Food
BAM: Detection of Cyclospora and Cryptosporidium
Return to BAM table of contents
October 2004
Bacteriological Analytical Manual
Chapter 19 A.
Detection of Cyclospora and Cryptosporidium from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR) and Microscopic analysis
Table of Contents
- Materials and Equipment
- Reagents
- Optional Reagents, Supplies, and Equipment
- Wash Procedure for Fresh Produce
- Isolation of Cyclospora from Fresh Produce Washes
- Isolation of Cryptosporidium spp. from Fresh Produce Washes
- Isolation of Parasitic Contaminants from Juices, Cider, and Milk
- Isolation of Cyclospora from Juices, Cider, and Milk
- Isolation of Cryptosporidium spp. from Juices, Cider, and Milk
- Isolation of Parasitic Contaminants from Large Volumes of Water
- Slide Preparation and Microscopic Analysis-Cyclospora cayetanensis
- Sample Preparation
- Microscopy
- Slide Preparation and Microscopic Analysis-Cryptosporidium spp.
- PCR Analysis
- DNA Primers
- General Sample Preparations for Primary PCR Amplification
- Conventional Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp.
- OPTIONAL-Real Time Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp. using the Roche LightCycler® System
- Nested PCR Amplification for the Differential Identification of Cryptosporidium spp.
- Agarose Gel Electrophoresis
- Restriction Fragment Length Polymorphism (RFLP) Analysis of Cryptosporidium spp. Nested PCR Amplicons to Determine the Presence and Differentiation of C. hominis and C. parvum
- References
List of Figures
- Figure 1 Assembly of the FTA-Filter Funnel Unit
- Figure 2 Practical Applications of FTA Filter Formats
List of Tables
- Table 1 Parameters for Epifluorescence Microscopy
- Table 2 DNA Primer Sequences for Cyclospora-specific PCR Amplification
- Table 3 DNA Primer Sequences for Cryptosporidium Genus-specific PCR Amplification
- Table 4 General PCR Conditions for Primary PCR Amplification
- Table 5 Controls for PCR Amplifications
- Table 6 PCR Thermal Cycling Parameters for Cyclospora and Eimeria spp. Detection
- Table 7 PCR Thermal Cycling Parameters for Cryptosporidium spp.
- Table 8 Assay Conditions for the Conventional Nested Multiplex PCR Amplification of Cyclospora and Eimeria spp.
- Table 9 Assay Conditions for the Real-time Nested Multiplex PCR Amplification of Cyclospora and Eimeria spp.
- Table 10 LightCycler® Thermal Cycling Parameters for Real-time Multiplex PCR Amplification of Cyclospora and Eimeria spp.
- Table 11 Expected Results for Real-time Multiplex PCR Amplification of Cyclospora and Eimeria spp. by Melting Curve Analysis
- Table 12 Assay Conditions for the Nested Amplification of Cryptosporidium spp.
- Table 13 Evaluation of nested PCR Amplification and RFLP Analysis to Differentiate Cryptosporidium spp.
- Materials and Equipment
- BagPage®+ filter bags (400 ml) and Bag Clips (Interscience, St Nom, France)
- Envirochek™ sampling capsule, 1 µm nominal (Pall Gelman Laboratory)
- Rocker platform
- Rotary shaker
- Rotating wheel
- 150 ml analytical filter units (Nalgene, Cat No. 130-4045)
- 25 mm disposable filter funnels (Whatman Biosciences)
- Dynal L10 tubes Prod. No. 740-03)
- Dynal MPC®-1 (Prod. No 120.01)
- Dynal MPC®-S (Prod. No 120.20)
- Vacuum manifold (Vac-Man® Laboratory Vacuum Manifold 20-sample capacity; Promega)
- FTA Filters, Classic Card of 960circle pre-printed card formats (Whatman Biosciences)
- Photo laminating sheets (Scotch®)
- Conical 250 ml centrifuge tubes
- Sorvall RT7 Plus refrigerated centrifuge or equivalent (to centrifuge 250 ml conical centrifuge tubes)
- Epi-illuminated Fluorescence Microscope-equipped with the following: UV 1A filter block (excitation Filter, EX 365/10; Dichroic mirror, DM 440; Barrier Filter, BA-400; or equivalent. Optics for differential interference contrast (DIC). For Cryptosporidium spp.: appropriate filter for viewing fluorescein isothiocyanate (FITC) conjugated oocysts. (Table 1)
- Glass microscope slides and cover slips
- Blotting paper
- Heating block for incubation at 56°C
- Single punch (6 mm diameter) hole puncher
- Thin-walled 0.65 ml PCR tube (PGC)
- ART pipette tips (Molecular BioProducts)
- PTC-200 DNA Engine (MJ Research) or comparable thermal cycler.
- Horizontal gel electrophoresis apparatus and power supply.
- Polaroid camera or digital imaging system to capture ethidium bromide-stained gels
- Polaroid Type 667 film
- UV Transilluminator
- Reagents
- Water
- Deionized water (for washing produce [dH2O])
- Sterile deionized water (for PCR procedure)
- Envirochek™ elution buffer (0.01M Tris, pH 7.4 ; 0.001 M EDTA; 1% SDS)
- Silicone vacuum grease
- Albumin, bovine (BSA) (Sigma, A-7030)
- Celite (Sigma, C-8656)
- Polyvinyl polypyrrolidone (PVPP) (Sigma, P-6755)
- NET buffer: 0.1 M Tris, pH 8.0, 0.15M NaCl, 0.001M EDTA
- NET-BSA buffer-NET buffer containing 1% (w/v) BSA
- 20% celite in NET-BSA buffer (w/v)
- 10% PVPP (w/v) in dH2O
- Dynabeads anti-Cryptosporidium Kit (Dynal Biotech Inc, USA)
- Hydrofluor Combo Detection Kit for Cryptosporidium and Giardia (Strategic Diagnostics, Inc.)
- 0.1 N HCl
- 0.1 N NaOH
- Immersion oil
- Clear fingernail polish, slide compound, paraffin wax or equivalent
- FTA Purification Buffer (Whatman Biosciences)
- FTA filter wash buffer: 0.01 M Tris, Ph 8.0; 0.1 mM EDTA
- DNA Primers-See Table 1 in PCR Section
- HotStartTaq™ Master Mix Kit (Qiagen)
- 0.5x Tris-acetate-EDTA buffer (0.5x TAE)
- Molecular biology-grade agarose (BioRad)
- Ethidium bromide
- 6x gel loading solution
- 100 bp and 25 bp DNA ladders (Invitrogen)
- Vsp I restriction endonuclease (Promega)
- Dra II restriction endonuclease (Hoffman-La Roche)
- NuSieve® 3:1 agarose (Biowhitaker Molecular Applications)
- Water
- Optional Reagents, Supplies, and Equipment
- LightCycler®-FastStart DNA Master SYBR Green I kit (Roche Diagnostics)
- LightCycler® Capillaries (Roche Diagnostics)
- LightCycler® System (Roche Diagnostics)
- Wash Procedure for Fresh Produce
This procedure can be used to analyze for potential contaminants on fresh leafy produce (lettuce, herbs, etc) and berries (e.g. raspberries) and may be applicable to other fresh produce.- Place produce to be analyzed (10-25 g of fresh leafy produce or 50g of fresh berries) in a BagPage®+ filter bag, add 100 ml dH2O and seal with Bag Clip.
- Place on rocker platform and gently agitate for 30 minutes at room temperature, inverting the bag after 15 minutes.
- Decant supernatant from the BagPage®+ filter bag into clean 50 ml conical centrifuge tubes and centrifuge for 20 minutes at 2,000xg.
- Isolation of Cyclospora from Fresh Produce Washes
- Aspirate supernatants (without disturbing debris pellets) to a volume not to exceed 45 ml when combined.
- Suspend pellets in remaining supernatants and combine.
- Add 2.5 ml 20% (w/v) celite in NET-BSA suspension (ensure that celite is thoroughly suspended prior to its addition to sample washes). Mix samples on a rotating wheel at room temperature for 15 minutes.
- Add 1.0 ml of 10% PVPP suspension (w/v). Mix samples on a rotating wheel at room temperature for 15 minutes.
- Prepare a 150 ml analytical filter unit by removing the membrane filter (0.45 µm or 0.2 µm) but retaining the grade 4 filter backing. Attach to a vacuum source.
- Pre-wet the analytical filter with a small volume (~10ml) of NET buffer.
- Decant celite/PVPP-containing sample wash into a prepared 150 ml analytical filter unit and vacuum filter. Ensure that the liquid passes through the filter septum to remove particulates and the celite particles from the suspension as it is filtered. The adsorbant celite should prevent filter clogging.
- Rinse the container with 10 ml NET to recover as much of the residual celite-containing sample and decant into the filter unit. Then rinse the celite and particulate material trap onto the filter with an additional 10 ml volume of NET.
- Prior to FTA filtration in step 4l, save ~10% of the filtered sample for microscopic examination.
- Prepare filter funnel unit(s) containing FTA filter disk as described in Figure 1 and attach to vacuum manifold.
- Under vacuum, pre-wet the FTA filter assembly.
- Slowly decant filtrate from step 4i into filter funnel unit while under vacuum until entire sample has passed through FTA filter.
- In succession while filter funnel unit is still attached to vacuum manifold, rinse filter twice with 10 ml of FTA purification buffer and twice with 10 ml of FTA filter wash buffer.
- Remove filter funnel unit from vacuum manifold, disassemble unit and dry FTA filter disk on 56°C heating block.
- Isolation of Cryptosporidium spp. from Fresh Produce Washes
- Aspirate supernatants (without disturbing debris pellets) to a volume not to exceed 10 ml when combined.
- Suspend pellets in remaining supernatants and combine. NOTE: pellet volume should not exceed 0.5 ml packed volume as it will interfere with subsequent steps that employ immunomagnetic adsorption of Cryptosporidium oocysts.
- Follow directions accompanying Dynabead anti-Cryptosporidium Kit for immunomagnetic separation (IMS) of Cryptosporidium oocysts from fresh produce washes using recommend tubes and magnetic capturing devices.
- Elute captured Cryptosporidium oocysts in a 0.1 ml volume of 0.1N HCl for 5 minutes a room temperature.
- Neutralize acid eluates with 0.01 ml 1N NaOH. Save ~10% of the sample for microscopic examination.
- Dilute with 10 ml NET buffer.
- Proceed as in Section 4A, steps j-n.
- Isolation of Parasitic Contaminants from Juices, Cider and Milk
This procedure can be used to analyze for contaminants in liquid samples such as orange juice, apple juice, apple cider, milk and milk products.- Isolation of Cyclospora from Juices, Cider and Milk
- Adjust a 25 ml aliquot of liquid sample to pH 8.0.
- Add an equal volume of NET buffer and mix well.
- Proceed as in Section 4A, steps c-n
- Isolation of Cryptosporidium spp. from Juices, Cider and Milk
A 10 ml volume of cider, juice or milk product is directly sampled by IMS using the Dynabead anti-Cryptosporidium Kit along with the recommend tubes and magnetic capturing devices as in Section 4B, steps c-f.
- Isolation of Cyclospora from Juices, Cider and Milk
- Isolation of Parasitic Contaminants from Large Volumes of Water
This procedure is designed to isolate contaminants from a designated water source (stream, river, reservoir, standing water, runoff, etc).- Place a single Envirochek™ sampling capsule in line with the water source to be sampled. Ensure that the flow rate does not exceed the standards established by the manufacturer.
- Collect a water sample from 10 L of flow through.
- Remove contaminants captured by the filter using 125 ml of elution buffer. Filters should be treated with elution buffer, sealed and agitated on a rotating wheel (moderate speed) for at least 5-10 minutes following the manufacturer's recommendations. Decant filter rinse into a 250 ml conical centrifuge tube.
- Repeat step 6c and combine filter rinses.
- Centrifuge the sample at 1,500-2,000 x g for 20 minutes allowing the centrifuge to coast to a stop (do not use the brake)
- Proceed as described in Sections 4A and 4B for the isolation of Cyclospora and Cryptosporidium spp. respectively.
-
Slide Preparation and Microscopic Analysis-Cyclospora cayetanensis
Cyclospora oocysts emit a cobalt blue autofluorescence with the UV-1A emission filter or blue-green with broader emission spectra filters under ultraviolet illumination. Prepare slides in duplicate and examine slides under ultraviolet illumination as described below.
Laboratories should use a microscope reticle capable of measuring organism in the 8-10 µm range to verify oocyst size when organisms are recovered. Compare morphological characteristics of presumptive oocysts to those in a known standard.
-
Slide Preparation
Centrifuge the volume set aside for microscopic analysis (Section 4A, step i), at 1,500 x g for 10-15 min at 4°C. Aspirate supernatant to within 0.5 ml of debris pellet. Uniformly suspend pellet material by gentle, repeated pipetting.
- Apply silicone vacuum grease to edge of cover slip
- Place 10 µl of suspended debris to a clean glass microscope slide and prepare a wet mount using pre-greased cover slip
- Apply silicone vacuum grease to edge of cover slip
- Microscopy
- Examine slide under UV light at 400X magnification. Cyclospora oocysts autofluoresce cobalt blue. Examine slide at multiple planes under UV. Occasionally, debris in slide preparations make it difficult to only view the slide on one plane.
- Switch from epifluorescence microscopy to bright field microscopy or differential interference contrast microscopy. Determine oocyst size of any presumptive oocysts at 1000X magnification. Compare to standards. Confirm internal structures of presumptive Cyclospora oocysts as compared to a standard.
- Seal cover slips to the glass slides of presumptive positives with fingernail polish, slide compound or paraffin wax.
- Document presumed positive samples with photographs taken at multiple planes.
-
-
Slide Preparation and Microscopic Analysis-Cryptosporidium spp.
Microscopic examination of produce washings and other liquid samples for the presence of Cryptosporidium spp. oocysts will be conducted using commercially available immuno-magnetic bead separation (IMS) kits and immunofluorescence labeling kits.
- An aliquot (~10µl) of the IMS-derived sample Section 4B, step e, is FITC-labeled using the Hydrofluor Combo Detection Kit for Cryptosporidium and Giardia (Ensys Inc., Research Triangle Park, NC) per the manufacturer's instructions and examined in conventional DIC and epifluorescence mode.
†Taken from protocol provided with HYDROLFUOR-Combo Detection Kit for Giardia cysts and Cryptosporidium oocysts (Ensys Inc., Research Triangle Park, NC)Table 1: Parameters for Epifluorescence Microscopy†
INCIDENT LIGHT
Light Source-Mercury Vapor
200W, 100W, or 50WExcitation Filter Dichroic Filter Barrier Filter Red Suppression Filter KP500 TK510 K510 or K530 BG38 FITC TK510 K530 BG38 D. Tungsten-Halogen 50 and 100 W KP500 TK510 K510 or K530 BG38 FITC TK510 K530 BG38 - An aliquot (~10µl) of the IMS-derived sample Section 4B, step e, is FITC-labeled using the Hydrofluor Combo Detection Kit for Cryptosporidium and Giardia (Ensys Inc., Research Triangle Park, NC) per the manufacturer's instructions and examined in conventional DIC and epifluorescence mode.
-
The molecular detection of Cyclospora spp. and Cryptosporidium spp. is independently accomplished using nested PCR protocols. The differential identification of Cyclospora cayetanensis from other closely related non-human pathogenic parasites (i.e. Eimeria spp.) employs a nested multiplex PCR assay. This assay can be accomplished using either a conventional thermal cycler with heated lid or a real-time PCR platform using the Roche LightCycler®.
The detection of Cryptosporidium spp. also involves nested PCR amplification. However, differentiation and speciation of Cryptosporidium spp. requires further analysis by a restriction fragment length polymorphism (RFLP) assay. Please note the following: C. parvum genotype I has been renamed C. hominis; C. parvum genotype II (bovine strain) is now referred to as C. parvum
- DNA Primers
†All primer sequences were derived from the published sequences for the 18S rRNA genes of the respective organisms.Table 2: DNA Primer Sequences for Cyclospora-specific PCR Amplification† Primer
DesignationPrimer Specificity Primer Sequence
(5'-3')Amplicon
Size (bp)Designated
ApplicationF1E (forward) Cyclospora and Eimeria spp. TACCCAATGAAAACAGTTT 636 Primary Amplification R2B (reverse) CAGGAGAAGCCAAGGTAGG CC719 (forward) C. cayetanensis GTAGCCTTCCGCGCTTCG 298 Nested Amplification PLDC661 (forward) C. cercopitheci, C. colobi, C. papionis CTGTCGTGGTCATCGTCCGC 361 Nested Amplification ESSP841 (forward) Eimeria spp. GTTCTATTTTGTTGGTTTCTAGGACCA 174 Nested Amplification CRP999 (reverse) Cyclospora and Eimeria spp. CGTCTTCAAACCCCCTACTGTCG Nested Amplification
†All primer sequences were derived from the published sequences for the 18S rRNA genes of the respective organisms.Table 3: DNA Primer Sequences for Cryptosporidium Genus-specific PCR Amplification† Primer
DesignationPrimer Specificity Primer Sequence
(5'-3')Amplicon
Size (bp)Designated
ApplicationExCry1 (forward) Cryptosporidium spp. GCCAGTAGTCATATGCTTGTCTC 844 Primary Amplification ExCry2 (reverse) ACTGTTAAATAGAAATGCCCCC NesCry3 (forward) Cryptosporidium spp. GCGAAAAAACTCGACTTTATGGAAGGG 590-593 Nested Amplification NesCry4 (reverse) GGAGTATTCAAGGCATATGCCTGC
- General Sample Preparations for Primary PCR Amplifications
- Punch marked triplicate areas (6 mm diameter) from dried FTA filter disk using a single punch hole-puncher. Decontamination of the hole-puncher is not necessary as cross contamination between samples from the hole-puncher has been found to be negligible. However, the individual researcher may wish to swab the punch with ethanol between sample disks if it is deemed appropriate.
- Insert filter punches snuggly into bottom of 0.65 ml thin-walled PCR tubes.
- Dispense 50 µl HotStartTaq™ Master Mix into each PCR tube.
- Prepare reagent master mix (see Table 4) with the appropriate forward and reverse DNA primers (see Tables 2 and 3) and dispense into each PCR tube.
- All PCR analyses must include positive and negative controls (see Table 5).
- Mix tubes with gentle tapping.
- Follow the appropriate thermal cycling protocol (Table 6 and 7) for primary PCR amplification.
*100 µl total volumeTable 4: General PCR Conditions for Primary PCR Amplification Component Volume (µl)* Final Concentration FTA Filter Disk (DNA Template) HotStartTaq™ Master Mix 50.0 † Reagent Master Mix MgCl2, 25 mM 2.0 2.0 ‡ Forward Primer, 10 µM 2.0 0.2 µM Reverse Primer, 10 µM 2.0 0.2 µM Sterile deionized water 44.00
†Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200 µM of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
‡Final MgCl2 concentration is that contributed by both the HotStartTaq™ Master Mix and 25 mM MgCl2stock
†Whenever possible, positive control FTA filters should be spotted with at least 103 organismsTable 5: Controls for PCR amplifications Control Type Condition/Organism Negative Control-1 Reagent blank-no filter Negative Control-2 Reagent blank + unspotted, washed filter †Positive Controls: Cyclospora Analysis: C. cayetanensis ‡¶Cyclospora spp. (NHP) *Eimeria spp. Cryptosporidium Analysis: ¶C. hominis (formerly know as C. parvum genotype 1) C. parvum, (formerly know as C. parvum genotype II (Bovine) ¶C. baileyi ¶C. serpentis
‡Non-human primate-derived Cyclospora spp.
¶Not routinely available.
*Most available Eimeria spp. are suitable.
†This is a stringent, 2-step amplification program (simultaneous annealing and extension at 66°C). Likewise, it does not require a final extension step.Table 6: PCR Thermal Cycling Parameters for Cyclospora and Eimeria spp. Step Number of Cycles Temperature and Time Primary PCR Initial Activation 1 95°C; 15 min Amplification 35 Denaturation: 94°C; 30 sec Annealing: 53°C; 30 sec Extension: 72°C; 90 sec Final Extension 1 72°C; 10 min †Nested Multiplex PCR Initial Activation 1 95°C; 15 min Amplification 25 Denaturation: 94°C; 15 sec Annealing: 66°C; 15 sec
Table 7: PCR Thermal Cycling Parameters for Cryptosporidium spp. Step Number of Cycles Temperature and Time Primary PCR Initial Activation 1 95°C; 15 min Amplification 40 Denaturation: 94°C; 45 sec Annealing: 53°C; 75 sec Extension: 72°C; 45 sec Final Extension 1 72°C; 7 min Nested PCR Initial Activation 1 95°C; 15 min Amplification 35 Denaturation: 94°C; 25 sec Annealing: 65°C; 25 sec Extension: 72°C; 25 sec Final Extension 1 72°C; 7 min
- Conventional Nested Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp.
- Dispense 25 µl of HotStartTaq™ Master Mix into each PCR tube.
- Prepare reagent master mix (Table 8) and dispense into all tubes
- Complete reaction samples with the addition of the desired volume (1-3 µl) of primary amplicon solution.
- Be sure to include all positive and negative controls as in the primary amplification reactions.
- Mix tubes with gentle tapping.
- Follow the appropriate thermal cycling protocol listed in Table 6.
*50 µl total volumeTable 8: Assay Conditions for the Conventional Nested Multiplex PCR Amplification of Cyclospora and Eimeria spp. Component Volume (µl)* Final Concentration HotStartTaq™ Master Mix 25.0 † MgCl2, 25 mM 1.0 2.0 mM‡ CC719 (forward primer), 10 µM 1.0 0.2 µM PDCL661 (forward primer), 10 µM 1.0 0.2 µM ESSP841 (forward primer), 10 µM 1.0 0.2 µM CRP999 (reverse primer), 10 µM 1.0 0.2 µM Sterile deionized water 19.00 DNA Template (primary amplicon) 1.0
†Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200 µM of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
‡Final MgCl2 concentration is that contributed by both the HotStartTaq™ Master Mix and 25 mM MgCl2 stock.
- OPTIONAL-Real Time Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp. using the Roche LightCycler® System
- Place the requisite number of glass capillaries in a pre-chilled cooling block (with accompanying centrifuge adapters)
- Prepare a reagent master mix (Table 9) and dispense into individual 0.65 ml PCR tubes
- Complete reaction samples with the addition of the 1 µl of primary amplicon solution.
- Be sure to include all positive and negative controls as in the primary amplification reactions.
- Mix tubes with gentle tapping.
- Dispense reaction mixture into glass capillaries, cap, and centrifuge briefly (5-10 sec at 3000 rpm) in a bench-top microcentrifuge.
- Transfer glass capillaries to LightCycler® carousel.
- Follow the appropriate thermal cycling protocol for (Table 10 ).
- Real time confirmation of pathogen can be made by melting curve analyis (see Table 11)
- For final confirmation, samples can be recovered from each glass capillary.
- Uncap, invervet capillary into a 0.65 ml PCR tube containing 5 µl of gel loading solution, and briefly centrifuge (5-10 sec at 3000 rpm) in a bench-top microcentrifuge.
- Following instruction for agarose gel electrophoresis (Part 9, Section F, steps b-f)
*20 µl total volumeTable 9: Assay Conditions for the Real-time Nested Multiplex PCR Amplification of Cyclospora and Eimeria spp. Component Volume (µl)* Final Concentration LightCycler®-FastStart DNA Master SYBR Green 2.0 - MgCl2, 25 mM 1.6 3.0 mM CC719 (forward primer), 10 µM 1.0 0.5 µM PDCL661 (forward primer), 10 µM 1.0 0.5 µM ESSP841 (forward primer), 10 µM 1.0 0.5 µM CRP999 (reverse primer), 10 µM 1.0 0.5 µM Sterile deionized water 11.40 - DNA Template (primary amplicon) 1.0 -
Table 10: LightCycler® Thermal Cycling Parameters for Real-time Multiplex PCR Amplification of Cyclospora and Eimeria spp. Step Number of Cycles Temperature and Time Comments Hot Start 1 95°C; 10 min Amplification 30 Denaturation: 95°C; 15 sec Annealing: 66°C; 15 sec Single Fluorescence Acquisition Melting Curve Analysis 1 95°C; 15 sec 65°C; 15 sec 98°C; 0.1°C/sec Continuous Fluorescence Acquisition
Table 11: Expected Results for Real-time Multiplex PCR Amplification of Cyclospora and Eimeria spp. by Melting Curve Analysis Primer
DesignationPrimer Specificity Primer Sequence
(5'-3')Amplicon
Size (bp)Amplicon
Tm (°C)CC719 C. cayetanensis GTAGCCTTCCGCGCTTCG 298 85°C PLDC661 C. cercopitheci, C. colobi, C. papionis CTGTCGTGGTCATCGTCCGC 361 91°C ESSP841 Eimeria spp. GTTCTATTTTGTTGGTTTCTAGGACCA 174 81°C
- Nested PCR Amplification for the Differential Identification of Cryptosporidium spp.
- Dispense 25 µl of HotStartTaq™ Master Mix into each PCR tube.
- Prepare reagent master mix (Table 12) and dispense into all tubes
- Complete reaction samples with the addition of the desired volume (1-3 µl) of primary amplicon solution.
- Be sure to include all positive and negative controls as in the primary amplification reactions.
- Mix tubes with gentle tapping.
- Follow the appropriate thermal cycling protocol listed in Table 7.
*50 µl total volumeTable 12: Assay Conditions for Nested Amplification of Cryptosporidium spp. Component Volume (µl)* Final Concentration HotStartTaq™ Master Mix 25.0 † MgCl2, 25 mM 1.0 2.0 ‡ NesCry3 (forward primer), 10 µM 1.0 0.2 µM NesCry4 (reverse primer), 10 µM 1.0 0.2 µM Sterile deionized water 21.0 DNA Template (primary amplicon) 1.0
†Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200 µM of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
‡ Final MgCl2 concentration is that contributed by both the HotStartTaq™ Master Mix and 25 mM MgCl2 stock
- Agarose Gel Electrophoresis
- Mix 10 µl of nested amplification product with 2-3 µl of gel loading solution.
- Load samples into wells of a 1.5% agarose gel prepared with 0.5 x TAE containing 0.2 µg/ml ethidium bromide. Include at least one lane containing 100 bp DNA ladder to approximate the size of any amplicon present.
- Run the gel at 125 volts (constant voltage) for at least 30 min.
- PCR products on the agarose gel can be visualized by using a UV transilluminator. Photograph the gel to have a permanent record of the results using a Polaroid Type 667 film (or a digital system, if you decide to include that in the material & methods).
- The primary amplicon from primer pair F1E/R2B for Cyclospora PCR may not be visible; therefore, only product from the nested reaction should be electrophoresed.
- Predicted sizes of PCR amplicons from Cyclospora spp., Eimeria spp. and Cryptosporidium spp. are listed in Tables 1 and 2
- Restriction Fragment Length Polymorphism (RFLP) Analysis of Cryptosporidium spp. Nested PCR Amplicons to Determine the Presence of C. parvum Oocysts and Distinguish C. hominis from C. parvum
- A 590 bp (genotype I) or a 593 bp product (genotype II) following nested PCR is a presumptive positive for the presence of Cryptosporidium spp.
- The restriction patterns resulting from the digestion of the nested amplicon with restriction endonucleases VspI and DraII will distinguish between C. parvum and C. hominis (VspI digestion) and C. parvum from C. baileyi and C. sepentis (DraII digestion).
- Combine 15 µl of the Cryptosporidium nested PCR amplicon with on unit VspI, 2.0 µl of 10x enzyme buffer, and 0.2 µl BSA solution (include with enzyme). Adjust final volume to 20 µl with sterile dH2O.
- For digestion with DraII, combine 15 µl of the Cryptosporidium nested PCR amplicon with one unit DraII, 2.0 µl of 10x enzyme buffer, and adjust final volume to 20 µl.
- Positive controls for C. parvum and other species of Cryptosporidium must be digested in the same manner and alongside test samples.
- Incubate digestion samples for at least 2 hr at 37°C.
- Analyze samples by gel electrophoresis using a 3% NuSieve gel prepared with 0.5x TAE and 0.2% ethidium bromide.
- Mix 10-15 µl of nested amplification product with 2-3 µl of gel loading solution and load into wells of gel. Include at least one lane containing 25 bp DNA ladder to estimate the size of restriction fragments present.
- Run the gel at 125 volts (constant voltage) for at least 45 min.
- RFLP patterns can be visualized on the agarose gel by using a UV transilluminator. Photograph the gel to have a permanent record of the results using a Polaroid Type 667 film (or a digital system)
- Predicted banding patterns confirmatory for the presence of Cryptosporidium spp. are listed in Table 13.
†Indistinguishable within an agarose gelTable 13: Evaluation of Nested PCR Amplification and RFLP Analysis to Differentiate Cryptosporidium spp. Organism PCR Amplicon RFLP Digestion Products (bp) Primary (bp) Nested (bp) VspI DraII C. hominis (formerly C. parvum, genotype I) 844 593 503 and 90 - C. parvum (formerly C. parvum, genotype II) 840 590 - - C. baileyi 831 579 - 295 and 284† C. serpentis 836 583 - 298 and 284† C. muiris - - - - C. wrairii - - - -
- DNA Primers
- References
- Centers for Disease Control. 1997. Outbreak of cyclosporiasis--Northern Virginia- Washington D.C.-Baltimore, Maryland, Metropolitan area, 1997. Morbid. Mortal. Weekly Rep. 46:689-691.
- Centers for Disease Control. 1998. Update: outbreak of cyclosporiasis--Ontario Canada, May 1998. Morbid. Mortal. Weekly Rep. 47:806-809.
- Eberhard, M.L., A.J. da Silva, B.G Lilley, and N.J. Pieniazek. 1999. Morphological and molecular characterization of new Cyclospora species from Ethiopian monkeys: C. cercopitheci sp.n., C. colobi sp.n., and C. papionis sp.n. Emerg. Infect. Dis. 5:651-658.
- Herwaldt, B.L. 2000. Cyclospora cayetanensis: a review, focusing on the outbreaks of cyclosporiasis in the 1990's. Clin. Inf. Dis. 31:1040-1057.
- Herwaldt, B.L., M.-L. Ackers, and the Cyclospora Working Group. 1997. An outbreak in cyclosporiasis associated with imported raspberries. N. Engl. J. Med. 336:1548-1556.
- Herwaldt, B.L., M.J. Beach and the Cyclospora Working Group.1997. The return of Cyclospora in 1997: another outbreak of cyclosporiasis in North America associated with imported raspberries. Ann. Intern. Med. 130:210-220.
- Ho, A.Y., A.S. Lopez, M.G. Eberhart, R. Levenson, B.S. Finkel, A.J. da Silva, et al. 2002 Outbreak of cyclosporiasis associated with imported raspberries, Philadelphia, Pennsylvania, 2000. Emerg. Inf. Dis. 8:783-788.
- Jinneman, K.C., J.H. Wetherington, W.E. Hill, A.M. Adams, J.M. Johnson, B.J. Tenge, N-L. Dang, R.L. Manger, and M.M. Wekell. 1998. Template preparation for PCR and RFLP of amplification products for the detection and identification of Cyclospora sp. and Eimeria spp. oocysts directly from raspberries. J. Food Prot., 61:1497-1503.
- Jinneman, K.C., J.H. Wetherington, W.E. Hill, C.J. Omiescinski, A.M. Adams, J.M. Johnson, B.J. Tenge, N-L. Dang, R.L. Manger, and M.M. Wekell. 1999. An oligonucleotide-ligation assay for the differentiation between Cyclospora and Eimeria spp. polymerase chain reaction amplification products. J. Food Prot., 62:682-685.
- Koumans, E.H.A. D.J Katz, J.M. Malecki, S. Kumar, S.P. Wahlquist, M.J. Arrowood, et al. 1998. An outbreak of cyclosporiasis in Florida in 1995: a harbinger of multistate outbreaks in 1996 and 1997. Am J. Trop. Med. Hyg. 59:235-242.
- Lopez, A.S., D.R. Dodson, M.J. Arrowood, P.A. Orlandi, A.J. da Silva, J.W. Bier, et al. 2001. Outbreak of cyclosporiasis associated with basil in Missouri in 1999. Clin. Infec. Dis. 32 :1010-1017.
- Lopez, F.A., J. Manglicmot, T.M. Schimidt, C.Yeh, H.V. Smith, and D.A. Relman. 1999. Molecular characterization of Cyclospora-like organisms from baboons. J. Infect. Dis. 179:670-676.
- Orlandi, P.A. and K.A. Lampel. 2000. Extraction-free, filter-based template preparation for the rapid and sensitive PCR detection of pathogenic parasitic protozoa. J. Clin. Microbiol. 38:2271-2277.
- Orlandi, P.A., D.-M. T. Chu, J.W. Bier, and G.J. Jackson. 2002. Parasites and the food supply. Food Technology 56:72-81.
- Orlandi, P.A., L. Carter, A.M. Brinker, A.J. da Silva, K.A. Lampel, and S.R. Monday. 2003. Targeting single nucleotide polymorphisms in the 18S rRNA gene to differentiate Cyclospora spp. and Eimeria spp. by multiplex PCR. Appl. Environ Microbiol. Submitted for publication.
- Ortega, Y., C.R. Roxas, R.H. Gilman, N.J. Miller, L. Cabrera, C. Taquiri, and C.R. Sterling. 1997. Isolation of Cryptosporidium parvum and Cyclospora cayetanensis from vegetables collected in markets of an endemic region in Peru. Am. J. Trop Med. Hyg. 57:683-686.
- Ortega, Y., C.R. Sterling, R.H. Gilman, V.A. Cama, and F. Diaz. 1993. Cyclospora species-a new protozoan pathogen of humans. N. Engl. J. Med. 328:1308-1312.
- Ortega, Y., R.H. Gilman, and C.R. Sterling. 1994. A new coccidian parasite (Apicomplexa:Eimeriidae) from humans. J. Parasitol. 80:625-629.
- Pieniazek, N.J. and B.L. Herwaldt. 1997. Reevaluating the molecular taxonomy: is human-associated Cyclospora a mammalian Eimeria species? Emerg. Inf. Dis. 3:381-383.
- Relman, D.A., T.M. Schmidt, A. Gajadhar, M. Sogin, J. Cross, K. Yoder, O. Sethabutr, and P. Echeverria. 1996. Molecular phylogenetic analysis of Cyclospora, the human intestinal pathogen, suggests that it is closely related to Eimeria species. J. Infect. Dis. 173:440-445.
- Sherchand, J.B., J.H. Cross, M. Jimba, S. Sherchand, M.P. Shrestha. 1999. Study of Cyclospora cayetanensis in health care facilities, sewage water and green leafy vegetables in Nepal. Southeast Asian J. Trop. Med. Public Health 30:58-63.
- Slifko, T.R., H.V. Smith, and J.B. Rose. 2000. Emerging parasite zoonoses associated with water and food. Int. J. Parasitol. 30:1379-1393.
- Sturbaum, G.D., Y.R. Ortega, R.H. Gilman, C.R.Sterling, L. Cabrera, and D. Klein. 1998. Detection of Cyclospora cayetanensis in wastewater. Appl. Environ. Microbiol. 64:2284-2286.
- Sturbaum, G.D., C. Reed, P.J. Hoover, B.H. Jost, M.M. Marshall, and C. R. Sterling. 2001. Species-specific, nested PCR-restriction fragment length polymorphism detection of single Cryptosporidium parvum oocysts. Appl. Environ. Microbiol. 67:2665-2668.
- Wurtz, R. 1994. Cyclospora: a newly identified intestinal pathogen of humans. Clin. Inf. Dis.18:620-623.
- Yoder, K.E., O. Sethabutr, and D.A. Relman. 1996. PCR-based detection of the intestinal pathogen Cyclospora, pp. 169-176. In D.H. Persing (ed.), PCR protocols for emerging infectious diseases, a supplement to diagnostic molecular microbiology: principles and applications. ASM Press, Washington, DC.
Authors: Palmer A. Orlandi, Christian Frazar, Laurenda Carter, and Dan-My T. Chu

