minimal work outside OR has been conducted. The effect of disease processes on drug pharmacokinetics in food-producing animals has been determined in this program by using natural and artificial infectious disease models. This work will help to establish infectious disease models for use by regulated industry. The other aspect of this research program focuses on inadvertent modulation of the immune system as an unintended consequence of drug administration. In addition to strictly drug-induced immunomodulation, the complex interactions of environmental factors, e.g., diet, sanitation, environmental toxicants, together with drugs commonly used in animal husbandry/veterinary medicine, can all serve to modulate the normal homeostasis of the immune system, either alone or in various combinations. The goals of this aspect of the research program focus on ascertaining the extent to which drugs and xenobiotics will inadvertently alter the normal homeostasis of the immune system in food-producing animals. This effort also necessitates the development of rapid and sensitive methods for assessing immune homeostasis. As a spin off of this aspect of the program, some of these methods can be used to assess immune homeostasis during an ongoing infectious disease for use as an alternative measure of anti-infective agent efficacy. Determine Effects of Endotoxin and NSAIDs on Inflammatory Cytokines The FDA/CVM establishes policy for the manufacturing of sterile, pyrogen-free animal pharmaceuticals (injectables) documented in the CVM Policy and Procedures Guidance 1240.4122. The Center has adopted the rabbit pyrogen test (RPT) and limulus amebocyte lysate (LAL) test for monitoring for the presence of pyrogenic substances. The RPT determines a non-specific febrile response to pyrogens, while the LAL test specifically identifies endotoxin (lipopolysaccharide - LPS) and may not detect other potential pyrogens. However, the biological relevance of these tests as it relates to animal exposure is not well understood. There are significant species differences in the magnitude and the type of response to endotoxin, which is further complicated by the dramatic size differences and volumes of pharmaceuticals administered for the treatment of the various domestic species. In light of this, the CVM has assumed a conservative approach to regulating animal drugs based upon the sensitivity of the benchmark testing procedures, and the permissible levels of pyrogen (endotoxin) in manufactured drugs are not specifically mentioned. The purposes of the current study are to: 1) investigate the physiologic response (primarily body temperature response) of cattle challenged with known low-level concentrations of bacterial endotoxin (E. coli), which can then be correlated with responses measured in standard/approved pyrogen testing methods; and 2) identify the lower limit of responsiveness (threshold or "window") to endotoxin in cattle for guidance in the production of sterile, pyrogen-free pharmaceuticals. Three groups of 8 dairy steers will be challenged with one of three concentraions of E. coli endotoxin (1 µg/kg, 0.25 µg/kg, 0.03 µg/kg) and their body temperature and other physiological variables will be monitored and recorded. Calves can be utilized for additional dosing experiments following a 3 to 4 week "wash-out" period, and additional concentrations of endotoxin may be examined in order to more accurately define the threshold for response. Jeffrey Ward DAR Staff Julie Bailey, CVM/ONADE The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 1.5 Coduct study with 30 stees and three levels of endotoxin; evaluate other endotoxin concentrations, if needed, to find response threshold In a separate effort, research is continuing to identify suitable biomarkers for use in clinical trials of anti-pyretic and anti-inflammatory drugs. We have completed the animal phase of a study that used an E. coli mastitis model in dairy cattle to identify proteins that were modulated during coliform mastitis. Proteomic techniques including 2D gel electrophoresis followed by MALDI-TOF analyses of tryptic peptides were used to identify proteins that were significantly up-regulated in bovine milk in response to E. coli. Follow-up investigations are being conducted to determine the effects of administration of anti-inflammatory drugs on the relative abundance the identified candidate proteins using peptide labeling strategies followed by LC-MS/MS. In addition to analysis via mass spectrometry, a small number of candidate proteins will be evaluated using antibody-based techniques including ELISA to determine if any of the proteins up-regulated in bovine milk during coliform mastitis are suitable markers of inflammation that may be used in evaluating the efficacy of NSAIDs. The following personnel are responsible for this study: Jamie Boehmer Jeffrey Ward Michael J. Myers DAR Staff Janis Messenheimer, CVM/ONADE The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 1.0 Complete the laboratory phase and final report. A separate study has been initiated in swine to identify biomarkers of NSAID efficacy, using a combination of biochemical tests, genomic techniques, and flow cytometry. Two separate swine inflammations will be developed that mimic either a systemic or local inflammatory reaction. Using microarray technology, we have identified several genetic markers that exhibit long term changes following in vitro stimulation of porcine blood cells with endotoxin. These markers will be used to determine the impact of Banamine on their expression during an in vivo inflammatory response. In adddition to these genetic markers, we will be evaluating the impact of Banamine on the production of biochemical measures of inflammation such as PGE2, Bradykinin, and Substance P. In collaboration with colleagues at CFSAN, we will also be evaluating changes to white blood cell surface proteins as another functional measure of inflammation and the impact of Banamine on those markers. While most of the research efforts to date have been performed in food animals, efforts will be made to apply the knowledge gained in these studies to companion animals. The following personnel are responsible for this study: .. Michael J. Myers .. Haile Yancy .. Dottye Farrell .. Sharla Peters, ORAU Fellow .. DAR Staff .. Janis Messenheimer, CVM, ONADE .. Uma Babu, CFSAN The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 1.0 10 Develop protocol to identify biomarkers of inflammation and pyrexia in companion animals that will be used to determine NSAID efficacy 1.5 0.2 11 1.3 Conduct study in swine to evaluate impact of NSAIDs on biomarkers of inflammation and pyrexia in swine. Complete in vivo study on impact of NSAIDS during inflammation and pyrexia in swine. Conduct study to identify biomarkers of inflammation and pyrexia in companion animals that will be used to determine NSAID efficacy Metabolism and Residue Depletion The shortage of drug availability for minor food animal species is well recognized by the Center for Veterinary Medicine. In order to facilitate the approval of drugs in aquatic animals, CVM’s Office of Research has begun metabolism studies for identifying a marker residue (MR) potentially present across multiple fish species. Since the metabolism of a compound may vary due to a number of parameters including species, FDA requires radiotracer studies to identify MR in each distinct species for which a sponsor is seeking approval. Before approving a compound for use in food-producing animals, FDA also requires that the sponsor provide an acceptable analytical method capable of reliably measuring the marker residue to ensure that total residue of toxicological concern is not exceeded. We will develop metabolism data and establish a MR for use in support of the development of regulatory analytical methods for veterinary drugs across multiple fish species. This approach will provide a sounder basis for the choice of an analytical method in a species or a group of fish species which have the same MR. By reducing the need to develop analytical methods for each species, we can speed the drug approval process for various aquaculture species. Additionally, this work should stimulate more sponsors to develop drugs for fish used for human consumption. Residue depletion studies of known marker residues are also conducted in various fish species in support of validation of regulatory analytical methods. We routinely coordinate our efforts with those of the National Research Support Project No. 7 (NRSP-7) and participate in their workshops which provide a forum for exchange of ideas among minor species producers, drug manufacturers, researchers, and government agencies on approaches to disease problems and drug priorities. Residue depletion studies are also conducted in support of guidance development for various manufacturing and human food safety questions. Determine Marker Residues of Selected Veterinary Drugs in Edible Aquatic Species In an effort to determine the marker residue (MR) of ivermectin in various finfish species, we will conduct its comparative metabolism and residue depletion studies in various species of fish that are of importance to the U.S. aquaculture. Radiolabelled ivermectin will be used to assist in defining the MR. The literature studies on in-vitro drug metabolizing enzyme activities reveal that different fish species vary in their capacity to metabolize drugs. The metabolism and residue depletion studies will allow us to ascertain fish species with similar or dismiliar metabolic profiles and allow us to identify potentially a common MR of ivermectin in multiple species of fish. Identification of a MR will allow us to develop analytical methods for regulatory monitoring. Additional veterinary drugs, based on the need identified by aquaculture subgroups, may be studied for finding MR in aquatic finfish species. Our results on the metabolism and residue depletion study of 3H-ivermectin in rainbow trout, Atlantic salmon, tilapia and channel catfish showed that an unknown metabolite is a potential MR in the muscle tissue of rainbow trout, whereas, parent drug ivermectin is the MR for the other three species. Mass spectrometry and liquid chromatography results indicate that the unknown metabolite may be 3’-O-demethyl-ivermectinB1a. This suggests that rainbow trout metabolizes ivermectin differently than Atlantic salmon, tilapia and channel catfish. In other food animals (cattle and sheep), the parent ivermectin is known to be the MR in their muscle tissue. Metabolism studies of Hivermectin in other fish species, hybrid stried and large mouth are in progress. 3 The following personnel are responsible for this study: Badar Shaikh Nathan Rummel Renate Reimschuessel Charles Gieseker Eric Evans The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 Laboratory phase – (a) Complete HPLC analysis of the incurred 3H-ivermectin in muscle tissues of tilapia, catfish and Atlantic salmon; (b) Initiate Total Radioactive Residue (TRR) and HPLC analysis of the incurred 3H-ivermectin in muscle tissue of HSB; (c) Continue isolation and characterization of a potential marker residue (MR) of ivermectin in rainbow trout muscle using LC & MS. 2 10 2 11 2 Animal phase – (a) Complete dosing of 3H-ivermectin to hybrid striped bass (HSB) and large mouth bass (LMB) for full metabolism study; (b) Complete dosing of rainbow trout with non-labeled ivermectin for characterization of the unknown metabolite in muscle. Laboratory phase – (a) Complete TRR and HPLC analysis of incurred 3Hivermectin in the muscle tissue of HSB; (b) Initiate/complete TRR and HPLC analysis of the incurred 3H-ivermectin in the muscle tissues of LMB. Laboratory phase – Initiate/complete TRR analysis of 3H-ivermectin in plasma, bile, liver , kidneys and scales of tilapia, rainbow trout, atlantic salmon, catfish, HSM and LMB. Method Development for Improved Drug Residue Testing Currently, NADA sponsors are required to provide FDA with analytical methods to quantify and confirm the presence of drug residues when a product is approved for use in a food producing animal. These methods are validated through a method trial to establish that the method performs as claimed, that this performance is fit for the intended purpose, and that the technology can be transferred successfully. The methods are the same used to establish the tolerance of the drug. The approach has served the Agency well; however several issues have developed that need to be addressed. The USDA Food Safety and Inspection Service (FSIS) needs to conduct meat industry surveillance activities using methods that are traceable to the original tolerance. Because technology changes, methods become obsolete. Equipment is no longer available. Some reagents are no longer be used because of environmental and occupational health considerations, Simpler, faster, and safer laboratory techniques are available. Some of the oldest methods, developed before the advent of many modern analytical techniques, are based on total microbiological activity of an extract for which the exact composition is unknown. As drug sponsors develop individual methods for each drug approval, regulatory laboratories have spend scare resources switching between methods including the development of the needed quality control and validation data to demonstrate that the analytical result is valid. Often this causes delays in the analysis of product. Because the tolerance developed for a drug is directly linked to the method, the relationship between the concentration measured using the original and any new method must be established. The approach taken in the past to develop the needed information has required the direct comparison of analytical results based on the analysis of split samples containing incurred residues, referred to as a bridging study. While this approach is scientifically rigorous, the complexity and resources required for the needed studies has greatly limited the number of bridging studies that have been conducted. The approach also requires bridging studies to be conducted whenever methods are changed. It is necessary to he initial step in addressing these issue involves developing the information needed to compare the performance of the oldest microbiologically based methods testing total residue of unknown composition with newer chemistry based methods. Because the microbiological activity in the residue may be due to both the drug and metabolites, a linear relationship between a specific marker and the microbiological activity may not exist. A second goal of the research is to develop data that will support the use of rapid screening tests, such as used in the milk industry, to test meat for drug residues. FSIS would be responsible for implementing new multi-residue quantitative or semi quantitative screening tests at the plant. The use of better screening tests would minimize the number of samples tested by traditional chemical based assays for both determination and confirmation. Methods in support of NADAs will continue to be evaluated. Typically, the developing laboratory is not involved in the analysis of regulatory samples. The laboratories using the methods usually do not have the same equipment, access to the method developer, or time and resources to modify flawed methods. Usually, the only information available to the scientist using the assay is what is written in the method. Additionally, the scientist developing the method often is an expert in a particular analytical technique; whereas, the scientist using the method is a generalist, and must be able to analyze a wide assortment of samples using a variety of analytical methods. The validation process evaluates the transferability of a method into a regulatory environment, determines that the methods are suitable for the intended use, and ensures that the written method is clear, complete, and free of ambiguity. The use of LC-MS/MS methods to quantify drug residues has become widely accepted in recent years due to ease of method development and higher sample throughput. However, these LC-MS/MS methods face some unique problems when transferring to other instruments. The design of each manufacturer's ion source is proprietary and the performance of sources can vary widely in instruments from different manufacturers or even in different models from the same manufacturer. Additionally, the sample matrix present in the extract can significantly change the intensity of the analyte signal. Research is being conducted at OR to investigate matrix effects and develop some tools to help method developers minimize the impact of matrix effects on method transferability. Assessing and controlling matrix effects in LC-MS/MS are significant issues for the entire bioanalytical community, including human drug studies. This research has the potential to not only improve the transferability of methods in CVM method trials but to improve the quality of the data generated throughout the bioanalytical community that FDA depends on for many of its regulatory decisions. Providing Better Regulatory Methods OR scientists are working with ONADE, OS&C, and FSIS to design and implement a program to replace obsolete methods with new updated technology. Ideally, multiresidue, multiclass methods base on methods currently used by FSIS will be the basis of the new methods. In FY09, a method will be developed for penicillin G in bovine tissue. While the research will focus on a single analyte, the chromatography and extraction techniques will be designed to allow the incorporation of additional drugs into the method. Knowledge gained in the development of multiresidue methods within the Office of Research will allow the method to be designed to be easily updated with new compounds. The project will serve as the prototype for designing studies to provide updated official methods for use in regulatory purposes. The method will be bridged to the official microbiological penicillin method. The bridging study will require the use of incurred residues. The following personnel are responsible for these studies: Mayda López Philip Kijak Linda English DAR Staff The following table presents the objectives and the title of the study. FY OBJECTIVE/STUDY TITLE FTE 09 Familiarize and validate the original microbiological method for penicillin G in bovine kidney. 1.0 0.5 Develop and validate a quantitative and confirmatory method for the analysis of penicillin G and other ß-lactams, tetracyclines, macrolides, sulfonamides, and aminoglycosides in bovine kidney. FY OBJECTIVE/STUDY TITLE Run a pilot study to gather data to help design the bridging of the new chemical based method to the obsolete microbiological method. 1.0 10 Begin evaluating the method with additional drugs 1.5 1.0 11 Bride additional drugs added to the new method back to the obsolete methods 1.0 1.5 Bridge the new chemical method for penicillin G in bovine kidney to the microbiological method. Complete the evaluation and documentation of the bridging study and transfer the chemical method to FSIS Labs. Develop Drug Specific Methods The Office of Research supports MUMS by assisting in method development and validation for needed drug specific methods. In 2001-2004, OR scientists working under a interagency agreement with the USGS, developed a confirmatory method for the marker residue of chloramine-T, p-TSA, in publicly aquacultured fish species. Currently, we have been requested by the Aquaculture Drugs Team in ONADE Division of Therapeutic Drugs for Food Animals to assist in the development of a method for erythromycin in salmon feed. The drug sponsor is developing a research method. OR scientists will modify the research method for regulatory use and validate the method. The project is being coodinated by the USGS Idaho Cooperative Fish and Wildlife Research Unit, University of Idaho. The following personnel are responsible for this study: Philip Kijak DRC staff Renate Reimschussel FY OBJECTIVE/STUDY TITLE FTE 09 1.0 10 0.5 Modify and validate the method for use in the determination of erythromycin in salmon feed Conduct a method trial of the erythromycin in salmon feed method Method Development in Support of Minor Use Minor Species The need to increase the availability of drugs for minor species has been recognized by the recent passage of The Minor Use and Minor Species Animal Health Act of 2004. By developing methods that can be used “off the shelf” for the quantitation and confirmation of a drug in a minor species, both the Agency and the sponsor will benefit. Multiresidue and multiclass methods enable regulatory agencies to efficiently use resources in enforcing residue tolerances. The need to develop analytical methodology is a major cost incurred by a sponsor submitting a drug for approval which can be minimize or eliminated by the use of an existence of a validated method for the compound of interest or which can easily accommodate the addition of a new compound. By providing tools that both the Agency and drug sponsor can use, the research supports the Agency’s Critical Path initiative. Additionally, it can serve as a model of an alternative approach for the development of all regulatory drug residue methods. The current approach to the development of drug residue methods is expensive, sometimes delay the approval of needed drugs, and does not provide efficient methods for the enforcement. The availability of multiclass methodology increases the efficiency of regulatory agencies and enhances their ability to protect the nation’s food supply. Develop Multiresidue Methods The main emphasis of this program is to develop multiresidue and multiclass methods. Existing multiresidue methods for veterinary drug monitoring are for single classes of drugs, e.g., macrolides, avermectins, tetracyclines. These methods were possible because similar chemical structures enabled a single extraction, purification, and detection scheme. The advent of liquid chromatography/mass spectrometry (LC/MS) instrumentation at prices within the range of routine analytical laboratories changed this situation. MS is a “universal” detector. It is possible to set up conditions that will, within a single chromatographic analysis, detect a wide range of compounds. The high specificity of the MS detector also means that simpler, more “universal,” extraction and purification procedures may be used prior to analyzing the extract. Much of the salmon, shrimp and catfish eaten in the US is a product of aquaculture. Current methods in routine used are capable of monitoring for only a limited number of drugs in aquacultured products using labor intensive procedures. The method developed for the screening and confirmation of mulitple drug residues in shrimp is being evaluated in the ORA Denver laboratory. We have completed developing a screening/confirmation method for finfish such as salmon and catfish. In order to have methods capable of enforcing import tolerances, we plan to extend the multiresidue multispecies methods for shrimp and finfish to include quantitation capability. We have successfully developed and validated a multiclass, multiresidue method that can quantify and confirm the presence of the following antibiotics in honey: tetracycline, chlortetetracycline, doxycycline, oxytetracycline, ciprofloxacin, danofloxacin, difloxacin, enrofloxacin, sarafloxacin, tylosin, lincomycin, streptomycin, sulfathiazole, fumagillin, and chloramphenicol. Erythromycin and monensin can be detected and confirmed but not quantitated. The method was validated using both fortified and incurred honey. Before the method can be used for regulatory purposes, the validation of the method by an independent second laboratory is needed. New drugs to treat diseases in bees are being tested by the ARS Bee Laboratory in Beltsville and by other laboratories across the US. In addition, recent reports of findings of other non-approved drugs in honey make it imperative that the method be extended to include these additional drugs. Future research in the development of multiclass multiresidue methods will continue to be in support of the FDA Critical Path Initiative. For example, the multiresidue approach can be applied to drug residue detection in veal calves. As with aquacultured species, multiresidue methods have the potential to provide both drug sponsors with off the shelf methods to decrease the development costs and the regulatory laboratories with more efficient tools for enforcing tolerances. The following personnel are responsible for this study: Mary Carson Philip Kijak Hui Li Mayda Lopez Cristina Nochetto Shani Smith The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 Complete development of quantitative multiresidue method in shrimp 0.25 1.0 10 Transfer the multiresidue/multiclass honey method to FDA field laboratories. Transfer the multiresidue/multiclass shrimp quantitative method to FDA field laboratories. 0.25 0.25 0.25 11 1.0 Transfer the multiresidue/multiclass method in honey to the Florida Department of Agriculture for second analyst check. Write final report on the development and validation of the multiresidue/ multiclass method in honey. Expand the multiclass/multiresidue honey method to include new drugs that are currently being tested to treat bees and to include other non-approved drugs being misused in beekeeping. Method Trials: Chemical The purpose of the method trial is to establish that the method performs as claimed, that this performance is fit for the intended purpose, and that the technology transfer is successful. Typically, the developing laboratory is not involved in the analysis of regulatory samples. The laboratories using the methods usually do not have the same equipment, access to the method developer, or time and resources to modify flawed methods. Usually, the only information available to the scientist using the assay is what is written in the method. Additionally, the scientist developing the method often is an expert in a particular analytical technique; whereas, the scientist using the method is a generalist, and must be able to analyze a wide assortment of samples using a variety of analytical methods. The validation process evaluates the transferability of a method into a regulatory environment, determines that the methods are suitable for the intended use, and ensures that the written method is clear, complete, and free of ambiguity. The use of LC-MS/MS methods to quantify drug residues has become widely accepted in recent years due to ease of method development and higher sample throughput. However, these LCMS/ MS methods face some unique problems when transferring to other instruments. The design of each manufacturer’s ion source is proprietary and the performance of sources can vary widely in instruments from different manufacturers or even in different models from the same manufacturer. Additionally, the sample matrix present in the extract can significantly change the intensity of the analyte signal. Research is being conducted at OR to investigate matrix effects and develop some tools to help method developers minimize the impact of matrix effects on method transferability. Assessing and controlling matrix effects in LC-MS/MS are significant issues for the entire bioanalytical community, including human drug studies. This research has the potential to not only improve the transferability of methods in CVM method trials but to improve the quality of the data generated throughout the bioanalytical community that FDA depends on for many of its regulatory decisions. When participating in a trial, the CVM laboratory serves as one of the laboratories conducting the actual hands-on evaluation of the method. The evaluation includes a review of the written method and the analysis of a series of both known and unknown samples The CVM laboratory plays a crucial role in the sponsor monitored method trial process. Typically, we are the only government laboratory participating in the sponsor’s method trial, and, therefore, serve as the only link between the sponsor who developed the method and the end user, the government laboratories. Additionally, the CVM laboratory conducts the only independent evaluation of a sponsor’s confirmatory procedure. Perform Method Trials for the Analysis of New Animal Drugs Historically, OR participates in one to two method trials for new animal drugs each year. The sponsors of new animal drugs must provide a method for the analysis of the drug if residues at an unsafe level may be present after the approved treatment in the animal. Typically, a regulatory method includes two analytical procedures: 1) the determinative procedure which is used to quantify the drug; 2) the confirmatory procedure which provides a positive identification of the drug. As part of the validation process for the method, the drug sponsor conducts multi-laboratory method trials of the determinative procedure. One government laboratory, usually OR, participates in these trials. In these trials, the Study Director reviews the method, attends a laboratory demonstration of the method at the sponsor's expert laboratory, and completes a validation of the method as defmed in the sponsor's trial protocol. For a single analyte, the Center’s guidelines for method trials typically require a set of thirty samples to be extracted and assayed. Because the data is included as part of the supporting data for the NADA, the studies are done as GLP studies. OR is the only laboratory that evaluates the confirmatory procedures to determine if they meet CVM performance guidelines. Typically, samples are prepared and extracted by the sponsor and sent to OR for analysis. We will perform analyses at OR. OR Division of Residue Chemistry Staff are responsible for this study. The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 0.5 10 0.5 11 0.5 Start and complete evaluation of sponsors’ methods for new animal drugs at CVM laboratory. Start and complete evaluation of sponsor’s method for a new animal drug at CVM laboratory. Start and complete evaluation of sponsor’s method for a new animal drug at CVM laboratory. Microbiological Methods Accurately determining the susceptibility of a bacterium to antimicrobial drugs is of considerable importance to CVM for several reasons. The antibacterial activity of a new antimicrobial compound, submitted by a drug sponsor to the FDA for review, consists of the the drug’s in vitro activity against the target pathogens. The in vitro activity of the drug is the foundation for establishing the dosing regimen and subsequently, the interpretive criteria (i.e., whether a bacterial isolate is susceptible or resistant to the drug). To ensure the accuracy of the susceptibility data, standardized testing methods must be used. Thus, standardized antimicrobial susceptibility testing methods are critical in the antimicrobial drug pre-approval process to ensure that the sponsor used appropriate quality controls. Validated methods are also important, as part assessing the safe use of an antimicrobial in its usage environment, including its effects on other microorganisms. OR scientists are closely involved in validating methods and establishing quality control parameters in association with the Clinical and Laboratory Standards Institute (CLSI). For example, we have conducted studies to develop CLSI standards for antimicrobial susceptibility testing of selected aquaculture pathogens and Campylobacter, including quality control organisms and QC ranges for several antimicrobial agents. This type of research is integral to the Agency’s mission to approve safe and effective animal drugs. Develop Antimicrobial Susceptibility Testing Methods and Interpretive Criteria for Aquatic Animal Microflora In recent years, CVM scientists in our laboratory, in conjunction with CLSI (Clinical Laboratory Standards Institute, formerly NCCLS) developed standardized methods for testing the antimicrobial suscdptibility testing (AST) of aquatic bacteria. There are now two standards: disk diffusion and broth microdilution susceptibility testing methods for group 1 organisms. It is important to continue this effort since fish pathogens include halophilic Vibrio species (Group 2 organisms) and gliding bacteria (Group 3 organisms). We will start with the gliding bacteria, to optimize growth and assay conditions and will conduct collaborative laboratory trials to test some of these methods. Susceptibility breakpoints or interpretive criteria for drugs approved for use in food fish, or for any aquatic bacterial pathogen are currently unavailable. Such breakpoints are invaluable for the clinical interpretation of laboratory susceptibility data, providing a predictor of clinical outcome. We have conducted a study to develop interpretive criteria for oxytetracycline, one of the few FDA-approved antimicrobial agents for use in food fish. We are analyzing in vitro susceptibility, pharmacokinetic and pharmacodynamic (PK/PD) parameters, and clinical efficacy during A. salmonicida infections in trout. This project directly supports current and evolving FDA regulatory effors for aquatic and minor species. Data generated from this study will be useful to ONADE by providing reviewers a more thorough understanding of the correlation observed in vivo and in vitro by establishing susceptibility breakpoints. This will help ONADE’s efforts to comply with the Animal Drug Approval Act (ADAA) to “facilitate more efficient and expeditious approval of NADAs.” In addition, any PK data generated by this study may support efforts to expand drug approvals to other aquatic species. This project represents a key step toward a research solution to an important problem in aquatic animal health, the lack of CLSI-approved susceptibility breakpoints for any aquaculture bacterial pathogens. This study could serve as a foundation for future efforts to establish interpretive criteria in aquaculture not only in the US, but abroad as well. The following personnel are responsible for this study: Renate Reimschuessel Charlie Gieseker Eric Evans DAR staff Ron Miller, CVM/ONADE The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 Conduct bacteriological eradication study to evaluate kill rates and correlate with appropriate in vitro test results. 0.1 0.1 Analyze data from the standard-of-practice or the FDA-approved dosing regime. FY Objective/Study Title Analyze the relationship between PK/PD parameters and drug efficacy as outlined in the CLSI guideline M23-A2 (largely from literature) Develop disk diffusion AST methods for gliding aquatic bacteria: 0.1 0.5 10 0.7 11 0.7 Conduct multilaboratory trials to test disk diffusion method for gliding aquatic micro organisms. Develop microbroth AST methods. Conduct multilaboratory trials to test microbroth method for gliding aquatic micro organisms. Develop Standardized In vitro Antimicrobial Susceptibility Testing Methods for Bacterial Pathogens We develop in vitro antimicrobial susceptibility testing methods to ensure the accurate and reproducible testing of bacterial susceptibility to antimicrobial agents. These methods are performed by exposing a known concentration of a pure bacterial culture to increasing concentrations of a select antimicrobial drug. The endpoint measurement, based on the inhibition of bacterial growth, is reported either qualitatively (susceptible, intermediate, resistant) or quantitatively as the minimal inhibitory concentration (MIC, usually expressed in micrograms per milliliter). To generate reliable and reproducible data, a process of standardization via multi-laboratory studies is required. This effort results in the identification of a suitable quality control (QC) organism and acceptable QC ranges for each antimicrobial agent tested by each testing method, e.g., disk diffusion, broth or agar dilution. OR scientists conduct research in this area in order to improve the quality of antimicrobial data generated for surveillance programs, the drug approval process, to aid clinicians in selecting the appropriate agents, and to provide a means to compare results from different testing laboratories. The following personnel are responsible for this study: Patrick McDermott Sonya Bodeis The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.3 Standardization of in vitro antimicrobial susceptibility testing. Establish testing conditions for disk diffusion (Kirby Bauer) method for testing members of the genus Campylobacter. Evaluate the effects of different components of growth medium. Conduct Molecular Characterization of Foodborne Bacterial Pathogens Isolated from Animals and Retail Meats by Microarray Technology Microarray methods represent the latest advance in molecular technology and offer a discriminatory, highly informative, high-throughput alternative for the parallel detection of hundreds to thousands of genes of interest simultaneously. The application potential spreads across most sectors of the life sciences, including environmental microbiology and microbial ecology; human, veterinary, food and plant diagnostics; water quality control, and industrial microbiology. The technology has been employed successfully for drug discovery, drug evaluation, cancer research, microbial pathogenicity, mechanisms of antimicrobial resistance, as well as genomic “fingerprinting” and detecting genetic polymorphisms of microorganisms. The objective of this study is to develop a DNA microarray for detecting and characterizing antimicrobial resistance genes and other genes of interest in Gram-negative enteric foodborne pathogens isolated from retail meat samples from the NARMS program as well as from humans, and animals. The genes conferring resistance which correlate to common resistance phenotypes as well as important virulence and toxin genes in E. coli, Salmonella, and Campylobacter species will be consolidated on a single DNA chip or investigated more intensely on individual chips. We will screen for the presence of antimicrobial resistance genes in E. coli, Salmonella, and Campylobacter using DNA microarray and determine the correlation between resistance phenotypes and genotypes. The following personnel are responsible for this study: Heather Harbottle Shaohua Zhao DAFM Staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 1.5 10 1.5 11 1.5 Complete preliminary studies, optomizing protocols and procedures. Develop different array designs. Continue studies to optomize protocols investigating antimicrobial resistance genes present, resistant phenotypes, and other virulence traits. Continue to expand studies to include DNA comparative genomic hybridization studies, as well as expression microarrays investigating resistance traits. Pharmacokinetics/Pharmacodynamics Investigate Antimicrobial Pharmacokinetic Differences Between Normal and Diseased Animals The target of antibacterial chemotherapy is the bacterial pathogen causing the disease. The concentration of drug required to inhibit the growth of, or kill, the bacterial pathogen is pathogen dependent. In other words, different bacterial strains, often of the same species, may be inhibited by substantially different concentrations of drug. Bacterial resistance to antibacterial agents is also bacteria and antimicrobial agent dependent. While for some bacteria/antimicrobial agent combinations the selection of resistant strains is not an issue, for others resistant pathogens are readily selected when the concentration of the drug nears the concentration required to inhibit the bacterium's growth (MIC). The length of exposure may also be a contributing factor to the selection of resistant bacteria. The concentration of drug to which the bacterial pathogen is exposed within the site of infection is dependent on the pharmacokinetic behavior of the administered drug in the target animal species. Therefore, it is important to identify those pivotal variables that can affect the pharmacokinetics of the compound in question. In this regard, there is an abundance of information indicating that disease can significantly affect drug activity/availability, distribution, elimination or metabolism. Within the human drug arena, these variables are accounted for by the use of thousands of patients enrolled in clinical trials. However, within the veterinary drug arena, economics necessitate that studies be conducted with a very limited number of subjects (generally no more than 100 per indication). Consequently, it is necessary that CVM use pharmacokinetic/pharmacodynamic (PK/PD) surrogates to ensure that dosage ranges associated with our drug approvals adequately cover the range of situations encountered under actual field use. Unfortunately, essentially all pharmacokinetic data submitted to CVM are generated in normal, healthy animals. Therefore, CVM is unable to validate the assumption that there are unaltered pharmacokinetic parameters in the face of disease for that drug/disease/animal species. Should this assumption be incorrect, we are at risk not only of therapeutic failures, but of equal or greater importance, may also be risking the public health via the inadequate exposure of pathogen to the drug. This in turn, may result in an increased risk of bacterial resistance; therefore, this research is particularly timely given the recently released draft guidance titled “Evaluating the Safety of Antimicrobial New Animal Drugs with Regards to the Microbial Effects of Bacteria on Human Health Concern”. This research will help CVM identify those (if any) classes of compounds where we need to factor disease condition into our human food safety assessments. This information will be invaluable in designing pre-approval studies for assessing the potential for selecting for resistant bacterial strains. These studies will focus on investigating the differences, or similarities, in the pharmacokinetic behavior of antibacterial agents in normal and diseased animals. The pharmacokinetic studies will investigate dosing regimens bracketed around the optimal dose in order to evaluate the effects of drug concentration on clinical efficacy and selection for resistant pathogens and commensals. It will also determine vascular and extravascular drug concentrations as they relate to the MIC of the pathogen, clinical response and changes in MICs. Each aspect of this investigation will be integrated via PK/PD assessments in an effort to optimize our predictions of the dose (amount, duration, frequency) needed to achieve a specific microbial outcome and the risks associated with failure to achieve the targeted level of pathogen exposure to the drug. We have completed pilot study of the macrolide class of antimicrobial agents (tilmicosin), initiated because of current issues being presented to ONADE and the absence of information within either the human or veterinary literature with regard to PK/PD criteria to support the selection of an upper limit to a dosing range. A larger study is underway to examine the effects of disease on tilmicosin pharmacokinetics, as well as to investigate the possible disease effects on the pharmacokinetics of another macrolide (tulathromycin). The order in which these species will be studied will depend upon resource availability within the Office of Research. In addition, the inclusion of sheep as a fourth species is highly recommended to test our current assumption that substantial evidence of effectiveness for minor species can be based solely upon comparable blood drug concentrations. Enrofloxacin was the first therapeutic moiety to be examined since it is currently approved for use in food producing animals and because of issues raised regarding potential human health ramifications relative to its use in these animal species. We are currently conducting a study of the macrolide class of antimicrobial agents (tilmicosin and tulathromycin) because of current issues being presented to ONADE and the absence of information within either the human or veterinary literature with regard to PK/PD criteria to support the selection of an upper limit to a dosing range. The following personnel are responsible for this study: Jeffrey Ward Jamie Boehmer DAR Staff Marilyn Martinez, CVM/ONADE The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.7 Complete the laboratory and pharmacokinetic data analysis for tilmicosin and tulathromycin. Prepare final report. Compare Pharmacokinetics of Small-Ruminant Antiparasitics of Clinical Importance Selection of dosing regimens for sheep and goats are often based on the assumption of close similarity between these two species (and moreover, their similarity to the major speceis, i.e. cattle). The literature suggests a high degree of similarity among domestic ruminants in the distribution and elimination of drugs that are not metabolized, but eliminated by passive processes, such as renal glomerular filtration. However, it is also known that wide differences in metabolic capabilities often exist among the species that are phylogenetically related. There is a wide range of available literature concerning pharmacokinetics and drug disposition of antiparasitics in sheep and goats. For some of the commonly used small ruminant antiparasitic drugs, there is no pharmacokinetic information available that would support proposed dose/dosing regimens. For many of these drugs, data is available in sheep and cattle, but totally lacking in goats, even though they are being used in goats. Those drugs that are approved in goats through use of the minor species act have dosing regimens that simply reflect the major species’ dose. These studies will be used to pharmacokinetically characterize small ruminant antiparasitic drugs so that their doses/dosing regimens are based on the pharmacological understanding of the drugs, rather than assumptions of and extrapolations from their similarities to other drugs/species. . To facilitate comparisons, all drugs were tested in all three species, namely, cattle, sheep, and goats. The following personnel are responsible for this study: Joseph Kawalek Karyn Howard Jeffrey Ward Jamie Boehmer DAR Staff Sanja Modric, CVM/ONADE The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 1.5 Completion of animal phase and analyses of six antiparasitic drugs in goats, sheep, and cattle. Complete data analysis and prepare final report Characterize and Functionally Analyze Bronchial Antimicrobial Peptides Using an Animal Pneumonia Model – A Critical Path Study Antimicrobial peptides (AMPs) are short proteins that possess direct antimicrobial activity. These compounds have been studied extensively in humans and various animal species, where they are expressed largely at the mucosal surfaces of the intestine and lung. They are a component of the innate immune system and demonstrate antibacterial activity across a broad range of both grampositive and gram-negative bacteria. Interestingly, members of this group of compounds are also synthesized by certain bacterial species, and two have been used extensively for several decades – ambicin (nisin; a food preservative) and polymixin B (an antibiotic). Two of the largest classes of vertebrate AMPs, and those that have been studied most extensively, are the defensins and the cathelicidins. These peptides are very attractive candidates for development as therapeutic agents because of their selectivity, broad-spectrum activity, and speed of action. Additionally, it is believed that bacteria will not easily be able to develop resistance to them because of their mechanism of action, which is to disrupt the basic structure of the bacterial membrane. The study of these innate defenses against bacterial infections in the lung may be easily investigated using a bovine pneumonia model in which we have direct access to the airways and their secretions. For the past 5 years we have been performing tracheostomies in beef cattle in order to obtain bronchial fluid for PK/PD analyses of approved antimicrobial agents directed against a common form of bacterial pneumonia. For this study, we used 6 steers that underwent the surgical preparation (tracheostomy), followed by a 7-10 day recovery period. Bronchial fluid was collected for peptide analysis when the cattle were healthy, and again at 6, 12, and 24 hours after the induction of pneumonia (direct instillation of M. haemolytica into the lungs.) Four steers were infected and two served as uninfected (sham) controls. Two-dimensional gel electrophoresis was performed to identify proteins that were stimulated by the infection. Proteins excised from the gels, and/or raw bronchial fluid, were subjected to trypsin digestion and the resulting peptides analyzed by liquid chromatography followed by tandem mass spectrometry (LC-MS/MS). AMPs will be identified by interrogating protein databases with MS/MS sequence data. Antimicrobial peptides of interest will be purified by fractionation using ion-exchange or reverse-phase HPLC. Once the peptides of interest have been purified, in vitro susceptibility testing will be performed. Minimal inhibitory concentrations (MICs) will be determined against the bacterial strain used for infection (M. haemolytica), and for other common respiratory pathogens of ruminant species (Pasteurella multocida, Haemophilus somnus, Actinomyces pyogenes.) Standard bacterial susceptibility protocols will be used and will be critically evaluated for their performance with AMPs. The development of AMPs for clinical applications is already being seen for human therapeutics, and it is anticipated that veterinary applications soon will ensue. In addition to the evaluation of peptide activity, toxicity, and efficacy/clinical performance, the FDA will also need to be prepared to evaluate such basic issues as dosage form and delivery mode, as well the other standard parameters such as MIC/break-point determination. However, in addition to the therapeutic applications of these peptides, they may also have great utility as biomarkers of infection or inflammation, or as surrogates in the evaluation of disease progression or response to treatment with more conventional antimicrobial agents. Subsequent evaluation of these compounds in animal models is anticipated to shed some light on their use in this regard, in both humans and animals. The following personnel are responsible for this study: Jeffrey Ward Jamie Boehmer DAR Staff Patrick McDermott DAFM Staff Kevin Shefcheck (CFSAN) The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 1.0 Isolation and purification of AMP(s); in vitro susceptiblity testing with bovine respiratory pathogens 2 COMPLIANCE Introduction ..................................................................................................................... 2-2 Drug Residue Methods.................................................................................................... 2-3 Develop Needed Enforcement Methods..................................................................................................... 2-4 Method Trials and Validation.......................................................................................... 2-5 Perform Method Trials to Determine Drug Residues from Unapproved Uses..................................... 2-6 Pharmacokinetics and Residue Depletion ...................................................................... 2-7 Use Tissue-Fluid Correlations to Predict Drug Residue Levels in Edible Tissues from Food- Producing Animals .................................................................................................................................. 2-8 Screening Tests...............................................................................................................2-10 Evaluate Screening Test Performance........................................................................................................2-11 Incursion Services ...........................................................................................................2-12 2 Introduction The Office of Research supports CVM’s compliance activities through research including method development, method trials, test kit validation, and residue depletion/tissue-fluid correlation studies. Reseachers at OR interact with CVM OS&C, CFSAN, ORA, USDA-FSIS and other government agencies in designing and completing research to address compliance issues. How OR accomplishes compliance oriented research is detailed in the following sections. Method Development The Method Development program addresses the need for analytical methods of drug residues in animal-derived foods. Some examples of why analytical methods have grown in importance are: While drug sponsors are responsible for developing methods for new animal drugs, the Animal Medicinal Drug Use Clarification Act (AMDUCA) allows the extralabel use of animal drugs by veterinarians. Import products may contain residues of drugs not allowed for use in the U.S. Food monitoring programs cannot effectively rely on single compound methods. FDA and FSIS require regulatory methods that can detect and measure a broad range of drugs at very low concentrations, yet are rugged, fast, economical, and safe. Violative residues of approved drugs or illegal residues of unapproved drugs may indicate improper drug use which could contribute to antibiotic resistance. Addressing these needs involves incorporating new cleanup, separation, and detection technologies in developing enforcement methods to address agency needs. Drug Residue Methods The development of chemical methods of analysis for drug residues in animal products is a major research activity at CVM. Regulatory enforcement methods are used to perform analyses that will support regulatory actions to be taken based on those results. CVM develops regulatory enforcement methods with the intention of transferring these methods to the FDA/ORA field laboratories, USDA Food Safety and Inspection Service, and other agencies with food safety enforcement authority. These methods must be rugged, well defined, validated and meet stringent criteria established for regulatory methods. The high level of performance demanded of these methods is essential, as data generated via these methods must be able to withstand a legal challenge. In order to perform its mission, it is crucial that the Agency use new tools being developed in the rapidly changing field of chemical analysis. Many techniques, such as electrospray LC/MS/MS, which were considered esoteric or even unknown only a decade ago, are now commonly used on a routine basis in analytical chemistry. New technologies offer the potential to improve methods for detecting and preventing drug residues from entering the nation’s food supplies. We must continuously monitor the changes in instrumentation and techniques in analytical chemistry and evaluate new and improved technologies that hold promise for improving the detection of drug residues. In the summer of 2005, news agencies reported that antiviral drugs were being administered to poultry in China in an effort to control avian influenza. Concerned that the development of resistant viral strains that could be accelerated by agricultural use of these drugs, as well as concerned about unknown direct adverse health effects to consumers of residue-laden meat and eggs, CVM issued an Order of Prohibition banning the use of adamantanes and neuraminidase inhibitors in poultry. Codex Alimentarious has also recommended that regulatory authorities prohibit the use of these drugs in food animals. It is critical that the Agency have available analytical methods to enforce this Order of Prohibition. Developing, validating and implementing such methods is part of the Agency’s Pandemic Preparedness Plan. Similar concerns by the Central Science Laboratory, one of CVM/OR’s counterparts in the United Kingdom, has led to the development of an informal collaboration between our laboratories. Develop Needed Enforcement Methods Multiclass methods are efficient for analyzing a large number of analytes in a single run. However, there are analytes that do not fit into the multiclass method development. For example, certain analytes may require special handling techniques, such as hydrolysis, derivatization, protection from light, or unusual extraction and chromatography. The need for single analyte and single-class multiresidue methods remains high. At OR, the development of such methods is often in response to the request of the Center and the Agency to address regulatory concerns. In recent years, OR has been called upon to develop methods for nitrofuran compounds and antiviral drugs. Custom method development for these prohibited substances incorporates new trends in methodology, data handling, and quality assurance, while meeting appropriate standards for providing valid data. By developing and publishing such methods, OR contributes to the repertoire of all regulatory analysts. Maintaining an active method devlopment program enables OR to fairly evaluate methods developed elsewhere and submitted for review. The following personnel are responsible for these studies: Mary Carson Pak-Sin Chu Tricia Johnson Shani Smith Jeffrey Ward DAR Animal Care and Use Staff The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 Antiviral Drug Residues in Poulty. Identify metabolites from FY08 incursions. Revise method and validate. Implement surveillance program for antiviral drugs in eggs and poultry. (continued from 08) 1.5 2.0 10 Antiviral Drug Residues in Poultry. Transfer methodology to other regulatory laboratories. Begin multilaboratory method validation, if needed. (continued from 09) 1.5 0.5 11 0.5 Hormones in animal tissues. Conduct incursion studies and Identify marker metabolites for hormones (continued from FY08) Hormones in animal tissues. Validate the method for hormones Antiviral Drug Residues in Poultry. Continue multilaboratory method validation, if needed. Method Trials and Validation The Method Trials program validates analytical methods for drug residues in animal-derived foods and for drugs, additives, and contaminants in animal feeds. Analytical methods for regulatory use are developed by CVM, FDA field laboratories, and new animal drug sponsors. Residue methods test for violative residues of approved drugs or illegal residues of unapproved drugs. In addition to chemical toxicity, residues may contribute to antibiotic resistance. Feed methods test for both potency of medicated products and detection of contaminants. Methods submitted by other federal or state regulatory laboratories for use as enforcement tools. These methods are validated through the non-NADA method trial program. The goal of the program is to determine if the method performs as claimed, that this performance is fit for the intended purpose, and that the technology transfer is successful. Typically, the developing laboratory is not involved in the analysis of regulatory samples. The laboratories using the methods usually do not have the same equipment, access to the method developer, or time and resources to modify flawed methods. Usually, the only information available to the scientist using the assay is what is written in the method. Additionally, the scientist developing the method often is an expert in a particular analytical technique; whereas, the scientist using the method is a generalist, and must be able to analyze a wide assortment of samples using a variety of analytical methods. The validation process evaluates the transferability of a method into a regulatory environment, determines that the methods are suitable for the intended use, and ensures that the written method is clear, complete, and free of ambiguity. Our strategy for achieving this goal has several facets: CVM coordinates method trials, participates in method trials, and has a contract with a private laboratory to evaluate methods. Coordination of a trial includes the following: Design the trial. Find laboratories to participate in the trial. Oversee the trial process, provide samples to the participating laboratories, and evaluate the results of the trial. When participating in a trial, the CVM laboratory serves as one of the laboratories conducting the actual hands-on evaluation of the method. The evaluation includes a review of the written method and the analysis of a series of both known and unknown samples. Perform Method Trials to Determine Drug Residues from Unapproved Uses Animal drugs are used in unapproved ways, so the federal government needs to monitor the nation’s food supply for these illegal and unsafe drug residues. Before a method can be used in a monitoring program, it needs to be validated. The validation process shows the method performed as stated by the developer, and addresses technology transfer issues. The goal of this research program is to have well-characterized, reliable methods available for use by regulatory agencies including FDA, USDA, and state laboratories. CVM will both coordinate and participate in the trials of the method. The trials are conducted at FDA, state and contract laboratories. The following personnel are responsible for this study: Philip Kijak OR staff The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 0.5 10 0.5 11 0.5 Compete multiple laboratory trial of a method to quantify triphenylmethane dyes in salmon Coordinate and participate in multiple laboratory trial of a method to quantify a drug to be determined. Coordinate and participate in multiple laboratory trial of a method to quantify a drug to be determined. Pharmacokinetics and Residue Depletion Regulators and consumer organizations recognize that the current monitoring programs sample only a tiny fraction of meat. This is due in part to the expense and time needed for laboratory analysis. The current approach of in-plant screening tests followed by laboratory repeat analysis, liquid or gas chromatographic quantitative analysis, and mass spectrometric confirmation takes too much time. Our work in the development of multiclass, multiresidue mass spectrometric methods is partly aimed at eliminating the need for the less specific chromatographic procedures. We believe that a system of highly specific and sensitive screening tests at the slaughterhouse combined with a minimal number of mass spectrometric confirmatory procedures at the lab could allow for a much larger portion of the food supply to be tested. In order to apply rapid screening tests at the slaughter plant, tests must be performed on samples that are easily obtained and tested. The physiological fluids such as blood, urine and saliva suit this requirement very well. Secondly, data must be developed that define the relationship between the drug levels in these fluids and in the edible tissues for which tolerances have been established. Part of this program is designed to develop these data using minimally invasive sampling techniques and small sets of animals. The Animal Medicinal Drug Use Clarification Act (AMDUCA) allows for certain extralabel uses of veterinary drugs by veterinarians. One of the requirements is that the veterinarian must be able to assure that no residues remain at time of slaughter. Pharmacokinetic studies are used to define drug and metabolite depletion characteristics of drugs which may be administered in an extralabel manner by the attending veterinarian. Physiologically based pharmacokinetic models can be developed which are capable of estimating the post dosing drug withdrawal times associated with acceptable tissue and fluid drug depletion levels. The physiologically based pharmacokinetic model will provide the guidance required to slaughter animals only after estimated withdrawal times to avoid drug residue contamination in food animals. Pharmacokinetic drug depletion profiles may be combined and evaluated to provide the background data necessary to develop risk assessment tables for the FARAD (Food Animal Residue Avoidance Database). FARAD maintains the largest database of pharmacokinetic data which describe the timecourse of drugs and estimates the depletion of residues from tissues of animals. Extended withdrawal time estimates have demonstrated utility in the prevention of drug residues in food animals. Use Tissue-Fluid Correlations to Predict Drug Residue Levels in Edible Tissues from Food-Producing Animals Testing for drug residues in tissues from swine and bovine normally occurs after slaughter. As a result, edible tissues with residues that exceed tolerance are declared adulterated and must be destroyed. The analytical methods used to measure these residues in tissues are time consuming to perform and relatively few of the slaughtered animals are monitored for drug residues. This approach is inefficient and economically costly for both consumers and producers, and does not provide assurance of optimal food safety. The use of rapid, inexpensive preslaughter screening tests, similar to those used for milk, based on detection of drug residues in some easily obtainable biological fluid (saliva, plasma or urine) would enable monitoring of more animals and help ensure greater food safety. Preslaughter testing also allows animals with violative residues to be held back until such time as drug residues deplete to safe levels by normal routes of excretion. The setting of acceptable drug residue tolerances in tissues from food-producing animals is based, in part, on an evaluation of toxicology data and target animal metabolism studies. This information determines which drug residues (parent and/or metabolites) are a food safety concern and which organ/tissue contains the highest residues. Depletion studies also provide data regarding the elimination of drug residue from edible tissues. Penicillins are inexpensive, readilly available antibiotics often used and abused in the treatment of swine for many types of infections. Unfortunately, the penicillins possess the potential for the production of an allergic response in the consumer of the animal derived food product. In swine, the accepted tolerance for penicillin in edible food is zero. – therefore the presene of any level of penicillin residue in swine tissue is a violation. Penicillin must be depleted to non-detectable levels in the kidney to be accepted as safe for human consumption. The ability to estimate the nondetectable concentration of penicillin in the kidney may be monitored by the corresponding level in the urine and or plasma. The objectives of this research study include: Providing initial validation for the use of kidney-tissue and urine or plasma fluid correlation data as a tool for determining the safety of edible tissues in penicillin treated swine. Increasing the efficient use of animal resources by minimizing the wasteful slaughter of animals with drug residues that exceed tolerance and which must subsequently be destroyed. Contributing to an increase in food safety by promoting the development and use of rapid test kits for screening drug residues in a larger sampling of animals. The following personnel are responsible for this study: David Heller Alberto Chiesa, CDRH OR Staff The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 0.5 Complete kidney tissue to biological fluid correlation for penicillin in swine. Screening Tests The Office of Research has a key role in the evaluation of commercial screening kits for milk. The National Conference on Interstate Milk Shipments (NCIMS) has mandated in the Pasteurized Milk Ordance, that all milk must be screened for the presence of beta-lactam drugs using methods approved by the FDA. Working in partnership with the AOAC-Reseach Institute, a protocol for the validation of the kits has been established based on well-defined requirements and testing by both the test kit manufacturer and an independent third party laboratory. In 2008, a new test kit was approved for use, and two previously approved tests were removed from the program by the manufacturer due to concerns raised about the test kit performance. In 2005, an NADA was approved for the intramammary use of ceftiofur. The labels of all the current kits on the market needed to be updated to reflect changes caused by the new approval. The Office of Research and collaborated with the drug sponsor, Pfizer, the NCIMS, AOAC-RI, and the kit manufacturers to generate the data to need to demonstrate the performace of the kits under the new standard. This effort continues as OR maintians a repository of ceftiofur inccurred milk required for kit validation. The validation of drug residue kits for milk from other lactating animals such as goats, sheep, and water buffalo has become an issue with the NCIMS in recent years. The industry needs tests for these specialty products, but the manufacturers cannot justify completing a full validation as done with the kits for cow’s milk because of the small market. To overcome this problem, a simplified protocol, designed for use only with kits that have already been approved for use in cow’s milk, has been developed to allow a kit to be shown acceptable for use with milk from other lactating animals. The State of Vermont completed a study to validate test kits for water buffalo milk, and the State of New York has initiated a study to validate test kits for sheep milk using the simplified protocol. Research at OR has also had a key role in addressing problems or issues with existing kits. . The OR staff works closely with CFSAN Division of Cooperative Programs and the FDA Milk Steering Committee to address problems as they are itentified. Additionally, OR has utilized its expertise in the validation of milk test kits to the evaluation of screening kits for drug residues in other matrices. Evaluate Screening Test Performance An important application of screening tests is to protect human health by monitoring the existence of drug residue contamination in food. A functional screening test kit should not detain uncontaminated food. The kit should also not define food as contaminated due to the presence of some natural biological interference which may cause an entire shipment to be rejected and destroyed. Historically, the primary OR effort has been in support of the milk monitoring program in cooperation with the National Conference on Interstate Milk Shipments. The specific performance criteria for milk screening test kits for antibiotics is established in a protocol developed by CVM in a partnership with the AOAC-Research Institute. The studies in this protocol provide sufficient information to assure that the screening test kits are manufactured to consistent specifications and that these tests respond consistently to well-defined levels of antibiotics in milk. Ongoing research efforts are concerned with the time and temperature stability of each screening test kit. These studies include the reproducible manufacture of every lot of test kits to continuously meet the same sensitivity criteria throughout the test kit expiration period. Studies will also consider the factors that control the shipping requirements of each test kit. The following personnel are responsible for this study: Philip Kijak Robert Condon (Contractor) OR staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.5 10 0.5 11 0.5 Evaluate the performance of new tests submitted for FDA acceptance. Evaluate the performance of new tests submitted for FDA acceptance. Evaluate the performance of new tests submitted for FDA acceptance Incursion Services The development of regulatory methods to monitor the food supply is dependent upon developing and validating detection methods. Part of the process of methods validation is determining if the analyte of interest can be qualitatively and/or quantitatively assessed in incurred tissues. Incursion refers to the deliberate dosing of an animal to produce residues in the animal’s tissues at time of collection/sacrifice. Incursion studies are necessary because method validation requires testing a new method against tissue samples that “naturally” contain drug residues. OR does not consider it sufficient to test a method solely with samples that are fortified by drug standard added just before extraction. Drug incursion studies are conducted for scientists at OR and at other U.S. laboratories. Drug dosing may follow a therapeutic regime, but in some cases dosing is calibrated solely to produce a desired residue level in a specific tissue. This target level is strictly a function of the level required to validate a method. Frequently, the Study Director researches the topic to determine how to dose the animal to produce this drug level. Real-time analytical support (as the tissues are collected) may be necessary to determine that the desired level is obtained. Incursion studies are conducted as the need arises and as requests are received. We expect to conduct approximately six studies per year for incurred residues in poultry, eggs, milk, meat, or fish. We are planning to provide incurred tissues for a number of high priority drugs for aquaculture in the next three years. These tissues will be used to validate residue methods which will be useful for the establishment and enforcement of import tolerances for these drugs. Some of the incurred residue studies are conducted at the request of ONADE to obtain direct information regarding drugs under review. In addition, some of these studies reflect cross-center collaborations, using the resources at CVM to leverage toward common FDA goals. The following personnel are responsible for these studies: Renate Reimschuessel Charles Gieseker Eric Evans Jeffrey Ward Jamie Boehmer OR staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 Incurred Tissue Request: Tricaine 3-aminobenzoic acid ethyl ester in multiple fish species and prepare final report Incurred Tissue Request: multiple drugs for multi-residue method development, prepare final report. Incurred Tissue Requests for Aquaculture Research Taskforce Incurred Residues of Hormones in Bovine Tissues 0.1 0.2 0.2 0.3 10 0.3 Incurred Tissue Requests for Aquaculture Research Taskforce 3 POST-APPROVAL MONITORING Introduction ..................................................................................................................... 3-2 Static and Non-Static Surveys........................................................................................................................ 3-2 Current Survey Activities............................................................................................................................... 3-3 Individual Programs ........................................................................................................ 3-4 Participate in PulseNet: DNA Fingerprint Foodborne Pathogens by Pulsed-Field Gel Electrophoresis (PFGE) .......................................................................................................................... 3-4 Characterize Antimicrobial Resistance among Bacteria Isolated from Retail Meats ............................. 3-6 Characterize Antimicrobial Resistance among Historical Isolates of Foodborne Pathogens .............. 3-8 Survey Susceptibility of Foodborne Pathogens from Humans, Food, and Animals in Mexico .......... 3-9 Characterize Antimicrobial Resistance Mechanisms of Animal Bacterial Pathogens..........................3-10 Molecular Serotyping of Salmonella spp. by using the Luminex multianalyte profiling (xMAP) technology...............................................................................................................................................3-12 Determine the prevalence of pathogenic Escherichia coli recovered from NARMS Retail Meats........................................................................................................................................................3-13 3 Introduction An active research effort focused on survey-oriented research represents an important tool to assist the regulatory mission of FDA. The Survey program is primarily the research-oriented half of an epidemiological approach to the gathering, analysis, and dissemination of data. The sole purpose of a valid, well-designed survey instrument is the collection of information about the status of a particular environment. As such, this program represents a different type of research activity, one in which the pursuit of knowledge does not follow the typical hypothesis-driven research efforts. However, the knowledge base acquired by survey-oriented research is no less important than the results produced by what is considered the traditional form of research; and can be used as a foundation to formulate hypothesis driven studies. This type of research is one for which FDA is well-suited to undertake, especially as the data are often essential for the Agency to fulfill its regulatory mission. Static and Non-Static Surveys Survey instruments are subdivided into two groups: static and non-static surveys. Static surveys gather information as a “snapshot in time.” This survey type is designed to acquire information concerning the status of a given problem or issue at that moment in time. This static assessment is focused on a pre-determined period of time with finite boundaries. If the information collected contains data from properly preserved and reliably archived samples, the information generated allows for a valuable look at past trends also. Non-static surveys collect data continually without any pre-determined time limits. This survey type documents changes over time. It is also able to monitor subtle shifts which may lead to activities, such as initiation of intervention strategies and policy guidelines, that can mitigate an identified area of concern. The databases generated by either type of survey impact the regulatory efforts of CVM and the Agency in several ways. Survey-derived databases can be involved in the following: Designing effective monitoring programs to provide real-time assessments. These survey programs are essential in ongoing efforts to predict future trends such that critical decisions can be timed to prevent development of possible adverse consequences. Generate risk assessment documents, which provide a quantitative determination of the relative risks that may accrue as a consequence of a given activity. While a risk assessment document does not, by itself, generate new policy, it can lead to the creation of new regulations. Directly lead to regulatory decisions through the illumination of critical public health issues. Current Survey Activities The principal focus of ongoing microbiological surveys is to understand how antimicrobial agents currently approved for use in veterinary medicine alter the antibiotic susceptibility patterns among zoonotic foodborne pathogens. The targeted bacteria include the pathogens Salmonella and Campylobacter, as well as commensal organisms such as E. coli and Enterococcus. Information to critically assess how antibiotics used in food-producing animals alter bacterial susceptibility patterns is limited. While this data gap is acknowledged by numerous regulatory and academic research entities, the focus of our research activities is uniquely crafted to address critical, mission-critical functions. Current research activities are designed to fill many of these crucial data gaps, so that ongoing efforts to address the role of agriculture and aquaculture on resistance development have a firm basis in science. OR scientists are responsible for the study design and continued testing of bacterial isolates from the Retail Meat Arm of the National Antimicrobial Resistance Monitoring System (NARMS). The NARMS retail meat program began in January 2002 and has become the third component of NARMS (in addition to the humans component -CDC and the animal component -USDA). The NARMS retail meat group collaborates with the Centers for Disease Control and Prevention to conduct retail meat sampling through 9 FoodNet Sites (California, Colorado, Connecticut, Georgia,Minnesota, New Mexico, New York, Tennessee, and Oregon) plus the Pennsylvania State Health Department. Each site purchases 40 retail meats per month (including 10 each of chicken breasts, pork chops, ground turkey, and ground beef). All ten sites culture the rinsate from each meat sample for the presence of Salmonella and Campylobacter. In addition, three sites (GA, OR, and TN) culture the rinsates for E. coli and Enterococcus. Bacterial isolates are sent to CVM’s Office of Research where species identification confirmation, antimicrobial susceptibility testing and DNA fingerprinting (PFGE) takes place. As part of this, a database has been developed that provides query capabilities for over 20 specific reports. These reports are provided quarterly to the FoodNet sites and other participants. The FDA NARMS retail meat annual reports are available at http://www.fda.gov/cvm/narms_pg.html. The information published in these reports provide a critical link toward developing needed data in the farm to fork continuum to determine trends in antimicrobial drug susceptibility/resistance among foodborne bacteria and possible associations with antimicrobial drug use in food producing animals. Another survey research activity is our ongoing participation in CDC’s PulseNet program. PulseNet is an epidemiological database focused on the acquisition and storage of DNA fingerprints generated by the procedure known as pulsed-field gel electrophoresis (PFGE). This methodology results in the visualization of a pattern of DNA fragments that is unique to a particular bacterial clone. This database represents a powerful epidemiological tool to conduct trace-back studies during outbreaks of foodborne illness. Our efforts focus on characterizing bacterial strains obtained from animals and retail meats. Data from these samples provide a critical, missing link in the ability of CDC and other state and federal agencies to trace the source of a given isolate back to the farm. Our effort is also unique in two other ways. We are one of a few laboratories that currently submits the antibiotic susceptibility patterns to PulseNet. These data provide a link between two different epidemiological monitoring programs, PulseNet and NARMS. The majority of the samples we are examining for PulseNet are obtained from the NARMS survey. We are also the primary source of Campylobacter PFGE patterns for the PulseNet program. Individual Programs Participate in PulseNet: DNA Fingerprint Foodborne Pathogens by Pulsed-Field Gel Electrophoresis (PFGE) In recent years, bacterial subtyping/fingerprinting has became an integral part of epidemiological investigations of foodborne outbreaks. Differentiation of bacterial isolates by DNA fingerprinting has become an essential tool in correctly identifying potential common-source exposures and tracing the source of contamination in food products. In addition, bacterial subtyping has proven useful in understanding how pathogens persist in animal reservoirs. This informatioon has helped to develop specific prevention strategies to control foodborne pathogens at the farm level. To date, the most effective bacterial subtyping method is pulsed-field gel electrophoresis (PFGE). PulseNet is a national network of public health laboratories that perform PFGE DNA "fingerprinting" on bacteria that may be foodborne. The network permits rapid comparison of these "fingerprinting" patterns through an electronic database at the CDC. PulseNet was established in 1996 through a collaborative effort of CDC, FDA, USDA and state health departments. PulseNet uses PFGE profiles to trace the source of a foodborne illness outbreak. In the past, PulseNet was focused on foodborne pathogens isolated from patients and foods because foodborne pathogen isolates from animals are limited. In CVM’s ongoing surveillance, we subtype Salmonella and Campylobacter isolated from food animals (cattle, swine, chicken and turkey), retail foods and humans. The isolates are obtained from diagnostic laboratories in the U.S. and NARMS. We will use PFGE to subtype these isolates and compare them to human clinical isolates through PulseNet, and to determine if there is a clonal spread of isolates between animals and humans or widespread dissemination of unrelated strains. We will also determine the antimicrobial susceptibility profiles of these isolates. When antimicrobial resistance is detected we will identify the genetic elements contributing to this resistance. The data generated from this study will help us understand the genetic diversity of Salmonella and Campylobacter and the types of foodborne pathogens shared between animals and humans. This will allow us to develop better strategies to prevent foodborne pathogens transmitted from animals to humans. The PulseNet network will facilitate rapid detection of clusters of bacterial pathogens by enabling real-time comparison of bacterial DNA fingerprints at the national level. The ability to identify specific strains of bacteria from diverse sources in a short period of time can play a critical role in allowing the detection of agents of bioterrorism, should they appear within the U.S. The study will also help us better understand how antimicrobial usage in veterinary medicine may influence antimicrobial resistance in foodborne pathogens as well as the mechanism of resistance gene transfer in bacterial pathogens of animals and humans. Thus, the objectives of this project are to coordinate the ongoing DNA fingerprinting laboratory at CVM for subtyping Salmonella and Campylobacter, to characterize antimicrobial resistance of these isolates, and to participate in the national DNA fingerprinting network for foodborne pathogens (PulseNet). The long-term goals include: Establish and maintain our own DNA fingerprinting database for important foodborne pathogens, including Salmonella, E. coli and Campylobacter. Collaborate with National Antibiotic Resistance Monitoring System (NARMS) in studying the emergence and spread of multiple drug-resistant pathogens. Share information via the Internet with other laboratories throughout the country to rapidly determine a source of foodborne infection and mode of disease transmission. Compare PFGE to other typing methods such as MLST, and explore highly discriminatory DNA fingerprinting methods such as microarray. Provide service to support other research projects at CVM/OR, such as the Biomarker project, and food safety related epideminological studies. The following personnel are responsible for this study: Shaohua Zhao Sharon Friedman Jason Abbott Althea Glenn OR staff The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 Generate PFGE data on NARMS isolates of Samonella and Campylobacter. Analyze and compare DNA fingerprinting profiles of human isolates associated with cases of foodborne illness through PulseNet. To maintain and continue to update the database as well as share and exchange information with other PulseNet labs. Identify antimicrobial resistance genes and investigate mechanisms of multiiple antimicrobial resistance. 4 10 Continue 09 activities 4 11 Continue 10 activities. 4 Characterize Antimicrobial Resistance among Bacteria Isolated from Retail Meats CVM continues to strive to provide for the safe use of antimicrobials in animals while ensuring that significant human antimicrobial therapies are not compromised. FDA’s main safety concern is that use of antimicrobial drugs in food-producing animals may lead to the emergence of bacterial pathogens (disease-causing organisms) that may be harmful to humans and that are resistant to drugs used to treat human illness. To address these concerns, CVM conducts basic and applied research on the prevalence, propagation, and persistence of antimicrobial resistant bacteria in the animal production environment and on foods of animal origin. CVM, in conjunction with CDC and ten public health laboratories, expanded the National Antimicrobial Resistance Monitoring System (NARMS) to include surveillance of retail meats for antimicrobial resistant foodborne bacterial pathogens. To better understand the contribution of the food supply to antimicrobial resistance among enteric bacteria and to focus efforts to mitigate antimicrobial resistance, CVM initiated two studies to determine the prevalence of antimicrobial resistant bacteria isolated from retail foods of animal origin. The first study began in FY 2001 and involved sampling of retail meat samples (ground turkey, pork chops, ground beef, and chicken breast) obtained from grocery stores throughout the state of Iowa from March, 2001 to July 2002 on a weekly basis. Retail meat samples were tested for the presence of enterococci, Salmonella, Campylobacter, and extended spectrum beta-lactamase producing Gram-negative bacteria. The second study, initiated in FY2002, has become the retail meat part of the NARMS surveillance program and involves CVM personnel from the Office of the Center Director and the Division of Animal and Food Microbiology. Currently, ten FoodNet sites participate (California, Colorado, Connecticut, Georgia, Maryland, Minnesota, New Mexico, New York, Tennessee, and Oregon), along with the Pennsylvania Department of Health. Each site purchases 10 packages of chicken breasts, 10 packages of pork chops, 10 packages of ground turkey and 10 packages of ground beef. All ten sites culture each meat sample for the presence of Salmonella and Campylobacter. In addition, three sites (GA, OR, and TN) currently culture for E. coli and Enterococcus. All participating laboratories use similar bacterial isolation methods adapted from the FDA’s Bacteriological Analytical Manual. Isolates from all ten sites are sent to FDA/OR for confirmation of the identification and antimicrobial susceptibility testing. This is an ongoing project as it has become part of the FDA NARMS program. In addition to monitoring antimicrobial susceptibility patterns, CVM-OR scientists examine resistant isolates for their carriage of resistance determinants. Data on the genetic mechanisms of resistance provides crucial date for assessing the impact of antimicrobial use and spread, and for assessing assiciated public health risks. Relevance to FDA and Public Health Impact: The overarching goal of antimicrobial resistant research at CVM is to identify and implement methods to reduce microbial hazards associated with antimicrobial drug use in food animals. This includes research focused on improving our understanding of how bacterial antimicrobial resistance develops, disseminates, and persists in the animal production environment when antimicrobial agents are administered under approved conditions. This research supports the FDA in its regulatory decisions pertaining to food safety by providing scientific data on the emergence and spread of resistant bacterial pathogens from the farm production environment to the retail market. In addition, date generated from these studies are a valuable resource for evaluating new animal antimicrobial in accordance with the recommendations of the CVM Guidance for Industry #152. A comprehensive research effort will help ensure that any actions taken to control antimicrobial resistance will be based on sound science. The Agency is devoting resources in these important areas to help fulfill its dual mission to support the safe use of antimicrobial drugs in food animals and to protect public health. The following personnel are responsible for this study: Patrick F. McDermott Elvira Hall-Robinson DAFM Staff The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09- 11 Coordinate isolation of Salmonella, Campylobacter, Enterococcus and E. coli from retail meats from 10 testing sites Confirm identification and determine antimicrobial susceptibilities Determine genetic relatedness of recovered isolates Identify genetic elements causing resistance to antimcrobial agents. 6 Characterize Antimicrobial Resistance among Historical Isolates of Foodborne Pathogens CVM has contracted with The American Type Culture Collection (ATCC) to acquire banked collections of foodborne pathogens (Campylobacter, Salmonella, E. coli) and to test their susceptibility to antimicrobial agents as a means of evaluating the evolution of drug resistance over time. The overall objective of this study is to assist CVM in addressing the public health impact of antimicrobial use in food-producing animals. ATCC generated susceptibility data on the isolates, and CVM obtained these strains for genetic analyses. Studies are underway to determine the genetic bases of antimicrobial resistance using standard molecular methods. Strains will be screened for known resistance and virulence genes, compared based on plasmid profiles. As needed, additional susceptibility testing may be performed to more thoroughly characterized resistance phenotypes. These data will help understand the development and spread of resistance to human and veterinary drugs over the past 6 decades. Isolates from animals and humans will be characterized for genetic relatedness in order to determine whether there are specific phenotypic and/or genetic biomarkers (used singly or in combination) that can be used to assess the exchange of bacteria between animals and humans. This will potentially provide information on the emergence of antimicrobial resistance in both animals and humans over the past decades. The following personnel are responsible for this study: Patrick F. McDermott Heather Harbottle OR Staff The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09 Continue molecular studies and strain typing experiments. Characterize plasmid content and mobility among select strains 1 10 Continue molecular studies on resistance determinants. 1 11 Continue molecular studies on resistance determinants. 1 Survey Susceptibility of Foodborne Pathogens from Humans, Food, and Animals in Mexico Fluoroquinolones are used in food animals to treat serious bacterial infections. This use is a concern due to the possibility that fluoroquinolone-resistant foodborne pathogens may be passed to humans through the food supply. The strength of this linkage is unknown. Thus, monitoring for fluoroquinolone resistance among foodborne bacterial pathogens is a critical surveillance tool in food safety. In this survey we are analyzing isolates of antimicrobial-resistant E. coli and Salmonella obtained from humans, food animals and retail meats acquired from the ResistVet surveillance system in Mexico. Susceptibility to a range of antimicrobials, including various fluoroquinolones, will be determined. Molecular methods, e.g., pulsed-field gel electrophoresis, will be used to estimate the relatedness of strains from human and retail meat isolates. The following personnel are responsible for this study: Patrick McDermott OR Staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 Analyze E. coli and Campylobacter isolates from the ResistVet program. 0.1 10 Continue 2009 studies and begin analysis of Campylobacter isolates from the ResistVet program. 11 Complete 2009 and continue 2010 studies Characterize Antimicrobial Resistance Mechanisms of Animal Bacterial Pathogens During the past decade, bacteria that cause human and animal diseases have developed resistance to many antimicrobials commonly used for treatment of human and animal infections. The development of some resistance by bacterial pathogens seems an inevitable consequence of the clinical use of antimicrobial drugs. It is also believed that excessive use in treating animal diseases, including subthrapeutic applications of antibiotics for treatment and disease prevention have played a significant role in accelerating the emergence of antibiotic-resistant bacteria . Bacteria develop resistance through a number of mechanisms, including enzymatic degradation of the antimicrobial, mutation in the antimicrobial target site, active efflux of the antimicrobial across the cell membrane, decreases in the cell wall permeability to antimicrobials, and the development of alternate metabolic pathways to circumvent antimicrobial interference. The phenomenon of resistance can be a naturally occurring trait or acquired from the environment. The majority of quickly emerging resistance phenotypes have acquired extra-chromosomal genes that may cause resistance to an entire class of antimicrobial agents. In recent years, many of these resistance genes have been associated with transferable, extra-chromosomal DNA plasmids, and other mobile DNA elements, such as transposons and integrons. These mobile DNA elements which carry antimicrobial resistance genes can transmit among bacteria via conjugation or transformation. Although much scientific information is available on this subject, many aspects of the development of antimicrobial resistance still remain unclear. The increasing incidence of antimicrobial resistant bacterial pathogens has severe implications for the future treatment and prevention of infectious diseases in both humans and animals. In order to control the emergence and spread of antibiotic resistance, to protect the potency of the currently available agents, understanding the complex ecological and molecular aspects of antimicrobial resistance mechanisms is greatly needed. The objectives of this project are to identify antimicrobial resistant animal pathogens, characterize genes associated with their antimicrobial resistance and determine how resistance gene transfer occurs among animal bacterial pathogens. The results of this study will allow us not only to reveal mechanisms of antimicrobial resistance, but also facilitate molecular epidemiology investigations of resistance dissemination in bacteria among animals and their environment. The following personnel are responsible for this study: Shaohua Zhao Sherry Ayers Sonya Bodeis-Jones Karen Blickenstaff DAFM Staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09-11 Identify antimicrobial resistant animal pathogens, characterize genes associated with their antimicrobial resistance and determine how resistance gene transfer occurs among animal bacterial pathogens. 1 Molecular Serotyping of Salmonella spp. by using the Luminex multianalyte profiling (xMAP) technology Serotyping of Salmonellae is a valuable phenotypic subtyping tool for understanding the epidemiology of this important foodborn pathogen. Traditional serotyping is using agglutination test according to the Kauffmann-White scheme based on their O, H, and Vi antigens. Such tests are tedious and have problems associated with antibody production and availability. Luminex multianalyte profiling (xMAP) has provided an alternative method for Salmonella serotyping. This technology combines PCR with a multiplexed bead-based suspension array detection system which allows us to detect specific nucleic acid sequences that encode different O and H antigens. The assay has been developed by Center for Diseases Control (CDC). We will use Salmonella isolated from the NARMS’s retail meats for this study. The results will allow us to determine the best method for serotyping Salmonella based on ease of testing, cost, reproducibility, and time efficiency. The project will also support and assist CDC & FDA in the development of molecular serotyping of Salmonella using Luminex technology. The following personnel are responsible for this study: Shaohua Zhao Althea Glenn Sherry Ayers Karen Blickenstaff DAFM Staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09-11 Molecular Serotyping of Salmonella spp. isolated from NARMS Retail Meat by using the Luminex multianalyte profiling (xMAP) technology 1 Determine the prevalence of pathogenic Escherichia coli recovered from NARMS Retail Meats Escherichia coli are commonly found in humans and animals. Most E. coli are harmless but some are pathogenic and can cause enteric or extraintestinal infections in humans. Human E. coli enteritis is often transmitted through consumption of contaminated food, especially products derived from animals, or water. Shiga-toxin producing E coli (STEC) and enterotoxigenic E coli (ETEC) are most important groups of foodborne pathogenic E. coli. In addition, some studies also suggested that foods might serve as a potential source of urinary tract infections caused by uropathogenic E. coli in humans. There is a paucity on information of the actual prevalence of pathogenic E coli in retail meats, which is in part due to the lack of routine screening of these pathogens in foods. The objective of the study is to screen for ETEC, STEC and UPEC among E coli isolates recovered from retail meat samples collected for NARMS, and to determine the prevalence of these pathogens, and to assess the potential risk of foodborne E. coli infections. The following personnel are responsible for this study: Patrick McDermott Shaohua Zhao Xiaodong Xia, University of Maryland Jianghong Meng, University of Maryland DAFM Staff The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09-11 To screen for ETEC, STEC and UPEC among E coli isolates recovered from retail meat samples collected for NARMS, and to determine the prevalence of these pathogens, and to assess the potential risk of foodborne E. coli infections. 1.5 4 ANIMAL FEED SAFETY Introduction ..................................................................................................................... 4-2 Individual Programs ........................................................................................................ 4-3 Use PCR and Immunochemical-Based Methods to Detect Natural and Rendered Materials that May Potentially be Used in Animal Feedstuffs ................................................................................... 4-3 Evaluate Commercial Test Kits for Detecting Rendered Materials that May Potentially be Used in Animal Feedstuffs............................................................................................................................ 4-5 Survey Microbiology of Animal Feed and Feed Commodities................................................................. 4-6 Develop Feed Security Tests ......................................................................................................................... 4-8 4 Introduction Assurance of the safety of animal feed and feed commodities is one of the central regulatory obligations of the Center for Veterinary Medicine. Even though the animal feed industry in the United States is largely self-regulated, there are a number of federal and state standards set for feed manufacturing. These regulations include medicated feed Good Manufacturing Procedures (GMPs) to control potentially unsafe chemical residues in edible animal tissues, and the bovine spongiform encephalopathy (BSE) feed ban to prevent spread of BSE and the potential for variant CJD in humans. The Food and Drug Administration has also promulgated regulations covering low-acid canned pet food and salmonellae contamination of feeds, programs intended to provide some control for dissemination of animal and human food-borne pathogens. Nearly all states have some type of regulatory program aimed at ensuring that feeds sold within their borders are properly labeled to ensure correct and safe usage. Enforcement of regulations of feed and feed commodities in the United States is primarily controlled by state feed control officials in consultation with the FDA. Within the past year several new issues have arisen in the area of animal feed contamination. First, the intentional contamination of feed and feed ingredients by melamine and cyanuric acid, to artificially increase the apparent protein content, led to widespread illness and death of companion animals. Second, the production of ethanol by fermentation of grain has led to increasing incorporation of the by-products (distillers grain, DG) into animal feed. Antimicrobial processing agents are used to prevent unwanted bacterial growth during fermentation, and analytical methods are needed to investigate whether antimicrobial residues occur in DG or feed forumulated with DG. Also, there is some concern that aflatoxins present in the grain could be concentrated in DG following the ethanol fermention step, so a method development study for mycotoxin residues in DG has also been inititated. Method development in all these areas will continue, with a particular emphasis on extracting the widest range of nitrogen dopant compounds, antimicrobial compounds, and mycotoxins, followed by multiresidue analysis by liquid chromatography tandem mass spectrometry. It is anticipated that all these methods will be transferred to field laboratories for regulatory analyses. Also, a new technology, Quadrupole-time-of-flight tandem mass spectrometry, will be tested for its capability to detect residues with a priori assumptions of what might be present. The Animal Feed Safety Research Program at the Office of Research is designed to support the regulatory efforts of FDA/CVM. This program is currently oriented in two areas: (1) Development and evaluation of analytical methods for detection of unsafe contaminants in feeds and (2) The conduct of microbiological surveys of feed commodities for contamination with food-borne pathogens. A method allowing detection of bovine-derived rendered materials in complete animal feeds has been developed to provide support for the enforcement of the FDA BSE feed ban. Recently, there has been some concern expressed about the potential for feed to serve as a vector for the dissemination and maintenance of antibiotic resistant bacteria in animal production environments. Surveys, both internal and extramural have been developed and are underway to assess the role various feed commodities might play in this phenomenon. Several reports of results of this work have been published in the past two years. The intramural survey efforts are continuing. With the recent development of interest in bio-security of agri-business, especially animal agriculture, there has been a renewed interest in developing and evaluating rapid microbiological screening methods for use in animal feeds and feed commodities. A new project is planned for development in the animal feed safety research area which will begin to gather information about and evaluate rapid screening methods for their applicability to feed and feed commodities in the U.S. Individual Programs Use PCR and Immunochemical-Based Methods to Detect Natural and Rendered Materials that May Potentially be Used in Animal Feedstuffs Currently, the laboratories of FDA’s Office of Regulatory Affairs are using a validated PCR-based method to detect rendered bovine derived materials in animal feed and feed ingredients. This method is being used as the confirmatory method for feed samples found postive for mammalian proteins by feed microscopy. The method has a bovine-specific primer set, a porcine-specific primer set, and a multi-species specific primer set that detects the rendered remains of sheep, goats, pigs, cows, deer, elk and horse. As pure horse or pure pig proteins are exempt from the current feed ban, restriction fragment-length polymorphic analysis can determine if the PCR amplicon derived from the multi-species primer set is due to the presence of one of these two exempt materials. As a consequence of discussions with ORA analysts using this method, we developed a simpler DNA extraction method and a faster PCR method for detection of mammalian materials. The DNA extraction method again uses commercially available reagents that will be marketed as a single DNA extraction kit.. The new PCR portion of this method uses a real-time platform to examine for mammalian mtDNA. A real-time PCR platform also eliminates the post-PCR processing typically needed for traditional PCR, which was the most common source of problems during the validation trial of the PCR-based method currently used by FDA’s field laboratories. We developed specific primers that permit detection of materials derived from either cattle, deer, elk, pigs, sheep, goats, or horse. Results from our extensive in-house evaluation of this method demonstrated that it is capable of detecting those materials down to a concentration of at least 0.1%. This method was evaluated against the same acceptance criteria used in our evaluation of the commercial test kits. The real-time PCR method can also detect bovine, porcine or ovine materials produced in the European Union. Current guidelines for preparation of meat and bone meal in countries of the European Union require conditions of elevated temperature (~133 C) and pressure (2.7 bar). These are processing conditions that are more stringent than those practiced in North America. This method was successfully used in a second analyst check to identify materials derived from either cattle, sheep, deer, or goat. The real-time PCR method represents a significant improvement over the current method, as a single analyst can analyze 12 samples in a little more than 2 hrs. The current method requires 8 hours to analyze these same 12 samples. We have initiated a peer-verification of this method to ensure that other laboratories can perform this method. We anticipate a successful verification of this method in early FY09, at which time we will work with OSC and ORA to migrate this method to our field laboratories. We have been able to modify the real-time PCR portion of the current method into a multi-plex realtime PCR method. This approach uses a Taqman-style approach to permit detection of five different ruminant species in a single reaction tube; cattle, sheep, goat, deer and elk. The multiplex approach combines the primers for three different species into a single PCR reaction tube, with detection accomplished using a fluorescently labelled probe specific for each species. This test will also permit detection of ruminant proteins rendered in the E.U. The goal of this effort is to create an assay in which both the DNA extraction and PCR assay reagents are contained in two commercially available kits. Validation of this method is contingent upon the staff scientist to be hired using GAP funds. A second line of research focuses on developing an immunochemical test to distinguish between prohibited and exempt bovine materials. Using a unique approach, we have been able to generate antiseras to two distinct portions of a bovine muscle protein. These antiseras are being use to create a sandwich ELISA, which should yield an assay with a greater senstivitiy than with either antisera alone. This test will permit ta laboratory to ascertain if their PCR positive result for bovine materials was due to the presence of bovine muscle (prohibited material; positive ELISA result) or some other bovine protein (exempt bovine materials; negative ELISA test result). The long range goal will be to produce monoclonal antibodies of the same specificity. Monoclonal antibodies are a more stable immunological reagent that does not change characteristics over time, like antisera will. A third area of research would focus on the development of a DNA microarray capable of detecting a large variety of animal species (FPP 2.1.2.1.E). While the initial application would be in the area of feeds analysis for enforcement of the 1997 Feed Ban, this approach can eventually be used for a multiple purposes such as species confirmation to determine accuracy of labelling, identification of filth contamination in feed and food, and identification of microbial contamination of feed. The following personnel are responsible for this study: Michael J. Myers Dottye Farrell Haile Yancy Christine Deaver, ORAU Fellow Staff Scientist The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 Continue efforts to use the polyclonal antisera to bovine muscle protein(s) in the development of a sandwich ELISA. Begin validation of multiplex real-time PCR methods (tentative. 0.7 0.5 0.3 10 Begin validation of ELISA Finalize validation of multi-plex real-time PCR (tent). Begin transfer to field laboratories Begin development of a DNA microarray for detection of animal remains in feed and feed ingredients 0.3 0.3 0.2 0.2 11 0.3 Finalize peer verification of real-time PCR assay. Work with OSC and ORA to transfer method to FDA field laboratories Begin development of monoclonal antibodies. Continue development of an ELISA for bovine muscle proteins, using a combination of antisera and monoclonal antibodies. Continue validation of ELISA Evaluate Commercial Test Kits for Detecting Rendered Materials that May Potentially be Used in Animal Feedstuffs Unlike human medical devices, veterinary devices for products and drugs regulated by CVM do not require pre-market approval. Thus these devices do not receive regulatory scrutiny unless issues with performance are noted and brought to the attention of the Center. Thus, devices such as Neogen’s Reveal for Ruminant Test, Strategic Diagnostics Inc (SDI) Feedchek test, ELISA-Technologies MELISA-Tek test, and Tepnel’s BioKit can be offered for sale without having to meet any requirements set by FDA. All four tests are designed to detect one or more different species of processed animal proteins. The Neogen, Tepnel, and ELISA technology tests are marketed as ruminant specific, using the exact same antibodies for bovine muscle, where as the SDI test detects rendered bovine (ruminant), porcine, and avian meals, and is more of a bone-specific test. The SDI and Neogen tests use lateral flow strips, while the ELISA-Technologies and Tepnel’s test are a standard 96-well ELISA format assay. As a direct consequence of the single cow diagnosed as BSE-positive in December of 2003, the Center began an evaluation of the commercially available test kits. As part of this effort, CVM’s Office of Research developed a set of acceptance criteria by which to assess the performance of these and similar tests. These criteria were developed were criteria for kits that might be suitable for regulatory use. We found that they could not attain the criteria developed by FDA. The results of our evaluations have been published. At least one kit manufacturer has purported to have made improvements in the design of their kit to address some of the deficiencies identified in our evaluation. A second round of kit evaluations is therefore desired. However, due to the effort needed to evaluate these kits, this work can not be initiated with current resources. This effort will be initiated if additional resources become available. The following personnel are responsible for this study: Michael J. Myers Haile Yancy Dottye Farrell Christine Deaver, ORAU Fellow Yolanda Jones Staff Scientist The following table presents the objectives and the title of each study. FY Objective/Study Title FTE 09 0.3 Re-evaluation of the Neogen Reveal for Ruminant test and other tests identified by the manufacturers as modified to improve the test performance. Survey Microbiology of Animal Feed and Feed Commodities The animal feed industry is a parallel industry to the animal production industry. The feed industry manufactures over 100 million tons of feed for animal production, not including that required for dairy herds and for the maintenance of breeding stock. With the exception of the cereal grains and grasses, virtually all other commodities that comprise animal feeds are by-products of other industries including the animal production industry. The feed industry can be viewed as a recycling business that provides sources of nutrients of high biological value for animal production and for companion animals. It is this process of recycling that may serve as a mechanism for the introduction and maintainence of bacterial pathogens and antibiotic resistance determinants in the animal production environment. There are many reports over the years demonstrating the role that animal and insect vectors play in the transmission of bacteria in animal production units. There is limited information on the role of feed in the transmission of bacterial pathogens, including antibiotic resistant strains. Most of the information that exists is fragmentary and is targeted at human pathogens, such as Salmonella and recently E. coli O157:H7. Recent reports of the isolation of synercid-resistant enterococci and methicillin resistant staphylococci from this environment suggest the need for a better understanding of the following: Microbial dynamics of feed Role feed may play in pathogen transmission Establishment and dissemination of antibiotic resistance in the animal production environment The purpose of this research is to establish a survey program that routinely screens feedstuffs and complete feeds received at OR and those provided by outside collaborators. We establish cultural methods to determine the presence of various organisms of interest, including Salmonella, E. coli, Enterococcus spp., Staphylococcus spp., and Clostridium. In addition, we will assess the susceptibility of the isolates from these studies to antibiotics used in food-producing animals and in human medicine. Development of this program and its conduct over time will allow a better assessment of the role animal feed plays in the introduction of pathogens into the animal production environment. The program will also assess the potential for feed to disseminate resistance determinants in the animal population. This program provides the capacity to isolate specific bacteria from feed and feed commodities, which the Division of Animal and Food Microbiology can use in other research studies. The following personnel are responsible for this study: Patrick McDermott Peggy Carter Joseph Paige, OS&C The following table presents the objectives and the title of each study. FY OBJECTIVE/STUDY TITLE FTE 09- 11 Continue sample analysis on feed samples collected within FDA's Feed Contaminants Program (CPG 7371.003). 1.0 Develop Feed Security Tests The Office of Research continues to develop feed surveillance methods to enhance feed security preparedness. This project has branched in new directions in response to recent events and concerns. First, distiller’s grain (DG) is a major co-product of dry-grind ethanol distillation. It is rich in nutrients and, as such, is an excellent feed supplement for livestock. However, there is concern that residues may occur in DGs from the antibiotics used to prevent bacterial growth during ethanol fermentation, especially if DGs are subsequently incorporated into animal feed. Surveillance and enforcement methods are needed to support any remedial action to be taken against the incidence of these residues in DG. A multi-class, multi-residue SPE ion trap-LC/MS/MS method was developed to monitor for antibiotics in distillers dry grain. Thirteen compounds have been included in the current phase of this project,. The next phases include (1) extending the method to distiller’s wet grain and DG solubles, (2) adding additional target compounds, (3) transfering the method to a triple quadrupole instrument (4) including internal standards for improved quantitation (5) assisting the implementation of the method in field laboratories. Another aspect of this project will be to evalaute the performance benefits of using OR’s new quadrupole time-of-flight instrument with this method. Second, a parallel method development project will continue, with the aim of identifying whether mycotoxins from moldy corn survive the fermentation process and remain in distillers grain byproducts. A multi-residue method will be developed to incorporate as many compounds as possible, focussing on aflatoxins. Initial stages have been carried out, including optimization of chromatography and mass spectrometry for detection of standards, and testing of published extractions methods. Third, the discovery of melamine and cyanuric acid as fraudulent nitrogen dopants in animal feed ingredients has become a significant health and safety question. OR scientists developed and validated an LC/MS/MS screening method for these compounds in a variety of finished animal feeds and feed ingredients. This method will be used to test feeds used in OR research projects, and will be modified to test other nitrogen-rich compounds that might be considered alternatives to melamine or cyanuric acid. CVM will continue to apply liquid chromatography-tandem mass spectrometry (LC-MS/MS) to new surveillance challenges. As new and existing methods are developed or adapted for the new target compounds and matrices, the provisional methods will be subjected to second analyst checks and method validation. Meanwhile the on-going effort to develop LC-MS/MS methods for possible chemical contaminants and toxins in feed will continue. This aspect of the study has now been underway for three years and although significant progress has been made, much remains to be done. CVM will seek to apply rapid screening and LC-MS/MS to the surveillance of a variety of animal feeds for deliberate contamination by drugs, pesticides, and/or other toxins. CVM’s role in a food security crises is to provide the scientific support through the development of rapid and specific agent detection capabilities. The rapid detection of agents, or worse, the validation of rumors of agents, is a critical requirement for decisions regarding the magnitude of the crisis and solutions to the problems. A rapid assessment of the presence or absence of broad classes of biological agents or chemicals may be acquired through the use of commercially available rapid screening kits. Quantitative and/or qualitative determination of the specific biological or chemcal agents are often accomplished with state-of-the-art LC-MS/MS analytical procedures. Aflatoxin is a naturally occurring mycotoxin which may contaminate feed ingredients or may be added intentionally to adulterate prepared feeds. The sensitivity and specificity of two commercially available, AOAC approved aflatoxin screening test kits (Agri-Screen by Neogen and Afla Test P by Vicam) are being evaluated in corn contaminated with known levels of naturally occurring aflatoxin. The same test systems are also being applied to corn samples to which feed components have been added and to the final animal feeds into which the aflatoxin contaminated corn has been incorporated. The same performance evaluation in feed ingredients concept followed by validation in final feed products may be applied to additional commercially available screening test kits for other naturally occurring mycotoxins. Some unknown threat agents may involve security issues which will limit the ability of CVM to study these agents, however, in some cases sufficient information may be gained through the use of “simulants” and the principles may also be applied to similar unknown agents. Finally, a new intelligence-gathering scheme is planned to enhance CVM’s ability to identify potential threat agents to include in method development. The following personnel are responsible for this study: David N. Heller Cristina Nochetto Hemakanthi de Alwis FY OBJECTIVE/STUDY TITLE FTE 09 Apply the validated LC-MS/MS method for veterinary antibiotic residues in Distillers Grain to the analysis of survey samples. Add additional compounds as needed and transfer the method to a triple quadrupole instrument. Apply LC-MS/MS methods for melamine and cyanuric aicd in multiple animal feed matrices to testing of OR feeds. Add other possible target analytes. Develop and validate multiresidue LC-MS/MS method for fungal mycotoxins in prepared feeds Develop and validate extraction methods for aminoglycosides in feed. Design a novel scheme for intelligence-gathering on potential contaminants in animal feed Validate rapid screening test systems for aflatoxins in feeds prepared from grains 3.0 10 Continue laboratory analyses as needed, data compliation and write-ups of method procedures . Complete method validation and testing of various provisional methods, prepare method standard operating procedures and reports. Identify and evaluate additional rapid screening test systems for toxins in grains and prepared feeds 1.5 11 1.5 Evaluate LC-Q-TOF for screening animal feed for organic contaminants, without prior assumptions of potential targets. Transfer methods to field laboratories for second analyst checks, multi-laboratory trials and application in feed surveillance CVM Subcommittee Report (8-17-09) Appendix 3.6-A 1 1 FDA Science Board Review of CVM’s Research Program July 15-16, 2009 Dr. Bernadette Dunham Director, CVM 2 Office of the Center Director Director Bernadette M. Dunham, D.V.M., Ph.D. Executive Director Tracey Forfa, J.D. Senior Advisor for Science Policy William Flynn, D.V.M., M.S. Office of the Center Director Director Bernadette M. Dunham, D.V.M., Ph.D. Executive Director Tracey Forfa, J.D. Senior Advisor for Science Policy William Flynn, D.V.M., M.S. Office of Management Director David E. Wardrop, Jr. Deputy Director Roxanne Schweitzer Office of Management Director David E. Wardrop, Jr. Deputy Director Roxanne Schweitzer Office of New Animal Drug Evaluation Director Steven D. Vaughn, D.V.M. Deputy Director for Administration David R. Newkirk, Ph.D. Deputy Director for Science & Policy Elizabeth A. Luddy, D.V.M. Office of New Animal Drug Evaluation Director Steven D. Vaughn, D.V.M. Deputy Director for Administration David R. Newkirk, Ph.D. Deputy Director for Science & Policy Elizabeth A. Luddy, D.V.M. Office of Surveillance and Compliance Director Daniel G. McChesney, Ph.D. Deputy Director Martine Hartogensis, D.V.M. Office of Surveillance and Compliance Director Daniel G. McChesney, Ph.D. Deputy Director Martine Hartogensis, D.V.M. Office of Research Director David White, M.S., Ph.D. Deputy Director (Acting) Michael Thomas, M.S. Office of Research Director David White, M.S., Ph.D. Deputy Director (Acting) Michael Thomas, M.S. Office of Minor Use Minor Species Animal Drug Development Director Margaret Oeller, D.V.M. Office of Minor Use Minor Species Animal Drug Development Director Margaret Oeller, D.V.M. Associate Director for Policy and Communications Catherine P. Beck Associate Director for Policy and Communications Catherine P. Beck Associate Director for Management David E. Wardrop, Jr. Associate Director for Management David E. Wardrop, Jr. CVM Subcommittee Report (8-17-09) Appendix 3.6-A 2 3 CVM’s High Priority Public Health Issues • Unapproved Animal Drug Products • Pet Food/Food Protection • New Animal Drug Safety • Regulating Genetically Engineered (GE) Animals • Addressing Antimicrobial Resistance • Generic Animal Drug Review • Preventing the establishment and amplification of Bovine Spongiform Encephalopathy (BSE) through Animal Feed • Minor Use and Minor Species (MUMS) • Food and Drug Administration Amendments Act (FDAAA) of 2007 4 Scientific and Technical Disciplines at CVM 0 20 40 60 80 100 120 Veterinarians - 106 Chemists - 46 Consumer Safety Officers - 46 Microbiologists - 40 Biologists - 36 Other Scientific Disciplines - 30 Mathematical Statisticians - 14 Graph does not display 100% of CVM staffing CVM Subcommittee Report (8-17-09) Appendix 3.6-A 3 5 Core Business Processes Pre-market Review • New Animal Drug Review • Generic Animal Drug Review • Minor Use and Minor Species • Applied Research Product Quality Safety • Tissue Residues • Compliance Activities • Compounding/Dosage Form Drugs • Bovine Spongiform Encephalopathy (BSE) • Counterterrorism • Zoonotic Diseases • Applied Research Patient Consumer Safety • Animal Feed Safety System • Antimicrobial Resistance • Adverse Events • Applied Research 6 Animal Drug Manufacturers (300) Feed Manufacturers (6,600) Livestock and Poultry Producers (over 1 million) Specialized Industry/Firms (a variety) The Center for Veterinary Medicine (CVM) is responsible for regulating animal drugs, devices, and food additives from: given to or used on: 8.5 billion chickens & turkeys 160 million cattle & pigs 11 million sheep & goats consumed by: 300 million humans in the U.S. Food Protection Food Protection 70% CVM Subcommittee Report (8-17-09) Appendix 3.6-A 4 7 Cross-cutting Themes • IT Transformation to an Electronic Environment • Recruiting Personnel and Staff Development • New Scientific Technology (genomics, nanotechnology, etc.) • International Harmonization and Outreach • Animal Health Literacy • High Performance Organization 8 CVM Mission Protecting both Animal Health and Public Health CVM Subcommittee Report (8-17-09) Appendix 3.6-B 1 1 Research in Support of the Center for Veterinary Medicine Comments by David White, Ph.D. Director, Office of Research Center for Veterinary Medicine 2 CVM’s Challenges ..Food Protection/Import Strategy ..Animal Biotechnology (genetic engineering and cloning) ..Antimicrobial Resistance (includes NARMS) ..Animal Drug User Fee Act (ADUFA) ..Animal Generic Drug User Fee Act (AGDUFA) ..Minor Use Minor Species (MUMS) ..Food and Drug Administration Amendments Act (FDAAA) of 2007 ..Bovine Spongiform Encephalopathy (BSE) CVM Subcommittee Report (8-17-09) Appendix 3.6-B 2 3 CVM’s Core Responsibilities ..New Animal Drug Review ..Animal Generic Drug Review ..Post-approval monitoring of animal drugs and feeds, and marketed animal devices ..Animal Feed Protection/Safety ..Compliance related actions ..Research to support regulatory decision-making – Pre-Market Review – Product Quality Safety – Patient Consumer Safety 4 CVM’s Office of Research (OR) ....>165 acres ....8401 Muirkirk Road ....About 70 staff ....Large-animal housing and surgery suites ....Specialized laboratories ....Aquaculture ....Pastures ....Feed mixing facility ....Quarantine facility CVM Subcommittee Report (8-17-09) Appendix 3.6-B 3 5 OR Capabilities ....Research programs - Food and companion animals - Animal and public health ....Specialized and unique facilities/instruments ....Diverse scientific backgrounds - Training - Assistance for Drug reviews ....Leveraging / Collaborations – CFSAN/ORA/CDRH/NCTR – USDA, CDC – Academia – International The research staff at CVM/OR conduct studies to support both preand post-marketing activities by providing information to aid CVM scientists in the review and decisionmaking process 6 Office of Research - Laboratories ....Residue Chemistry ....Animal Research ....Animal and Food Microbiology To conduct research to ensure public health, the safety of animal health products and the safety of animal feed CVM Subcommittee Report (8-17-09) Appendix 3.6-B 4 7 Large Animal Research Facilities Milk and meat safety Antimicrobial resistance Cardiovascular disease research (CDRH) Aquaculture research Biomarker research 8 Office of Research: Organization ..Office of the Director .. Dr. David White, Director .. Mr. Michael Thomas, Acting Deputy Director .. Division of Residue Chemistry .. Dr. Phil Kijak, Acting Director .. Division of Animal Research .. Dr. Jeff Ward, Acting Director .. Division of Animal and Food Microbiology .. Dr. Pat McDermott, Director NARMS .. Dr. Pat McDermott, Director .. Dr. Beth Karp, Coordinator CVM Subcommittee Report (8-17-09) Appendix 3.6-B 5 9 OR Scientists’ Training Animal/Dairy/Food Science Chemistry/ Biochemistry Biology/Microbiology/Molecular Biology Epidemiology Immunology Pharmacology Pathology Toxicology Veterinary Medicine 10 Office of Research: Personnel 0 2 4 6 8 10 12 14 16 18 20 Microbiologists Chemists Biologists Other Fellows Scientific Discipline # Staff Graph does not display 100% of OR staffing Currently recruiting 5 principal investigators: 2 Chemistry 2 Microbiology 1 Pharmacogenomics 2 administration positions: 1 Supervisory Business v Administrative Manager 1 Staff Specialist *Other includes quality assurance officers, epidemiologists, animal scientists, VMOs, animal caretakers and pharmacologists 2 VERN positions: 1 Microbiologist 1 Chemist * CVM Subcommittee Report (8-17-09) Appendix 3.6-B 6 11 Professional Recognition .. Service to America Medal Finalist - Dr. Renate Reimschuessel, melamine in pet food .. FDA Scientific Achievement Award - Dr. Shaohua Zhao, protecting public health .. FDA Outstanding Service Award – - Dr. Mike Myers, IACUC commitment to excellence .. CVM Excellence in Laboratory Science - Dr. Renate Reimschuessel .. CVM Outstanding Junior Investigator Award - Dr. Heather Harbottle .. PHS Achievement Medal - LT Shani J. Smith, exemplary and dedicated performance .. CVM Outstanding Support Scientist Award - Althea Glenn 12 .. Division of Residue Chemistry .. Lauren Girard / Dr. Hemkanthi De Alwis .. Division of Animal Research .. Christine Deaver / Dr. Michael Myers .. Sharla Peters / Dr. Michael Myers .. Nadia Francis / Dr. Haile Yancy .. Lauren Callahan / Dr. Haile Yancy .. Tamara Mayer / Dr. Renate Reimschuessel .. Division of Animal and Food Microbiology .. Thu Tran / Dr. Shaohua Zhao .. Niketta Womack / Emily Tong .. Claudine Kabera / Dr. Beth Karp .. Dr. Daniel Tadesse / Dr. Heather Harbottle ORISE The Oak Ridge Institute for Science and Education (ORISE) manages the Research Participation Program for CVM which provides opportunities for postdoctoral fellows, postgraduate interns, students, and faculty to participate in programs, projects, and activities supportive of CVM’s and FDA’s mission CVM Subcommittee Report (8-17-09) Appendix 3.6-B 7 13 .. Division of Residue Chemistry .. Dr. Donglei Yi / Dr. Badar Shaikh .. Dr. Hiranthi Jayasuriya / Dr. Pak Chu .. Division of Animal Research .. Dr. Maocheng Yang / Dr. Michael Myers .. Dr. Cynthia Stine / Dr. Renate Reimschuessel .. Division of Animal and Food Microbiology .. Dr. Heather Green / Dr. Shaohua Zhao .. Dr. Aparna Singh / Dr. Patrick McDermott FDA Commissioner's Fellowship Program Provides an opportunity for health professionals and scientists to receive training and experience at the FDA. The program combines rigorous didactic coursework with the development of a hypothesis-driven, regulatory science research project 14 Office of Research: Budget $7,910 $7,047 $7,994 $9,169 $9,840 0 2000 4000 6000 8000 10000 FY 05 FY 06 FY 07 FY 08 FY 09 Millions CVM Subcommittee Report (8-17-09) Appendix 3.6-B 8 15 CVM Research ..Maintains a strong science base - Accredited by the American Association for Accreditation of Laboratory Animal Care (AALAC) - GLP compliant • Quality Assurance unit • OR Research Manual ..Collaborative research and outreach ..Answers CVM needs - Public and animal health mission - Resolves evolving FDA issues - Provide scientific foundation to establish solid regulatory policy 16 Research Priorities Identify research needs with preand post market CVM offices - ONADE - OS&C, OMUMS - Other Center’s needs and Agency programs Three Year Plan - Internal Prioritization of OR’s research - Prepared by OR - Center Management Team (CMT) reviews & approves CVM Subcommittee Report (8-17-09) Appendix 3.6-B 9 17 Research Metrics OR’s Annual Report - reviewed by CMT & CVM staff Facilities and personnel Research accomplishments Premarket / Drug review Compliance Post-approval monitoring Animal feed safety Leveraging Publications/Presentations Final reports 18 Research Publications Clinical Infectious Diseases Journal of Bacteriology Foodborne Pathogens and Disease Journal of Food Protection Antimicrobial Agents and Chemotherapy Applied and Environmental Microbiology Journal of Clinical Microbiology Avian Diseases PLoS One Veterinary Microbiology Emerging Infectious Diseases American Journal of Veterinary Research Molecular and Cellular Probes Journal of Aquatic Animal Health Journal of Veterinary Pharmacology and Therapeutics International Journal of Toxicology Toxicological Sciences Journal of Agriculture and Food Chemistry Journal of Chromatography Journal of AOAC International Journal of Chromatography B Rapid Communications in Mass Spectrometry Pathobiology Journal of Dairy Science CVM Subcommittee Report (8-17-09) Appendix 3.6-B 10 19 OR Publications 20 Professional Service .. Editorial Boards – Veterinary Microbiology – Foodborne Pathogens and Disease – Antimicrobial Agents and Chemotherapy – The Open Agricultural Journal – Journal of Veterinary Pharmacology and Therapeutics – Journal of Food Protection – Journal of Toxicologic Pathology – American Journal of Veterinary Research – Journal of the American Veterinary Medical Association .. Numerous professional, international, government, Agency and Center committees .. WHO - Global Foodborne Infections Network (GFN) - Advisory Group on Integrated Surveillance of Antimicrobial Resistance (AGISAR) .. Codex Alimentarius - Committee on Residues of Veterinary Drugs in Foods (CCRVDF) - Task Force on Antimicrobial Resistance (TFAMR) .. AOAC International CVM Subcommittee Report (8-17-09) Appendix 3.6-B 11 21 .. Use of technologies to align research with regulatory needs – Strengthening our capabilities in “omics” to ensure safety of foods and drugs .. Critical Path – Better Evaluation Tools – Developing New Biomarkers and Disease Models • Pharmacogenomics • Biomarkers in Animals – Developing Products to Address Urgent Public Health Needs • Food and feed safety .. Food Protection Plan – Development and validation of detection methods for drug residues and resistant foodborne pathogens in foods and feeds CVM Research Strategy 22 .. Pharmacogenomics of the MDR-1 Gene Mutation and the Effect on P-Glycoprotein Substrates in Dogs and Other Veterinary Species .. Interrogating Salmonella Diversity Using a Novel Genome Microarray .. Characterization and Functional Analysis of Bronchial Antimicrobial Peptides Using an Animal Pneumonia Model CVM Critical Path Projects CVM Subcommittee Report (8-17-09) Appendix 3.6-B 12 23 Premarket/Drug Review .. Animal Drug Safety and Efficacy .. Antimicrobial Resistance Mechanisms .. Immunopharmacology .. Metabolism and Residue Depletion .. Method Trials .. Microbiological Methods .. Pharmacokinetics/Pharmacodynamics 24 A New Era of Biotechnology .. The first genetically engineered (GE) animal NADA was approved by CVM February 2009 .. GE goats make Antithrombin III (Atryn®) in their milk .. OR worked with the sponsor’s team to develop and validate a real-time PCR regulatory assay suitable for identifying the GE goats .. The assay provides the agency the ability to be able to identify GE goats .. Future studies will require scientist from OR working with sponsors in the pre-approval process to develop assays to detect GE animals http://www.sciam.com/blog/60-second-science/post.cfm?id=fdaapproves- blood-thinner-atryn-ma-2009-02-09 CVM Subcommittee Report (8-17-09) Appendix 3.6-B 13 25 Compliance .. Drug Residue Methods .. Method Trials and Validation .. Pharmacokinetics and Residue Depletion .. Screening Tests .. Incursion Services Harmful Residues 26 Multi-class Residue Methods ..Drug residue methods – Develop multiclass multiresidue screening & confirmatory methods for drugs residues in meat, eggs and fish – Develop regulatory methods for specific problems, e.g. chloramphenicol and nitrofurans in imported shrimp ..Screen/Confirmation in Finfish – Single LC-MSn qualitative analysis – Single extraction scheme – Total of 36 drugs – Four species of fish: salmon, trout, catfish, tilapia CVM Subcommittee Report (8-17-09) Appendix 3.6-B 14 27 Melamine Research Melamine cyanurate Determined depletion of melamine residues in 2 species of fish and initiated No Observable Effect Level (NOEL) tests for melamine kidney crystal formation, to facilitate FDA’s risk assessment efforts Global concern of triazine animal feed contimination 28 Melamine Studies Melamine Depletion in Catfish and Trout Filets 0.00 3.00 6.00 9.00 12.00 0 3 6 9 12 15 18 21 24 27 30 Days mg/kg Melamine Catfish Melamine Trout Melamine Trout MEL+CYA Catfish MEL+CYA Level of Concern 2.5 ppm 20 mg/kg BW Residues below 2.5 mg/kg on day 7 CVM Subcommittee Report (8-17-09) Appendix 3.6-B 15 29 Animal Feed Safety ..Assurance of the safety of animal feed and feed commodities is one of the central regulatory obligations of CVM - Development and evaluation of analytical methods for detection of unsafe contaminants in feeds · BSE – Detecting prohibited substances · Chemical method development - Conduct of microbiological surveys of feed commodities for contamination with foodborne pathogens · Salmonella in animal feeds 30 Molecular Detection of Animal Proteins in Animal Feed .. The 1997 FDA Feed Ban prohibited adding mammalian proteins to ruminant feed – Cattle, sheep, goat, deer and elk main concern .. FDA currently uses feed microscopy to detect and PCR to confirm – Time consuming with low sample processing rate .. Have developed a multiplex PCR method to detect all 5 species listed above – Currently undergoing final evaluation and validation .. Will permit a shift in testing paradigm, resulting in a significant increase in sample throughput cattle deer sheep CVM Subcommittee Report (8-17-09) Appendix 3.6-B 16 31 Post-Approval Monitoring .. Surveys - Microbiological .. Microbiological Methods .. Method Trials – Microbiological 32 Standardized Testing Methods CVM Subcommittee Report (8-17-09) Appendix 3.6-B 17 33 National Antimicrobial Resistance Monitoring System (NARMS) .. Provide data on extent, temporal trends in enteric bacteria .. Collaboration among: – FDA/CVM (retail meat) – CDC (humans) – USDA (food animals .. Platform for research .. Help FDA decision-making in approval of veterinary, human drugs – Promote antimicrobial stewardship – Supports the Agency’s mission as a science-based regulatory agency 34 NARMS Objectives 1. Monitor trends in antimicrobial resistance among foodborne bacteria from humans, retail meats, and animals 2. Disseminate timely information on antimicrobial resistance to promote interventions that reduce resistance among foodborne bacteria 3. Conduct research to better understand the emergence, persistence, and spread of antimicrobial resistance 4. Assist the FDA in making decisions related to the approval of safe and effective antimicrobial drugs for animals CVM Subcommittee Report (8-17-09) Appendix 3.6-B 18 35 FDA Science Board Subcommittee Review of NARMS The FDA Science Board Advisory Committee established a subcommittee to evaluate the NARMS program (2007) • NARMS has evolved into a mission-critical tool for FDA • Outstanding progress over last decade • High priority for future support and attention • Suggest visioning, strategic, and business planning processes be adopted • Suggest the program should become more predictive, responsive, & expansive 36 Focus Areas and Key Findings 1. Sampling strategies – Use national, random sampling when possible .. When not feasible, further stratify data or use a more targeted sampling strategy – Encourage monitoring of commensals 2. Research studies – Encouraged further development and expansion – Emphasis on hypothesis-driven and collaborative research 3. International activities – Strongly endorsed continuation and expansion of international activities, including training 4. Data harmonization and reporting – Need for an integrated database and timely reporting CVM Subcommittee Report (8-17-09) Appendix 3.6-B 19 37 .. CDC - NARMS - PulseNet .. USDA - National Center for Cool and Cold Water Aquaculture - Bee Research Laboratory - Bacterial Epidemiology and Antimicrobial Resistance Research Unit Leveraging Activities .. Academia - University of Maryland - University of Minnesota, NCSU, Ohio State University, University of Georgia, Iowa State University, Howard University, NDSU, Marshfield Clinic .. Florida Department of Agriculture .. AOAC International .. European Union Community Reference Laboratories .. 2010 - VERN CVM works with others outside FDA in ways that will help the Agency meet its public health responsibilities Look beyond the boundaries of our laboratories Develop new partnerships 38 .. CVM will develop a network which will coordinate the facilities, equipment and professional expertise of U.S. veterinary diagnostic laboratories along with those of the federal government .. This network will provide the means for faster identification of animal injury reports associated with animal feed contamination .. 3 FTEs – 2 to be located at OR – Coordinate and oversee contracts/communication – Enhance infrastructure capabilities – Validate standardized analytical protocols and sample collection methods Veterinary Emergency Response Network VERN CVM Subcommittee Report (8-17-09) Appendix 3.6-B 20 39 Strategic Planning .. Environmental Scan – Office of Management – February, 2009 • External environments (economy, politics, technology) • SWOT • Organizational sustainability (priorities, resources) .. OR leadership retreat – Strategic planning – March 4, 2009 • Office in transition • Shared vision – Core values (e.g. integrity, commitment to excellence) – Challenges of research in regulatory framework (reactive vs. proactive) – Business practices – Positive work environment 40 Challenges .. Maintain visibility and importance of research at FDA - Distance/separation to rest of CVM and FDA - Improve outreach to stakeholders .. Attract and retain nationally and internationally recognized scientific personnel - Staff support - State of the art instrumentation .. Build and maintain modern comprehensive research facilities - Laboratory modernization - Only large animal facility at FDA - NARMS, VERN, SFSA? .. Stay current on emerging and innovative technologies - Omics - Biosensors - Nanotechnology .. Scientific computing - Modern information infrastructure - Bioinformatics .. Procurement issues CVM Subcommittee Report (8-17-09) Appendix 3.6-B 21 41 .. Focused on two critical path areas and FPP – Developing New Biomarkers and Disease Models – Developing Products to Address Urgent Public Health Needs • Detection methods for drug residues and resistant foodborne pathogens in foods and feeds .. Designed to identify and develop scientifically sound solutions to new concerns that are likely to arise regarding the safety, quality, and efficacy of new and existing FDA regulated products – Premarket/Drug review – Compliance – Post-approval monitoring – Animal feed safety .. Provide the scientific basis on which to base new procedures, policies, and regulations CVM OR Research – Summary 42 Thank you for your time! CVM Subcommittee Report (8-17-09) Appendix 3.6-C 1 1 CVM Office of Research Division of Animal Research Jeffrey L. Ward, DVM, MS, PhD Acting Director OR Attending Veterinarian 2 Mission The Division of Animal Research (DAR) conducts applied and basic research using animals and animal systems in support of current and evolving regulatory issues. We provide research solutions to issues of animal health, food safety of animal derived products, and other animal industry associated technologies. CVM Subcommittee Report (8-17-09) Appendix 3.6-C 2 3 DAR Staff • Supervisory Veterinary Medical Officer • Senior Research Biologist • Senior Research Pharmacologist • Research Chemist • Research Biologist • 2 Biologists • Research Biologist (Pharmacogenomics) - vacant • 7 Biologists • 2 Microbiologists • Animal Scientist • 3 Animal Caretakers • 5 ORAU Fellows • 2 Commissioner’s Fellows Study Directors Support Staff 4 DAR Research Program Areas • Aquaculture Research • Genomics/Proteomics • Pharmacokinetics/ Pharmacodynamics • Support Services In support of: • Food Protection Plan • Minor Use/Minor Species • Critical Path Initiative CVM Subcommittee Report (8-17-09) Appendix 3.6-C 3 5 Aquaculture 6 Main Goals • To facilitate new drug approval process for aquatic species (minor species) • To assist with the Agency’s surveillance efforts to protect the food supply from illegal drugs/chemicals in food fish Research Collaboration and Prioritization: 1. CVM’s ONADE, OMUMS, and OS&C 2. US Aquaculture industry 3. JSA -Joint Subcommittee on Aquaculture (USDA, NOAA, USFWS, HHS) 4. National Program to Approve Animal Drugs for Minor Species and FDA’s Aquaculture Research Task Force (ORA, CFSAN, CVM) 5. NADRF- National Aquaculture Drug Research Forum 6. NRSP-7 - National Research Support Project B 7 7. University of Maryland Aquaculture - Overview CVM Subcommittee Report (8-17-09) Appendix 3.6-C 4 7 New Drug Approval • Develop disease models - efficacy studies .. Efficacy of formalin for treating fungal infections .. Internal parasite disease model (LMB) for parasiticide evaluation • Examine drug effects on non-target species .. Effects of oxytetracycline on aquatic plants and algae • Develop AST standards – treatment, diagnostics, & resistance monitoring. • Development of the first interpretive criteria for aquaculture .. Setting “breakpoints” .. Expanded approval of antimicrobial agents • Pharmacokinetic (depletion) studies in fish Aquaculture - Overview 8 M42-A Aeromonas salmonicida subsp. Salmonicida ATCC 33658 Escherichia coli ATCC 25922 28 şC M49-A Disk diffusion • 22 °C and 28 °C Broth dilution • 22 °C and 28 °C AST method development Methods and QC parameters CVM Subcommittee Report (8-17-09) Appendix 3.6-C 5 9 • Searchable Database of Pharmacokinetic Data in Aquatic Animals Reimschuessel, R., Stewart, L., Squibb, E., Hirokawa, K., Brady, T., Brooks, D., Shaikh, B., Hodsdon, C., 2005. Fish drug analysis—PhishPharm: a searchable database of pharmacokinetics data in fish. American Association of Pharmaceutical Scientists Journal 7:E228-327. • 2008 Update – CD • 508 Compliance • Accessible through the FDA website 10 Aquaculture - Overview Surveillance 1. Provide incurred residue samples - chemical method development (CVM, ORA, CFSAN, NCTR) 2. Bridging Studies – Erythromycin A in salmon (ONADE/Div. of Human Food Safety) CVM Subcommittee Report (8-17-09) Appendix 3.6-C 6 11 Melamine/Cyanuric Acid 2007 Petfood Recall • Kidney failure in dogs and cats • Crystal formation in kidney • Economic fraud: flour + melamine sold as gluten (feed ingredient) • Pig, chicken, and fish feed also contaminated .... Incurred residue requests – OS&C/ORA/USDA .... GLP depletion study – CFSAN/NCTR • Catfish & trout: mel only, cya only, combination • NOEL crystal formation • Sequential dosing • Added – long term (28d) mel-only 12 Melamine/Cyanuric Acid Depletion Melamine Depletion in Catfish and Trout Filets 0.00 3.00 6.00 9.00 12.00 0 3 6 9 12 15 18 21 24 27 30 Days mg/kg Melamine Catfish Melamine Trout Melamine Trout MEL+CYA Catfish MEL+CYA Level of Concern 2.5 ppm CVM Subcommittee Report (8-17-09) Appendix 3.6-C 7 13 Glomeruli Glomeruli Crystals CONTROL Melamine Only Cyanuric acid Only (Normal appearance) MELAMINE+CYANURIC ACID DOSED • Catfish Kidney 14 CVM Subcommittee Report (8-17-09) Appendix 3.6-C 8 15 Melamine/Cyanuric Acid - Swine • NCTR, CFSAN, WHO • NOEL determination – 7 day feeding/range finding – 28 day feeding – MEL/CA; MEL only – Preliminary NOEL range 3.3 – 10 mg/kg/d 16 DNA Barcoding CVM; CFSAN, ORA, Univ. of Guelph •Method development at OR/DAR for FDA field labs •PCR-based analysis of Cytochrome C Oxidase Subunit I •Identification of >70 species •RFE barcode reference library •Health impact; economic fraud CVM Subcommittee Report (8-17-09) Appendix 3.6-C 9 17 DNA Barcoding •Currently being used by CFSAN, ORA, NOAA, US Customs, and other federal agencies •2006/2007 Pufferfish related investigations Smuggling / import violations •2008 Identification of barracuda and grouper (mislabeled) involved in ciguatera poisoning •2009 Economic adulteration – 3 species mislabeled as “premium” species of food fish 18 BSE Detection of prohibited mammalian proteins • 1997 Feed Ban – Feed microscopy • Method development and kit evaluation • OS&C; ORA • Food Protection Plan • Simplex and Multiplex PCR • ELISA (antibody-based) CVM Subcommittee Report (8-17-09) Appendix 3.6-C 10 19 Deer/Elk Sheep/Goat Cattle Three reactions in 1 tube! Simplex RT-PCR vs Multiplex RT-PCR Cattle Sheep Goat Three different reactions in 3 different tubes SYBR green PCR Taqman Probe Based Multiplex PCR 20 Identification and Verification of Inflammatory Biomarkers in Swine using Gene Microarray Analyses Genomics/Proteomics •Biomarker discovery / validation •“Personalized” medicine •Adverse drug responses •Data standards/evaluation •Bioinformatics Agency/Center Aims CVM Subcommittee Report (8-17-09) Appendix 3.6-C 11 21 Genomics Fig.3. Microarray analysis of specific upregulated genes from pooled RNA (n=3) Fig.4. Microarray analysis of downregulated genes from pooled RNA (n=3). 22 Accession No. Gene Gene Symbol GO Biological Process CB475095 Serum amyloid A2 LOC733603 acute-phase response BI184638 Endothelial PAS domain protein 1 EPAS1 regulation of transcription BQ602316 IL-10 receptor Il-10RB signal transduction NM_214214 Monocyte Chemoattractant Protein 1 MCP-1 chemotaxis inflammatory response NM_214162 Caspase 1 CASP1 proteolysis BF710863 Thrombospondin-2 precursor THBS1 cell adhesion NM_213876 Alveolar Macrophage derived factor II AMCFII chemotaxis inflammatory response NM_213831 CD1 antigen CD1.1 immune response NM_001001908 CD4 molecule CD4 immune response CN163044 Cathepsin L CTSL2 proteolysis BF713431 * Interferon activated gene 203 LOC100156073 protein binding CK452419 * 3-phosphoadenosine 5-phosphosulfate synthase 2 PAPPS2 sulfate assimilation CB475695 * S100 calcium binding protein A12 (calgranulin C) / inflammatory response * Genes are similar to those found in other species (< 80% homology). All information based on NetAffx Query for Porcine Genome array (www.affymetrix.com) and Gene Cards (www.genecards.org). CVM Subcommittee Report (8-17-09) Appendix 3.6-C 12 23 Survey of the Bovine Milk Proteome Profiles generated on the relative abundance of: ....major milk proteins ....host response proteins ....acute phase proteins ....other inflammatory markers Proteomic methods developed to evaluate changes in milk proteins during infection/inflammation using: •2D gels and MALDI-TOF MS •LC and tandem MS Goal: Identification of biomarkers to support anti-inflammatory claims of NSAIDs Time Following Infusion (h) 0 6 12 18 24 30 36 42 48 Normalized spectral counts 0.000 0.005 0.010 0.015 0.020 0.025 0.030 0.035 0.040 Serum albumin Beta- lactoglobulin Alpha- lactalbumin 24 Time Following Infusion (h) 0 6 12 18 24 30 36 42 48 Fibrinogen A Normalized Spectral Counts 0.000 0.001 0.002 0.003 0.004 0.005 0.006 0.007 Fibrinogen alpha Fibrinogen beta Fibrinogen gamma Time Following Infusion (h) 0 6 12 18 24 30 36 42 48 Milk Haptoglobin (mg/mL) 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 Milk Haptoglobin Normalized Spectral Counts 0.0000 0.0002 0.0004 0.0006 0.0008 0.0010 0.0012 0.0014 0.0016 0.0018 Haptoglobin ELISA Haptoglobin Spectral counts 455_18hr# RT:29.28 AV:1 NL:2.24E3 500 1000 1500 2000 m/z 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100 Relative Abundance 340.89 374.13 586.20 275.12 715.25 204.06 771.23 MS/MS scan of a peptide from ITIH4 Comparison of ELISA data to Normalized Spectral Abundance Factors (NSAF) for Haptoglobin NSAF for 3 fibrinogen chains CVM Subcommittee Report (8-17-09) Appendix 3.6-C 13 25 Methods / Accomplishments • Profiled bovine milk proteins using 3 different proteomic strategies • Identified 75 proteins related to host response across a time course of E. coli infection • Used semiquantitative label-free analyses to evaluate temporal expression of inflammatory markers • Compared semiquantitative measures to ELISA data for high and low abundance proteins ....Methods will be used to profile biomarkers of inflammation in the milk of dairy goats for use in evaluating the efficacy of NSAIDs in treating inflammation associated with mastitis 26 Genomics/Proteomics ATryn • Recombinant protein regulated by CBER • GE animals regulated by CVM • OR/DAR role: .... Confirm genetic construct / insertion site / stability .... Evaluate method for detection (food protection) • Request of ONADE – future support will be provided Related issue : surrogate dam “safety” CVM Subcommittee Report (8-17-09) Appendix 3.6-C 14 27 Minor Use/Minor Species (MUMS) Approval Means of Withdrawal Last Sample Anthelmintic Abbreviation Brand Name Species Administration Time (days) Time (days) Levamisole LEV Levasole S, C Oral 2 (c)2, 3 (s, g) 2 (c), 3 (s, g) Fenbendazole FBZ Safe-Guard G, C Oral 8 (c), 6 (s, g) 8 (c, s, g) Albendazole ABZ Valbazen S, C Oral 27 (c), 7 (s, g) 28 (c), 8 (s, g) Ivermectin IVR Ivomec S(po, sc), C(sc) Oral/Inject1 35 (c), 11 (s, g) 84 (c), 28 (s, g) Doramectin DOR Dectomax C(sc) Inject1 35 (c, s, g) 72 (c), 42 (s), 28 (g) Moxidectin MOX Cydectin S(po) Oral 21 (c), 7(s, g) 120(c), 49 (s, g) 28 Anthelmintics / Minor Species (Preliminary) 0 0.5 1 1.5 2 2.5 0 5 10 15 20 25 Hours after dosing [Levamisole], ppm Calves Sheep Goats 0 10 20 30 40 50 60 70 80 90 100 0 5 10 15 20 hours [Ivermectin], ppb Calves Sheep Goats CVM Subcommittee Report (8-17-09) Appendix 3.6-C 15 29 0 5 10 15 20 25 0 1 2 3 4 5 6 IV Trial I (control) IV Trial II (infected) SQ Trial I (control) SQ Trial II (Infected) Equivalent Enrofloxacin Concentration (µg/ml) Time (hours) Comparison Comparison of Pharmacokinetic/Pharmacodynamic Parameters in Healthy vs. Diseased Animals Guidance/Tools for Efficacy and Human Food Safety Assessment… Goal: Refine Guidance policies relative to drug dosing and efficacy in diseased animals, with implications for tissue levels and possible residues; advise drug sponsors at pre-submission stage, to shorten new drug approval time. 30 Critical Path Projects •Cathelicidin-4 (P33046) •Cathelicidin-5 (P54229) •Cathelicidin-7 (P56425) •Cathelicidin-1 (UniProt:P22226) •Cathelicidin-2 (P19660) •Cathelicidin-3 (P19661) The change in relative abundance of cathelicidin-1 peptide AVDQLNEQSSEPNIYR over 24 hours. For clarity, only 1 biological replicate is shown, though the other 3 biological replicates demonstrate similar trends. Gray, healthy steer analyzed as a control (data for the 24 hour time point is not available). Yellow, infected steer. 0 1 2 3 4 5 6 0 6 12 18 24 Hours Post Infection Fold Change Characterization and Functional Analysis of Bronchial Antimicrobial Peptides Using an Animal Pneumonia Model CVM Subcommittee Report (8-17-09) Appendix 3.6-C 16 31 Significance • Method development and evaluation; proteomic data analysis and management • In vitro evaluation methods • Biomarker identification • Shorten product approval times by identifying key characteristics of peptides and gaining familiarity with evaluation methods 32 Pharmacogenomics of the MDR-1 Gene Mutation and the Effect on P-Glycoprotein Substrates in Dogs and Other Veterinary Species CVM Subcommittee Report (8-17-09) Appendix 3.6-C 17 33 Objectives • A three year study to explore the potential impact of multidrug resistance-1 (MDR-1) gene mutation on drug safety in the canine population – To determine whether the systemic drug exposure of known P-gp substrates differ when administered to dogs that are homozygous recessive, heterozygous or the wild-types • renally cleared • hepatic/biliary cleared • issues pertaining to stereospecificity – Develop in vivo and in vitro models to determine whether or not a compound is a P-gp substrate 34 Genomics -/- S -/- S +/+ NS +/+ NS CVM Subcommittee Report (8-17-09) Appendix 3.6-C 18 35 Venn Diagram of Loperamide Induced Gene Changes Sensitive Phenotype Non-Sensitive Phenotype 36 Significance • Data analysis/management • “Personalized” medicine • Adverse drug reactions • Correlation With PK and clinical data • Shorten product approval times; e.g. mouse model – “knock-out” and “knock-in” CVM Subcommittee Report (8-17-09) Appendix 3.6-C 19 37 Support Services • Incurred residue requests – Melamine/cyanuric acid (ORA, USDA) – Antibiotics (Multiple sponsors) – Hormones (DRC) – Anti-viral drugs (DRC) – Pen G bridging study (DRC/DAFM) • CDRH cardiovascular studies • Other Centers/Agencies • Surge responses AJVR (2008) 69:1217-1228 Feed Evaluation Devices Necropsy 38 Strengths • Diversity of staff • Food animal expertise and research capabilities • Rapid response to requests for samples and data Division of Animal Research Trends • “Omics” approaches • Food protection emphasis • Team emphasis / realignment CVM Subcommittee Report (8-17-09) Appendix 3.6-C 20 39 Challenges Scientific • Food Protection Plan – Whole foods – GE animals • “Omics” – Biomarkers – Adverse drug reactions – “Personalized medicine” • Veterinary Medical Practice – MUMS – Antibiotic resistance 40 Questions? CVM Subcommittee Report (8-17-09) Appendix 3.6-C 21 41 CVM Subcommittee Report (8-17-09) Appendix 3.6-D 1 Division of Residue Chemistry Philip James Kijak, Ph.D. Acting Director, Division of Residue Chemistry U.S. Food and Drug Administration Center for Veterinary Medicine Office of Research Laurel, MD Mission of Division • DRC conducts analytical research for compounds which pose a potential health risk if found in animal tissue or feed. We develop and validate methods for official and research uses. We determine the fate of xenobiotics in animals to answer questions about their safety or efficacy CVM Subcommittee Report (8-17-09) Appendix 3.6-D 2 Staffing • Six principal investigators • Six support chemists • Two Commissioner's Fellows • Two vacancies Significant Contributions • NADA method trials • Guidance 118 • Melamine methods for feeds • Milk test kit program CVM Subcommittee Report (8-17-09) Appendix 3.6-D 3 NADA Method Trials • Original mission of the division • Typically one to two trials per year • Often last item required for an approval • Can methods be transferred Method Ruggedness • Chromatography changes between instruments impact matrix effects on analyte ionization CVM Subcommittee Report (8-17-09) Appendix 3.6-D 4 Guidance 118 Mass Spectral Confirmation • Lack of guidance on criteria for confirmation of compound identity • No consensus on criteria • Working group led by DRC Guidance Developed • Working group developed draft document • Input and comments from CFSAN, ORA, NIST, EPA CVM Subcommittee Report (8-17-09) Appendix 3.6-D 5 Melamine methods for feeds • Established method for simultaneous detection of melamine and cyanuric acid in feeds • Used method for evaluation of feed used for OR research animals Retention Time, min 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00 6.50 7.00 7.50 8.00 8.50 9.00 9.50 10.00 % 0 100 7.51 8.44 4.56 Cyanuric Acid Melamine 100% = 976 m/z 128..42 -ESI 100% = 14300 m/z 127..85 +ESI Standard Pre-Fortified Post-Fortified Control Blank Retention Time, min 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00 2.50 3.00 3.50 4.00 4.50 5.00 5.50 6.00 6.50 7.00 7.50 8.00 8.50 9.00 9.50 10.00 % 0 100 7.51 8.44 4.56 Cyanuric Acid Melamine 100% = 976 m/z 128..42 -ESI 100% = 14300 m/z 127..85 +ESI Standard Pre-Fortified Post-Fortified Control Blank Expansion to Infant Formula • Discovery of melamine adulterated infant formula in China • Collaborated with ORA to validate method for powdered formula CVM Subcommittee Report (8-17-09) Appendix 3.6-D 6 Milk Test Kit Program • Concerns about drug residues in milk • Need for milk testing program • Quality of screening tests unknown “We test one kit and if it works we test another just to be sure” -Test kit manufacturer circa 1994 Milk Test Kit Program • The Pasteurized Milk Ordinance requires every tanker to be tested for beta-lactam drugs • Office of Research coordinates third party validation of rapid screening tests – Protocol used for validation developed by CVM CVM Subcommittee Report (8-17-09) Appendix 3.6-D 7 Amoxicllin Concentration-Response 0 20 40 60 80 100 120 0 2 4 6 8 10 12 ppb Amoxicillin Percent Positive Response Tolerence = 10 ppb 90/95 = 7.5 Current Research • Multiresidue methods • Antiviral method • Feeds • Tissue fluid correlations • Replacement of obsolete methods • Mark residue identification • Analytical support CVM Subcommittee Report (8-17-09) Appendix 3.6-D 8 Multiresidue Methods • Based on LC-MS/MS • Screen/confirm for wide variety of compounds • Use generic extraction techniques Reds—betalactams & cephalosporins Purples—tetracyclines Greens—sulfonamides and potentiators Oranges—macrolides & mectins Brown—malachite green & leuco MG Greys—imidazoles & colistin Black—florfenicol amine Blues—quinolones & fluoroquinolones Yellow—lincomycin Chromatographing 36 drugs from more than 9 different chemical classes 2 3 4 5 6 7 8 8 9 10 11 12 13 14 15 15 16 17 18 Time (min) Reds—betalactams & cephalosporins Purples—tetracyclines Greens—sulfonamides and potentiators Oranges—macrolides & mectins Brown—malachite green & leuco MG Greys—imidazoles & colistin Black—florfenicol amine Blues—quinolones & fluoroquinolones Yellow—lincomycin Chromatographing 36 drugs from more than 9 different chemical classes 2 3 4 5 6 7 8 8 9 10 11 12 13 14 15 15 16 17 18 Time (min) Multiresidue Methods • Eggs • Shrimp • Finfish • Meat • Honey silica SPE hydrophilic polymer SPE (Oasis) egg blend at pH 3.5, aqueous blend in ACN hexane ionophores macrolides sulfonamides beta-lactams Phenyl LC column, gradient, aqueous formic acid + ACN Other non-polar residues tetracyclines fluoroquinolones ESILCMS/ MS SPE Extraction of > 6 Drug Classes from Egg silica SPE hydrophilic polymer SPE (Oasis) egg blend at pH 3.5, aqueous blend in ACN hexane ionophores macrolides sulfonamides beta-lactams Phenyl LC column, gradient, aqueous formic acid + ACN Other non-polar residues tetracyclines fluoroquinolones ESILCMS/ MS silica SPE hydrophilic polymer SPE (Oasis) egg blend at pH 3.5, aqueous blend in ACN hexane ionophores macrolides sulfonamides beta-lactams Phenyl LC column, gradient, aqueous formic acid + ACN Other non-polar residues tetracyclines fluoroquinolones ESILCMS/ MS SPE Extraction of > 6 Drug Classes from Egg CVM Subcommittee Report (8-17-09) Appendix 3.6-D 9 Honey • Few drugs approved for apiculture • Contamination from pesticides • Many producers • Imports Developed method for 17 drugs in honey • Collaborated with USDA Bee Laboratory • Honey matrix highly variable • Method currently being transferred Extraction Procedure 2 g Honey Sample Add 10 mL water Vortex and centrifuge Analysis of Streptomycin LC-MS/MS positive ESI SPE Cleanup Strata X Solvent Evaporation Reconstitution with water Centrifugation Filtration 100 µL aliquot Analysis of 15 drugs LC-MS/MS positive ESI Analysis of Chloramphenicol LC-MS/MS negative ESI CVM Subcommittee Report (8-17-09) Appendix 3.6-D 10 Antiviral Drugs in Poultry • Use prohibited in turkey, chicken, duck • Agency needed monitoring method • Developed method for four antivirals in chicken and eggs XIC of +MRM (12 pairs): 152.2/93.1 amu from Sample 1 (Std A) of standards- 20mM ACNgrad#14.wiff (Turbo Spray) Max. 1.1e5 cps. 1 2 3 4 5 6 7 8 9 10 11 92 183 274 365 455 546 637 728 819 910 1001 Time, min 0.0 5.0e4 1.0e5 1.5e5 2.0e5 2.5e5 3.0e5 3.5e5 4.0e5 4.5e5 5.0e5 5.5e5 6.0e5 6.5e5 7.0e5 7.5e5 7.7e5 Intensity, cps 5.22 1.23 % ACN oseltamivir rimantadine amantadine oseltamivir carboxylate zanamivir 50% 80% 100% XIC of +MRM (12 pairs): 152.2/93.1 amu from Sample 1 (Std A) of standards- 20mM ACNgrad#14.wiff (Turbo Spray) Max. 1.1e5 cps. 1 2 3 4 5 6 7 8 9 10 11 92 183 274 365 455 546 637 728 819 910 1001 Time, min 0.0 5.0e4 1.0e5 1.5e5 2.0e5 2.5e5 3.0e5 3.5e5 4.0e5 4.5e5 5.0e5 5.5e5 6.0e5 6.5e5 7.0e5 7.5e5 7.7e5 Intensity, cps 5.22 1.23 % ACN oseltamivir rimantadine amantadine oseltamivir carboxylate zanamivir 50% 80% 100% Collaborating with Food and Environment Research Agency CSL (UK) • Shared information during method development • Exchanged incurred tissues • Facilitated method validation for turkey and duck CVM Subcommittee Report (8-17-09) Appendix 3.6-D 11 Feed Methods • Concerned about a variety of potential contaminants – Antibiotics – Pesticides – Economic adulterants –Mycotoxins • Commodity prices influence composition • Distillers Grains Tissue Fluid Correlation Studies • Sulfadimethoxine • Isobaric One-port Laparoscopy – Kidney and liver biopsy samples • Developed LCMS/ MS method for analysis CVM Subcommittee Report (8-17-09) Appendix 3.6-D 12 Depletion Plot for Sulfadimethoxine in Bovine Tissues and Fluids 10 100 1000 10000 100000 20 40 60 80 100 120 Time after last dosage (h) log concentration (ng/g or ng/mL) Urine Plasma Kidney Liver Oral fluid Replacement of Obsolete Methods • Old official methods – Outdated Scientifically – Labor intensive – Safety • Scientist • Environment – Equipment 1968 Food and Drug Administration, Washington, DC CVM Subcommittee Report (8-17-09) Appendix 3.6-D 13 Tolerance based on official method • Need to correlate results • Bridge new method to official method • Office of Research uniquely qualified to conduct research – Chemists – Animal scientists –Microbiologists Penicillin G in Bovine Tissue • Developed new LCMS/ MS based method – Designed to be multiresidue – Currently being bridged to official assay • Collaborating with FSIS Recovery of Penicillin from Bovine Kidney 0 50 100 150 200 250 300 350 400 450 0 100 200 300 400 ppb Fortified ppb Measured CVM Subcommittee Report (8-17-09) Appendix 3.6-D 14 Marker Residue Identification • Metabolism of drugs unknown in many species • Need to monitor correct marker to detect usage • Currently studying ivermectin metabolism in multiple species of fish Ivermectin in Finfish • 3H-Ivermectin studies indicate parent drug is marker in three species • Unknown metabolite seen in rainbow trout tentatively identified as 3’-Odemethyl- ivermectinB1a • Verifying metabolite identification CVM Subcommittee Report (8-17-09) Appendix 3.6-D 15 Analytical Support for OR Studies • Provide support for studies in other divisions – Loperamide assay for collie safety study –Melamine in fish kidney – Feed assays Internal and External Collaborations CVM Subcommittee Report (8-17-09) Appendix 3.6-D 16 Training • Hosted and trained scientists from China and Thailand • Participate in summer intern program • Participate in ORA training programs ORA • ADRC –Melamine –Methods for aquaculture –Milk methods • Method transfer to ORA field labs – Longstanding program to validate methods – Nitrofurans in shrimp CVM Subcommittee Report (8-17-09) Appendix 3.6-D 17 CFSAN • Collaborate with Laboratory Proficiency and Evaluation Team on test kit validation • Participate in FDA Milk Steering Committee • Partner with Gulf Coast Seafood Laboratory • Conduct expert reviews for tissue residue cases Standing Working Groups • Interagency Residue Control Group – Focus on tissue residue issues • Aquaculture Research Group – FDA group chaired by OR – Develop priorities and make assignments for method development in aquaculture CVM Subcommittee Report (8-17-09) Appendix 3.6-D 18 External Collaborations • AOAC International • Codex Committee on Residues of Veterinary Drugs in Foods • Food and Environment Research Agency CSL • American Society for Mass Spectrometry • National Conference on Interstate Milk Shipments • State Laboratories Challenges • Data handling • Small molecule group • Rapid tests for field use • Appropriate technologies CVM Subcommittee Report (8-17-09) Appendix 3.6-D 19 Questions? CVM Subcommittee Report (8-17-09) Appendix 3.6-E 1 1 The Division of Animal and Food Microbiology Patrick McDermott, MS, PhD Director, Division of Animal & Food Microbiology Director, The National Antimicrobial Resistance Monitoring System U.S. Food and Drug Administration Center for Veterinary Medicine Office of Research Laurel, MD patrick.mcdermott@fda.hhs.gov 2 Mission of the Division Est. 1998 Conduct research on microorganisms from food, feed, animals and the environment to provide valid sciencebased information to assess the public health impact of antimicrobial use in animals. We measure the effects of antimicrobial use in animals on efficacy against pathogens, changes in the environmental microbial ecology, and the development and spread of antimicrobial resistance in pathogenic and commensal bacteria. We monitor antimicrobial resistance trends in foodborne bacteria as part of the National Antimicrobial Resistance Monitoring System (NARMS). CVM Subcommittee Report (8-17-09) Appendix 3.6-E 2 3 Staffing • 3 Principal Investigators – Feeds – PulseNet/NARMS – Molecular/NARMS • 2 Principal Investigator vacancies – Veterinary Bacteriologist – Environmental Microbiologist • 1 Veterinary Medical Officer/Epidemiologist (Program Coordinator for NARMS) • 14 Microbiologists – 4 Masters level – 9 Bachelors level – 1 Associate level • 1 Postdoctoral Microbiologist • 1 Epidemiologist (MPH) – 2 Epidemiology Fellows (MPH) • 2 Commissioner’s Fellow (PhD) – 1 Epidemiologist – 1 Microbiologist 4 Clinton Food Safety Initiative • Budget request announced in 1997 • Reduce the risk of illness to the greatest extent possible • Established early warning systems – PulseNet, FoodNet • Expanded research, training, education • Focus on those areas where hazards present the greatest risk – Intramural: DAFM was created – Extramural: RFP for CRADAS – NARMS was expanded CVM Subcommittee Report (8-17-09) Appendix 3.6-E 3 5 External Funding Via FSI 1. On farm risk factors for zoonotic enteropathogens associated with cattle feed and water D. Hancock, Washington State University 2. Waterborne dissemination of E. coli O157 C. Kaspar, University of Wisconsin 3. Factors affecting numbers of acid-resistant E. coli in cattle J. Russell, USDA 4. Control of EHEC in cattle by probiotic bacteria M. Doyle, University of Georgia 5. Survey of antimicrobial resistant enterococci in animals M. Zervos, William Beaumont Hospital 6. STEC, Salmonella virulence and antibiotic resistance in cattle and feed D. Acheson, Tufts University 7. Evaluation and use of BAM/FDA and rapid methods for on farm survey A. Draughton, University of Tennessee 8. Livestock feeds as a means of dissemination of antimicrobial resistant organisms Dale Hancock, Washington State University 9. The spread of drug-resistance among Campylobacter Margie Lee, University of Georgia 10. Antimicrobial use and resistance in enteric bacteria Paul Morley, Colorado State University 11. Antimicrobial resistance of Salmonella isolated from swine Craig Altier, North Carolina State University 6 A Public Health Action Plan to Combat Resistance • Interagency Task Force created in 1999 • A blueprint for specific coordinated federal action to address the emerging threat of antimicrobial resistance • Input from many partners: state and local health agencies, universities, professional societies, pharmaceutical companies, health care delivery organizations, agricultural producers, consumer groups, & etc. • Implemented over time, building on existing public health infrastructure • Dr. David White serves as FDA co-chair CVM Subcommittee Report (8-17-09) Appendix 3.6-E 4 7 PHAP - Four Principal Components 1. Surveillance • Implement coordinated national surveillance. Disseminate data in a timely manner to those who may make decisions based on the data • Monitor patterns of antimicrobial use in human medicine, agriculture, veterinary medicine, and consumer products • Standardize and harmonize methodologies • Ensure the availability of reliable and comparable drug susceptibility data 2. Research • Augment existing research infrastructure to support research in resistance and related fields • Increase understanding of microbial physiology, ecology, genetics, and mechanisms of resistance – effect of growth promoting antibiotics in agriculture – effect of different dosing regimens 3. Prevention and Control 4. Product Development 8 CVM Strategy to Combat Antibiotic Resistance in Foodborne Pathogens Aimed at assessing relationships between antimicrobial use in animal agriculture and potential human health consequences • Enhanced surveillance activities (NARMS) • Expanded research activities (Overview of DAFM) – Funding cooperative agreements to study the microbiological hazards associated with food-animal production, including feeds (1999-2003) • Risk assessments to better quantify uncertainties for development of scientifically sound priorities and policy • Revised safety assessment process (GFI #152) • International collaboration (WHO, Denmark, Mexico) • Education/outreach activities (e.g., prudent use guidelines) CVM Subcommittee Report (8-17-09) Appendix 3.6-E 5 9 NARMS Goals 1. Monitor trends in antimicrobial resistance among foodborne bacteria from humans, retail meats, and animals • Use a unified approach • Allow comparisons with other countries that have similar surveillance systems 2. Disseminate timely information on antimicrobial resistance to promote interventions that reduce resistance among foodborne bacteria 3. Conduct research to better understand the emergence, persistence, and spread of antimicrobial resistance 4. Assist the FDA in making decisions related to the approval of safe and effective antimicrobial drugs for animals 10 The National Antimicrobial Resistance Monitoring System Partnership w/ FSIS & NAHMS Public Health Labs Partnership w/ FoodNet & P.D.H. CVM Subcommittee Report (8-17-09) Appendix 3.6-E 6 11 Bacteria Tested Human (1/20th) • Non-typhoidal Salmonella • Campylobacter • E. coli • Including 0157:H7 • Enterococcus • S. Typhi • Shigella • Listeria • Vibrio Animal • Non-typhoidal Salmonella • E. coli • 0157:H7 when available • Enterococcus • Campylobacter Retail Meats (GB, PC. CB, GT) • Non-typhoidal Salmonella • E. coli • Enterococcus • Campylobacter 12 Added Value from NARMS Isolates • Partnership with the CDC PulseNet – All Salmonella and all CipR and EryR Campylobacter are assayed by PFGE using two enzymes. – All patterns are submitted to PulseNet to aid in outbreak detection and response • USDA VetNet – housed at USDA and linked to CDC PulseNet • NARMS isolates are used for research projects – Attribution – Genome structure – Antimicrobial resistance – Virulence – Typing method development • NARMS date are used for antimicrobial drug approvals CVM Subcommittee Report (8-17-09) Appendix 3.6-E 7 13 PFGE Profiles of MDR S. Newport 14 FDA/CVM Regulatory Approach Microbial Food Safety Risk Assessment Evaluating the Safety of Antimicrobial New Animal Drugs with Regard to Their Microbiological Effects on Bacteria of Human Health Concern GFI #152 http://www.fda.gov/cvm/Documents/fguide152.pdf CVM Subcommittee Report (8-17-09) Appendix 3.6-E 8 15 Hazard Characterization Qualitative Risk Assessment Release Assessment Exposure Assessment Consequence Assessment probability that resistant bacteria are present in target animal as a consequence of drug use (rank as High, Medium, or Low) Risk Estimation Overall Risk Estimate: Integration of release, exposure and consequence assessments. (rank as High, Medium, or Low) probability for humans to ingest bacteria in question from the relevant food commodity (rank as High, Medium, or Low) probability that human exposure to resistant bacteria results in an adverse health consequence (rank as High, Medium, or Low) GFI #152 NARMS/ Research NARMS 16 Science Board Review of NARMS • Meeting April 10-11, 2007 • Board: – Larry Granger – Susan Harlander – Lonnie King – Scott McEwen – J. Glenn Morris – Jim Riviere – John Thomas CVM Subcommittee Report (8-17-09) Appendix 3.6-E 9 17 Focus Areas and Key Findings 1. Sampling strategies – Use national, random sampling when possible .. When not feasible, further stratify data or use a more targeted sampling strategy – Encourage monitoring of commensals from healthy humans 2. Research studies – Encouraged further development and expansion – Emphasis on hypothesis-driven and collaborative research 3. International activities – Strongly endorsed continuation and expansion of international activities, including training 4. Data harmonization and reporting – Need for an integrated database and timely reporting 18 NARMS Laboratory Methods Meeting Athens, GA, Sept 2008 • Lab methods – Handling and testing – Serotyping and species identification – QC organisms and testing – Criteria for repeat testing • Sampling methods for each component • Research tools & collaborations • Data management and reporting – Goals, Content, Timeliness – Challenges • Strategic planning Next planning meeting is Aug 5-7 Established WGs for: • Epidemiology/Reporting • Molecular biology • Microbiology (laboratory SOPs) CVM Subcommittee Report (8-17-09) Appendix 3.6-E 10 19 Response to Science Board on Sampling Strategies • USDA - Investigating options to overcome limitations of HAACP sampling • Use of ongoing FSIS baseline studies for comparison • Discussions with FSIS to provide NARMS-specific samples • Stratify by sample source to reduce or eliminate HAACP bias • CDC – A NARMS expansion could include monitoring of commensals from healthy humans • FDA – Increasing NARMS retail meat testing to 10-20 more states would improve sampling 20 Science Board Comments on Research Studies • An active applied research program is critically important to the continued success of NARMS • Encourage further expansion the research portfolio to include: lab methods; platform development; and more pilot projects • Expand hypothesis-driven research with a special emphasis on assessing human risks • Encourage more collaborations and partnerships • Key research focus for NARMS is to gain understanding of the flow of resistance genes and/or bacteria across the farm-to-fork continuum CVM Subcommittee Report (8-17-09) Appendix 3.6-E 11 21 DAFM Research Programs 1. Standardize and validate in vitro antimicrobial susceptibility testing methods 2. Measure the effects of veterinary antimicrobials on emergence of resistance in zoonotic foodborne bacteria 3. Determine the genetic diversity within bacterial populations • Genetic relationships between isolates from different sources • Plasmid epidemiology/biology 4. Characterize molecular mechanisms of resistance • Develop rapid methods to identify/characterize resistant bacteria 5. Examine the role of animal feeds (rendered products, dried commodities, complete feeds) in the ecology of resistance 22 DAFM Research Programs 1. Standardize and validate in vitro antimicrobial susceptibility testing methods 2. Measure the effects of veterinary antimicrobials on emergence of resistance in zoonotic foodborne bacteria 3. Determine the genetic diversity within bacterial populations • Genetic relationships between isolates from different sources • Plasmid epidemiology/biology 4. Characterize molecular mechanisms of resistance • Develop rapid methods to identify/characterize resistant bacteria 5. Examine the role of animal feeds (rendered products, dried commodities, complete feeds) in the ecology of resistance CVM Subcommittee Report (8-17-09) Appendix 3.6-E 12 23 The Need for an Antimicrobial Susceptibility Testing Method for Campylobacter • Campylobacter is one of the most common causes of foodborne gastroenteritis worldwide. • Because of the special grow characteristics of Campylobacter (thermophillic, capnophillic) existing testing methods and quality control strains were not applicable. • Poultry is a major source of human infection • Between 40%-80% of chickens purchased in US grocery stores are contaminated with Campylobacter • Data suggested an increasing trend in resistance to FQs, temporally associated with approval and use of FQ in poultry. • CVM/OR led a multi-laboratory study to develop a valid in vitro AST method to better assess the potential hazard, and for monitoring purposes. 24 Developing Quality Control Limits CLSI M23 Document – Development of In Vitro Susceptibility Testing Criteria and Quality Control Parameters; Approved Guideline-Third Editions • Purpose is to: – Evaluate reproducibility of a broth microdilution method • Within and between laboratories • Between (3) reagent lots • Ten participating laboratories from different institutions – Each tests 10 replicates (individual suspensions) of the QC strain on 3 lots of medium – Testing should be done over at least 3 days • First standardized an agar dilution method (5 compounds) then a broth microdilution method (14 compounds) CVM Subcommittee Report (8-17-09) Appendix 3.6-E 13 25 Nalidixic Acid vs. C. jejuni ATCC 33560 at 36°C/48 hrs. 14 235 51 0 50 100 150 200 250 0.12 0.25 0.5 1 2 4 8 16 32 64 128 256 MIC (µg/ml) Number 10 labs Conc. Lab 1 Lab 2 Lab 3 Lab 4 Lab 5 Lab 6 Lab 7 Lab 8 Lab 9 Lab 10 Total 0.12 0.25 0.5 12 4 14 14 8 2 25 30 30 26 29 16 24 25 28 235 16 28 5 4 1 6 5 2 51 32 64 128 256 N 30 30 30 30 30 30 30 30 30 30 300 GeoMean 15.47 9.33 8.00 8.00 9.07 8.27 6.13 9.60 7.37 8.53 9.17 mode 16 8 8 8 8 8 8 8 8 8 8 min 8 8 8 8 8 8 4 8 8 8 4 max 16 16 8 8 16 16 8 16 16 16 16 range 2 2 1 1 2 2 2 2 2 2 3 Campylobacter jejuni ATCC 33560 Nalidixic Acid at 36° C / 48 hours Ten Labs 100% Ideally, • >95% of the values should be included in the proposed range • Proposed range is the mode + 1 log2 dilution (3-dilution range) 26 Retrospective Evaluation of Data/Methods CVM Subcommittee Report (8-17-09) Appendix 3.6-E 14 27 Setting Tentative Interpretive Criteria S I R 28 CLSI M45 Acceptable Limits for Quality Control Strains Used to Monitor Accuracy of Minimal Inhibitory Concentrations (MICs) (µg/ml) of Fastidious Organisms Antimicrobial 36oC / 48 hr. 42oC / 24 hr. S I R Azithromycin 0.03-0.25 0.03-0.12 < 2 4 >8 Ciprofloxacin 0.06-0.25 0.03-0.12 < 1 2 =4 Clindamycin 0.12-1 0.12-0.5 =2 4 =8 Doxycycline 0.12-0.5 0.12-0.5 =2 4 =8 Erythromycin 0.5 - 2 0.25 - 2 =8 16 =32 Florfenicol 1-4 0.5-2 =4 Gentamicin 0.5-2 0.25-2 =2 4 >8 Levofloxacin 0.06-0.25 0.03-0.25 Meropenem 0.008-0.03 0.008-0.03 Nalidixic acid 4-16 4-16 =16 32 =64 Telithromycin 1-4 0.5-2 =4 8 =16 Tetracycline 0.25-2 0.25-1 =4 8 =16 QC Ranges Interprtive Criteria CVM Subcommittee Report (8-17-09) Appendix 3.6-E 15 29 DAFM Research Programs 1. Standardize and validate in vitro antimicrobial susceptibility testing methods 2. Measure the effects of veterinary antimicrobials on emergence of resistance in zoonotic foodborne bacteria 3. Determine the genetic diversity within bacterial populations • Genetic relationships between isolates from different sources • Plasmid epidemiology/biology 4. Characterize molecular mechanisms of resistance • Develop rapid methods to identify/characterize resistant bacteria 5. Examine the role of animal feeds (rendered products, dried commodities, complete feeds) in the ecology of resistance 30 Weeks of age 2 4 8 Infect with Campylobacter Treat with Antibiotic Measure Cha Day-old Chicks nges in Campylobacter Resistance Weeks of age 2 4 8 Day-old Chicks Infect with Campylobacter Treat with Antibiotic Measure Changes in Campylobacter Resistance • Following infection with susceptible Campylobacter, birds were medicated with either sarafloxacin or enrofloxacin per label instructions • Fecal samples were collected just prior to treatment, and periodically until the birds reached market age (~50 days of age) Experimental Approach CVM Subcommittee Report (8-17-09) Appendix 3.6-E 16 31 Changes in Fluoroquinolone MICs following Sarafloxacin Treatment 0 20 40 60 80 100 120 0 5 7 9 12 19 26 Days after initiation of treatment Percent isolates with MICs >32 mg/mL Ciprofloxacin Sarafloxacin Non-treated control Changes in Fluoroquinolone MICs following Sarafloxacin Treatment 32 0 20 40 60 80 100 120 0.125 0.25 0.5 1 2 4 8 16 32 Ciprofloxacin MIC (ug/mL) Percent Isolates Ciprofloxacin Sarafloxacin Distribution of MICs CVM Subcommittee Report (8-17-09) Appendix 3.6-E 17 33 Changes in Fluoroquinolone MICs following Enrofloxacin Treatment 0 4 8 12 16 20 24 28 32 36 0 1 3 5 12 21 Days after initiation of treatment MIC (mg/mL) Ciprofloxacin Enrofloxacin Non-treated control Changes in Fluoroquinolone MICs following Enrofloxacin Treatment 34 78 81/82 Thr86 MIC CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATACAGCAGTTTATG WT CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATATAGCAGTTTATG 32 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATATAGCAGTTTATG 32 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATATAGCAGTTTATG 32 CCGTATAGTGGGTGCCTGTTATAGGTCGTTATCATCCACATGGAGATATAGCAGTTTATG 32 CCGTATAGTGGGTGCCTGTTATAGGTCGTTATCATCCACATGGAGATATAGCAGTTTATG 32 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATACAGCAGTTTATG 0.25 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATATAGCAGTTTATG 32 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATATAGCAGTTTATG 16 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATACAGCAGTTTATG 0.25 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATATAGCAGTTTATG 32 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATACAGCAGTTTATG 0.25 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATACAGCAGTTTATG 0.25 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATACAGCAGTTTATG 0.5 CCGTATAGTGGGTGCNTGTTATAGGTCGTTATCATCCACATGGAGATACAGCAGTTTATG 0.125 Mutations in gyrA • All resistant isolates had a single amino acid substitution in the gyrase A gene (gyrA). • Mutation resulted in a change of isoleucine to threonine at position 83. • This mutation is common in Gram-negative enteric bacteria, usually in tandem with other changes. CVM Subcommittee Report (8-17-09) Appendix 3.6-E 18 35 Summary • Rapid evolution of resistance and the bimodal distribution likely reflects that only a single mutation is needed (gyrA) for high-level MICs. • Implications to food safety: 45-80% of retail chicken carcasses are contaminated with Campylobacter. Contamination of poultry carcasses during processing would result in the presence of fluoroquinolone-resistant Campylobacter on meats derived from treated birds. • The continued use of these drugs in poultry has the potential to further limiting therapeutic options available for treating human campylobacteriosis infections. 36 CVM Subcommittee Report (8-17-09) Appendix 3.6-E 19 37 Emergence and Persistence of Q/D Resistance in Broiler E. faecium Appl Environ Microbiol. 2005 Sep;71(9):4986-91 38 The in vivo studies, along with environmental and genetic studies (see publications) were incorporated in the CVM risk assessment document. CVM Subcommittee Report (8-17-09) Appendix 3.6-E 20 39 DAFM Research Programs 1. Standardize and validate in vitro antimicrobial susceptibility testing methods 2. Measure the effects of veterinary antimicrobials on emergence of resistance in zoonotic foodborne bacteria 3. Determine the genetic diversity within bacterial populations • Genetic relationships between isolates from different sources • Plasmid epidemiology/biology 4. Characterize molecular mechanisms of resistance • Develop rapid methods to identify/characterize resistant bacteria 5. Examine the role of animal feeds (rendered products, dried commodities, complete feeds) in the ecology of resistance 40 Foodborne Enterococcus • PenR E. faecium • To date, 162 PenR E. faecium from retail meats analyzed by MLST for the standard 7 genetic loci and compared with the database. • MLST database has 335/450 known enterococcal STs – 111 have no corresponding ST in the database – 9 STs common to human isolates in the MLST database • Enterococcus • E. faecium and E. faecalis from meats, healthy humans and clinical infections were also tested for genetic relatedness by MLST • E. faecium (n=116) separated into human or food specific groups • E. faecalis (n=182) were found in 26 groups, 8 of which contained isolates from both humans and retail food sources .. E. faecalis has a greater probability of moving from food animals to humans and potentially resulting in invasive infections. CVM Subcommittee Report (8-17-09) Appendix 3.6-E 21 4411 Salmonella Genome Project Institute for Genome Sciences (IGS) University of Maryland School of Medicine, Baltimore, MD S. Agona DBS_WI_03BC1092 S. Dublin CT_02021853 S. Hadar RI_05P066 S. I 4,[5],12:i:- CVM23701 S. Javiana GA_MM04042433 S. Weltevreden HI_N05-537 S. Virchow FCF_353617-2 S. Kentucky CVM29188 S. Kentucky CDC191 S. Newport SL254 S. Newport SL317 S. Saint Paul SARA23 S. Saint Paul SARA29 S. Schwarzengrund CVM19633 S. Schwarzengrund DBS_GA_F25499 S. Heidelberg AZ_ID05-1610005 S. Heidelberg CVM30485 42 Salmonella MDR-AmpC Plasmid pSN254 Welch TJ, et al Multiple Antimicrobial Resistance in Plague: An Emerging Public Health Risk. PLoS ONE (2007) 2(3):e309. Sulfonamide resistance is encoded within backbone All other resistance genes are encoded in insertions to the backbone (red ORFS) Insertion sites are conserved among the three plasmids CVM Subcommittee Report (8-17-09) Appendix 3.6-E 22 43 sugE and blaCMY High-level expression of sugE leads to resistance to a subset of toxic quaternary ammonium compounds, including cetylpyridinium chloride Small multidrug resistance (SMR) family Approved in 2004 to treat the surface of raw poultry carcasses prior to immersion in a chiller SugE Son, M.S. et al. 2003. Biochem Biophys Res Commun. 312:914-921. 4444 How prevalent is the IncA/C backbone in MDR Salmonella? • Screened 125 MDR Salmonella strains recovered from retail meats (2002 – 2005) plus some E. coli and Klebsiella MDR isolates • Screened plasmid DNA preps by PCR for the repA marker indicative of the IncA/C replicon • Positive samples were probed with an additional 12 primer sets for other backbone regions CVM Subcommittee Report (8-17-09) Appendix 3.6-E 23 45 MDR AmpC Plasmids in NARMS Isolates Organism State Year Source n Transfer A C S Su T Ti G K Ag Ax N Ak Cp Sxt S . Typhimurium CT 2003 Chicken 27 A - - Su T Ti - - Ag - - - - - 8.4 x 10-6 S . Newport CT 2002 Beef A - S Su T Ti - - Ag - - - - - - S . Newport MD 2002 Turkey 8 A C S Su T Ti - - Ag - - - - Sxt - S . Newport MD 2002 Pork A C S Su T Ti - - Ag - - - - Sxt - S . Kentucky CT 2004 Chicken 2 A C S Su T Ti - - Ag - - - - - 8.3 x 10-5 S . I.4,5,12:NM CT 2005 Chicken A - - Su T Ti - - Ag - - - - - - S . I.3,10 :NM MN 2005 Turkey A - S Su T Ti - K Ag - - - - - 5.2 x 10-5 S . I. 4,12 : r :- MD 2005 Turkey A C S Su T Ti - - Ag - - - - Sxt - S . Heidelberg OR 2004 Chicken 6 A C S Su T Ti - - Ag - - - - - 6.3 x 10-2 S . Heidelberg CO 2005 Turkey A - - - - Ti - - Ag - - - - - - S . Dublin MN 2003 Beef 2 A C S Su T Ti - - Ag Ax - - - - - S. Bredeney CT 2004 Turkey 2 A - - Su T Ti G - Ag - - - - - - Klebsiella sp. IA 2002 Turkey 9 A C S Su T Ti G K Ag - N - - - 4.9 x 10-3 E. coli ND 1997 Calf A C S Su T Ti G K Ag Ax N - Cp - 3.6 x 10-4 E. coli GA 2002 Chicken 2 A - S - - Ti G K Ag Ax N Ak - - 4.5 x 10-3 E. coli GA 2003 Turkey A C S Su T Ti G K Ag - N - - - 3.3 x 10-2 E. coli GA 2003 Pork A C S Su T Ti - K Ag - - - - - - E. coli OR 2004 Beef A C S Su T Ti G - Ag - - - - - - Antimicrobial resistance phenotype Welch TJ, et al Multiple Antimicrobial Resistance in Plague: An Emerging Public Health Risk. PLoS ONE (2007) 2(3):e309. 46 IncA/C MDR Plasmids In addition to Yersinia ruckeri and Y. pestis…. • Aeromonas salmonicida from Atlantic salmon in Canada • Several clinical isolates of Vibrio cholerae 0139 from China • Edwardsiella ictaluri from farmed catfish from USA (Mississippi) – Decreased susceptibility to SUL and co-resistant to TET and FFC • Sequencing of banked historical strains show the evolution of this plasmid from a progenitor background CVM Subcommittee Report (8-17-09) Appendix 3.6-E 24 4477 S. Kentucky Plasmids pCVM29188_146 Resistance Colicin 4488 S. Kentucky Plasmids pCVM29188_146 pCVM29188_101 Resistance Colicin Resistance Colicin CVM Subcommittee Report (8-17-09) Appendix 3.6-E 25 4499 R-Plasmids in S. Schwarzengrund 50 Examples of Other Studies • MLST of Campylobacter from foods, animals and humans with CDC • Beta-lactamase resistance determinants in Salmonella and E. coli with CDC • MRSA & VRE in meats with CDC • Whole genome sequencing of veterinary bacterial pathogens with USDA • AMR in historical Salmonella and E. coli (CDC) • Source attribution of Salmonella to human diseases based on DNA fingerprinting profiles (CDC PulseNet and VetNet) CVM Subcommittee Report (8-17-09) Appendix 3.6-E 26 51 Examples of Other Studies • The role of CmeB in multi-FQR in Campylobacter • Molecular serotyping of Salmonella (CDC Luminex platform) • Virulence factors (STEC, ExPEC) in generic E. coli isolates (UMD, UMN) • Salmonella on imported products (ORA Denver) • Genetic relatedness of S. Newport over time • Funds were provided by USDA’s Agricultural Marketing Service to characterize produce pathogens isolated in the Microbiological Data Program 52 DAFM Research Programs 1. Standardize and validate in vitro antimicrobial susceptibility testing methods 2. Measure the effects of veterinary antimicrobials on emergence of resistance in zoonotic foodborne bacteria 3. Determine the genetic diversity within bacterial populations • Genetic relationships between isolates from different sources • Plasmid epidemiology/biology 4. Characterize molecular mechanisms of resistance • Develop rapid methods to identify/characterize resistant bacteria 5. Examine the role of animal feeds (rendered products, dried commodities, complete feeds) in the ecology of resistance CVM Subcommittee Report (8-17-09) Appendix 3.6-E 27 53 Rapid Detection -Microarray • DNA Detection Microarray – Detecting 272 resistance, virulence and pathogen ID genes – Identification of all classes of antimicrobial resistance genes as well as common virulence genes – Triplicate 70-mer oligonucleotide probes designed per gene using AlleleID® 6.0 software Antimicrobial Agents # of Genes b-lactam 72 Aminoglycosides 48 Tetracycline 26 Quinolone and fluoroquinolones 5 Chloramphenicol 10 Macrolide 5 Trimethoprim 6 Sulfonamide 2 Integron 5 Virulence genes 36 Salmonella identification 6 Campylobacter jejuni identification 12 Campylobacter coli identification 3 Campylobacter lari identification 1 Campylobacter upsaliensis identification 1 Norwalk virus identification 1 E.coli identification/toxin 8 Yersinia identification/virulence 1 Human negative control genes 1 54 Critical Path Initiative: Interrogating the Genomic Diversity of Enteric Pathogens Using a Novel 85 Genome Salmonella enterica, Escherichia coli, Shigella and Vibrio cholera Multi-Species Microarray Principal Investigators: Heather Harbottle, CVM Scott Jackson, CFSAN CVM Subcommittee Report (8-17-09) Appendix 3.6-E 28 55 FDA Custom Enteric Pathogen (SEEC) DNA Microarray Complete Bacterial Genome Sequences: 85 E. coli chromosomes: 27 E. coli plasmids: 46 Shigella spp. chromosomes: 10 Shigella spp. plasmids: 16 Salmonella spp. chromosomes: 38 Salmonella spp. plasmids: 58 Vibrio cholerae chromosomes: 10 Vibrio sp. plasmids: 12 Number of Genes: 83352 Number of IG Regions: 13678 Antibiotic Resistance and Virulence Genes: 4636 5566 Detection of Resistance Genes in Salmonella using FDA SEEC Microarray CVM Subcommittee Report (8-17-09) Appendix 3.6-E 29 57 Genotyping Methods • Molecular serotyping using the Bioplex System – Simultaneous multiplex analysis of up to 100 different biomolecules in a single well of a microplate in 30 minutes. – Current studies involve validating molecular serotyping by traditional serotyping for all serotypes • Studies investigating resistance gene and virulence gene profiles of interest 58 DAFM Research Programs 1. Standardize and validate in vitro antimicrobial susceptibility testing methods 2. Measure the effects of veterinary antimicrobials on emergence of resistance in zoonotic foodborne bacteria 3. Determine the genetic diversity within bacterial populations • Genetic relationships between isolates from different sources • Plasmid epidemiology/biology 4. Characterize molecular mechanisms of resistance • Develop rapid methods to identify/characterize resistant bacteria 5. Examine the role of animal feeds (rendered products, dried commodities, complete feeds) in the ecology of resistance CVM Subcommittee Report (8-17-09) Appendix 3.6-E 30 59 Animal Feeds 1. Microbiological survey of animal feeds – Analysis of distillers grains for resistant food safety pathogens. Requested by CVM Division of Animal Feeds – Survey for resistant Salmonella, E. coli and Enterococcus 2. New analytical test for Division of Animal Feeds, CVM – Development of a PCR test for Zymomonas mobilis biomass in distillers grains (requested by DFS) 3. Research on antimicrobial resistance – Suppression of antimicrobial resistance with plant derived efflux pump inhibitors. • Collaboration with CFSAN, ARS/USDA and Iowa State University College of Veterinary Medicine. 4. Knowledge concerning the background presence of Bacillus sp in animal feeds 60 Focus Areas and Key Findings 1. Sampling strategies – Use national, random sampling when possible .. When not feasible, further stratify data or use a more targeted sampling strategy – Encourage monitoring of commensals 2. Research studies – Encouraged further development and expansion – Emphasis on hypothesis-driven and collaborative research 3. International activities – Strongly endorsed continuation and expansion of international activities, including training 4. Data harmonization and reporting – Need for an integrated database and timely reporting CVM Subcommittee Report (8-17-09) Appendix 3.6-E 31 61 Science Board Comments on International Activities • International activities are critical because antibiotic resistance is a global problem • Strongly endorse continuation and expansion of activities • Need to improve coordination of NARMS’ components for international purposes and serve as a global model • Internationally, programs need to adopt new technologies and ensure quality data and reporting • Important to continue and expand international training 62 NARMS International Activities • Support of international food safety programs – Training of visiting scientists (China, Mexico) – PulseNet International - Trainers – WHO Global Salm-Surv – Trainers, CVM annual support of $125K – WHO Advisory Group on Integrated Surveillance of Antimicrobial Resistance – OIP support for 2010 of $500K – ResistVet (Mexico) – Initiated with $1.3 mln CVM grant • Collaborations with other antimicrobial resistance surveillance programs – ResistVet – CIPARS – DANMAP • Codex Task Force on Antimicrobial Resistance – Dave White is the U.S. Delegate. Jean Whichard (CDC –NARMS) and Paula Cray (USDA-NARMS) serve on the delegation CVM Subcommittee Report (8-17-09) Appendix 3.6-E 32 63 Science Board Comments on Data Harmonization and Reporting • Critical need to create a real-time, integrated database for all components of NARMS and to produce more timely reports • Data attributes and use should dictate the IT solution • Suggest data be more accessible and shared with researchers and other end users • Strong need for faster reporting to improve utility of information 64 Annual NARMS Reports CVM Subcommittee Report (8-17-09) Appendix 3.6-E 33 65 NARMS Executive Reports 66 Database Features • Integrated database to merge specified data from the three contributors – Regular, automated data transfer into the database • Data integrity – Password-protection and audit trails • Advanced analysis capabilities – User-friendly queries – On-the-fly data mining capabilities (e.g., as provided by an OLAP cube interface) • Reporting capabilities – Auto-populate data into the Executive Report template – Create NARMS reports with user-defined parameters – 508 compliant (for web-based reports only) • Controlled transfer or export of specified data into other programs • Expandability (provision for continuous improvements, future capacity) – Mechanism for adding more data fields, queries and reports – Mechanism for adding new routes for data import and export Resource dedicated in 2009 from both CVM and CDC Business plan, tactical plan, boundary document, and harmonized data dictionary completed CVM Subcommittee Report (8-17-09) Appendix 3.6-E 34 67 Reporting • Timeliness of data reporting has been improved at FDA and USDA – CDC is addressing internal data review impediments • Online reports have been made more concise • State partners have shortened testing and shipping timeframes • Data templates established for more efficient reporting • Interactive online data visualization tools available 68 CVM Subcommittee Report (8-17-09) Appendix 3.6-E 35 69 70 Challenges & Future Needs • Balancing the expertise in the Division to better serve the needs of the Center for veterinary bacterial pathogens • Continued cooperation/coordination with CFSAN, CDC and USDA • Professional development, training and collaboration on emerging technologies and emerging public health issues • Anticipating feed safety/security events with appropriate method development • Environmental routes of dissemination – NCTR partnership • NARMS and food safety – Can we better support CFSAN and other sister agencies – Testing other food commodities and pathogens – How real time can we be? CVM Subcommittee Report (8-17-09) Appendix 3.6-E 36 71 Thank you CVM Subcommittee Report (8-17-09) Appendix 3.6-F 1 CVM Strategic Recruitment Process: Finding the “Right” People …with the right skills. …in the right places. …at the right times. CVM Strategic Recruitment Process: Phase I Step 1 – Engage Managers in the Process Human Capital Staff Conducts Strategic Meeting • Hiring Manager • Management Officer Discussion items: • Appointment • Position Description • Job Series • Competencies • Hiring Incentives Potential Hurdles • Sourcing Tools and Targeting Strategies (Websites, Networking, Job Fairs) • Marketing Timeline • Timeframes CVM Subcommittee Report (8-17-09) Appendix 3.6-F 2 CVM Strategic Recruitment Process: Phase I Step 2 – Prepare Comprehensive Recruitment Package Human Capital Staff prepares… Comprehensive Package: • Amend / Develop Position Description • Write Job Analysis • Select and weigh Quick Hire questions based on job analysis and required competencies • Write Selective Factor, if applicable • Obtain Hiring Official’s approval • Provide technical guidance to applicants, if requested • Complete additional paperwork if required; Above The Minimum, Annual Leave Enhancement, Recruitment Incentive Justification, etc… • Forward Recruitment Package to RHRC / OPM • Follow-up with RHRC / OPM RHRC / OPM Prepares Draft Vacancy Announcement CVM Strategic Recruitment Process: Phase I Step 3 – Review and Approval of Vacancy Announcement Human Capital Staff prepares… Vacancy Announcement • RHRC / OPM prepares Certificate of Eligible Candidates • Forwards Certificate to Human Capital Staff Step 4 – Quality Control / Guidance Human Capital Staff reviews Certificate of Eligible Candidates and Applications • Coordinates with RHRC / OPM if amendments / corrections are required • Delivers Certificate and Applications to Hiring Manager • Advise if necessary Step 5 – Follow up Human Capital Staff monitors selection process (25 days) Selection Made • Obtain EEO Signature, if required • Forward Certificate to RHRC / OPM Additional Information: Human Capital Staff Conducts Strategic Monthly Meetings with Office Directors to Discuss Upcoming Vacancies and Status of Current Cases CVM Subcommittee Report (8-17-09) Appendix 3.6-F 3 CVM Strategic Recruitment Process: Phase I Keys to Success • Engage Mangers aggressively in the beginning of the process • Lead Managers through the right strategic thinking about the position, targeting, marketing and assessment approaches • Capture recruitment information required in a streamlined way minimizing Manager time while maximizing the value of their input • Set expectations regarding time and resources required • Development of a comprehensive recruitment package • Keep Managers informed throughout the process • Strategic partnership between Managers and Human Capital Staff Continuous Improvement • Measure Success in meeting manager requirements and expectations • Refine the processes to reflect client evaluations and feedback • Set expectations regarding time and resources required