Food
FDA Survey of Imported Fresh Produce - Import Produce Assignment (DFP # 05-16)
HIGH Priority
ORA Concurrence # 2005031601
Return to Guidance, Compliance & Regulatory Information for Fruits, Vegetables & Juices
Memorandum
Attachment A: Detection and Isolation of Shigella species From Produce, Revised 8/2/05
Attachment B: Soak Method for the Detection of Salmonella in Basil, Cilantro, Green Onions, Loose-Leaf Lettuce, Parsley, and Spinach
Attachment C: Soak Method for Salmonella analysis in Cantaloupe
Attachment D: Soak Method for Salmonella analysis in Tomatoes
Attachment E: Protocol for the Detection of Viruses in Produce
Attachment F: Detection of Cyclospora from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR)
| Date: | March 18, 2005 |
| From: | Consumer Safety Officer, Division of Field Programs Through: Chief, Compliance Programs Branch, HFS-636 /s/ |
| Subject: | Import Produce Assignment (DFP # 05-16) - HIGH Priority ORA Concurrence # 2005031601 |
| To: | District Directors: (#) Directors, Regional Laboratory: (#) Import Program Managers: (#) Director, Laboratory Branch: (#) Director, Microbiology Branch: (#) Directors, Compliance Branch: (#) |
| Info: | Regional Food and Drug Directors: ALL Directors, Investigations Branch: (#) Field Food Committee Chairperson (#) Field Food Program Monitors: (#) |
Note: Material that is not releasable under the Freedom of Information Act (FOIA) has been redacted/deleted from this electronic version of the program. Deletions are marked as follows: (#) denotes one or more words were deleted; (&) denotes one or more paragraphs were deleted; and (%) denotes an entire attachment was deleted.
OBJECTIVES
- To collect and analyze samples of selected fresh imported produce for microbiological pathogens.
- To take appropriate regulatory actions on lots found contaminated, including DWPE recommendations for the product and responsible shipper, grower and/or importer.
BACKGROUND
Over the past decade, the number of foodborne illnesses associated with fresh fruits and vegetables has increased. Fresh fruits and vegetables are grown in fields and orchards. Consequently, surfaces of produce during growth become contaminated with non-pathogenic and possibly pathogenic microorganisms. In addition to growing conditions, packaging and further processing (e.g., cutting, slicing, packaging) under insanitary conditions provides additional opportunities for contamination of harvested produce with pathogens. Fresh produce is of special concern because it is likely to be consumed without further treatment to "destroy or remove" microorganisms. The increase in foodborne illnesses associated with fresh produce may be due, in part, to increased ability to detect foodborne illness outbreaks and to an increase in the consumption of fresh produce. CFSAN has conducted a number of surveys since 1999 to gather data on the incidence and extent of pathogen contamination on selected produce, both imported and domestic. This assignment is being issued to continue this effort and is specified in the FY05 WorkPlan under Import and Domestic Micro Assignments.
Produce commodities are selected for sampling based on results of previous assignments, recent foodborne illness outbreaks, and other data needs. The elements of the assignment including pathogens targeted and analytical methods are kept as constant as possible for continuity between assignments and to facilitate completion of the assignment. Where changes from previous versions are necessary, they will be noted.
Over the past few years, there have been several studies involving the ability to recover and detect pathogen contamination of fresh produce. Most often, analyses involve rinsing the outside of the fruit or vegetable and analyzing the rinse water for pathogens. However, for some commodities and pathogens, the rinse method has a very low incidence of pathogen recovery and detection. For example, it is difficult to recover pathogens from the rough surface of cantaloupe. Pathogen recovery is significantly improved if cantaloupe is soaked rather than rinsed. If pathogens have been internalized into the product, a surface rinse may again fail to detect their presence. Internalization is a particular concern for microbiological analysis of tomatoes. Prior to the most recent assignment, a study was done within CFSAN to analyze the accuracy of two different Salmonella soak methods, one for cantaloupe and another for whole tomatoes. The study determined that the soak methods yielded more accurate results than when these two commodities were examined by the rinse method (fewer false negative results). In this assignment, the soak methods will be used for the Salmonella analyses of all commodities, with modified soak methods for cantaloupe and for tomatoes.
APPROACH
This assignment is to be implemented upon receipt. Each district should collect samples as seasonally available. The assignment will continue through September 30, 2005 if needed to meet sampling goals.
Sample Collection and Shipment
Sample Schedule
The following table shows the collecting districts, products to be collected, and the number of requested samples per commodity per district.
| Commodity | District |
|---|---|
| Cantaloupe | (#) |
| Tomatoes | |
| Loose-leaf lettuce | |
| Green Onions - split sample | |
| Spinach | |
| Cilantro | |
| Basil - split sample | |
| Parsley | |
| Snow Peas | |
| Totals per district |
Each district should collect samples indicated as available in that district as per OASIS. If product availability requires districts to substitute commodities between others from the table to meet overall sampling obligations, this will be acceptable. Districts should attempt to meet the totals per district. All samples should be field grown commodities where microbial contamination may be of concern due to poor agricultural practices on the field and/or poor manufacturing practices, such as at packing houses, i.e., districts should not knowingly collect hot house or greenhouse produce. Identified commodities from all countries of origin (except US Goods returned) are acceptable for sampling under this assignment except that no samples of Mexican cantaloupe (except for the exception noted below) are to be collected because they are covered by Import Alert #22-01. Exempt growers/importers that are on IA #22-01 may be sampled once during the course of this assignment. Districts should continue to collect samples until their obligation is fulfilled or until September 30, 2005.
For all products, a sample will consist of ten (10) sub-samples (no 702(b) required). For all products except cantaloupe and tomato, each sub-sample will consist of 454 grams (1 pound). For cantaloupe, each sub-sample will consist of two cantaloupes. For tomatoes, each sub-sample will consist of 900 grams (2 pounds).
NOTE: Split sample indicates one portion of the sample is sent to one science unit and another portion is sent to another science unit. Each split sample must consist of ten sub-samples.
Coordinate shipment and analysis of samples with the analyzing laboratories before collecting to ensure that the sample will be analyzed expeditiously.
NOTE: Samples collected under intensified sampling (see Regulatory Section) should indicate this on the collection report.
Ship samples to servicing laboratories according to the following table:
| Commodity | Servicing Laboratories |
|---|---|
| Cantaloupe | (#) |
| Tomatoes | |
| Loose-leaf lettuce | |
| Spinach | |
| Cilantro | |
| Parsley | |
| Snow Peas | |
| Basil - split sample: | |
| Cyclospora cayetanensis | |
| All other analyses | |
| Green Onions - split sample: | |
| Hepatitis A | |
| All other analyses |
Collect all samples as domestic import status. Process the sample collection in FACTS. Inform importers that preliminary analytical results (negative for the pathogens) should be available within 3 to 7 days of sample receipt by the FDA servicing laboratory (should include estimated shipping time as well). Any distribution of sampled product is done at the importer's risk.
The following should be included with the Notice of Sampling.
NOTE: Notice to the Importer
Surveillance Sample(s) collected from this shipment will be tested for the presence of pathogenic microorganisms. Preliminary analytical results may be available within 4 to 9 days following the date of sample collection. FDA will attempt to provide the importer with preliminary analytical results as soon as they are available. Should a sample be determined to contain a pathogenic microorganism and is violative, the importer will be responsible to initiate a recall of the product.
If you have any questions regarding the above procedures contact the Division of Import Operations and Policy (DIOP), Linda Wisniowski at 301-594-3855.
Aseptic Sampling
Collect all samples ASEPTICALLY; see IOM, Chapter 4, Section 426.
| NOTE: | It is important that each sub-sample be collected into a separate bag, and controls (i.e., open and unopened collection bags, and unopened sterile disposable gloves) be submitted with the sample. All controls must be identified and placed in the container with the sample. |
Collect sub samples at random to ensure that the sample is representative of the lot.
Sampling containers for cantaloupe samples:
If whirl pack bags of sufficient size are unavailable, investigators may use unopened, new, small commercial garbage or trash bags. Previous experience indicates that the interiors of these bags do not support the growth of bacteria. If these containers are used, then an unopened intact bag must also be submitted to the laboratory as a control sample.
Sample Shipment
Because fresh produce is highly perishable, ship refrigerated samples by the fastest means possible and coordination should be made by the District to the servicing labs for this assignment. Consideration should also be made to not collect samples late in the day if they cannot be prepared and shipped the same day.
Ensure that the coolant used does not come in direct contact with the commodity.
REPORTING REQUIREMENTS
Data Reporting
Laboratories are required to report positives and monthly sample status to headquarters.
Report all analytical finding into FACTS using PAF = MIC (problem code MICROID, PFGE, SERO as appropriate); secondary PAF = SAL, ABR.
Data Reporting Requirements:
| Cantaloupe: | 22A [ ] B01 | Raw |
| 22A [ ] C01 | Raw, Fresh, Refrigerated | |
| Tomatoes: | 24F [ ] B50 | Raw |
| 24F [ ] C50 | Raw, Fresh, Refrigerated | |
| Loose-leaf Lettuce: | 24T [ ] B32 | Raw |
| 24T [ ] C32 | Raw, Fresh, Refrigerated | |
| Green Onions: | 25J [ ] B04 | Raw |
| 25J [ ] C04 | Raw, Fresh, Refrigerated | |
| Spinach: | 24T [ ] B25 | Raw |
| 24T [ ] C25 | Raw, Fresh, Refrigerated | |
| Cilantro: | 24T [ ] B46 | Raw |
| 24T [ ] C46 | Raw, Fresh, Refrigerated | |
| Basil: | 28A [ ] B04 | Raw |
| 28A [ ] C04 | Raw, Fresh, Refrigerated | |
| Parsley: | 24T [ ] B21 | Raw |
| 24T [ ] C21 | Raw, Fresh, Refrigerated | |
| Snow Peas | 24A [ ] B51 | Raw |
| 24A [ ] C51 | Raw, Fresh, Refrigerated | |
|
PAC: Report all import operations accomplished under PAC 03F098. |
||
ANALYTICAL
Negative or presumptive positive test results for Salmonella and Shigella will be available within 3 days from receipt in the lab, Cyclospora and Hepatitis A negative or presumptive positive test results will be available within 5 days from receipt in the lab, E. coli negative results will be available in 3 days and confirmed positive and MPN within 7 days from receipt in the lab, E. coli O157:H7 negative results will be available in 3 days and presumptive positive will be available in 5 days from receipt in the lab. The collecting district in coordination with the servicing laboratories needs to notify the broker of either negative or presumptive positive results within the timeframe.
| ANALYTICAL RESULTS | ||
|---|---|---|
| Microorganism | Presumptive Positive | Positive |
| E. coli | Not Applicable | IMVIC, API20E, VITEK GNI+, modified 3.21.05 |
| E. coli 0157:H7 | Absence of Sorbitol fermentation on TC-SMAC agar and Spot Indole Test, modified 3.21.05 | Serology and PCR |
| Salmonella | VIDAS | (api20E or VITEK GNI+) and Salmonella antiserum H and O Groups |
| Shigella | First round PCR (of amplified product and/or microbiology with PCR analysis of colonies) using ipaHF/ipaHR primers | Nested PCR (of amplified product and/or microbiology with PCR analysis of colonies) using ipaH3/ipaH4 primers |
| Cyclospora cayetanensis | Not Applicable | CC719 CRP999 |
| Hepatitis A | BG7/BG8 | Sequencing |
At the first of each month, each laboratory is requested to e-mail a list of samples received and/or completed during the previous month to the DFS contact (Atin Datta at atin.datta@fda.hhs.gov). The information will include the sample number, product, sampling district and analysis results (if completed). This information will be compiled and sent to CFSAN assignment contact (Carrie Lawlor at carrie.lawlor@fda.hhs.gov). The labs will immediately notify the DFS contacts and the CFSAN assignment contact of positive samples by e-mail. Laboratories should also immediately notify the collecting district.
Sample Analysis
-
Analyzing laboratories: (#)
Due to the perishable nature of fresh produce, it is important that analyses start immediately upon arrival of samples to the laboratories. Samples should not be frozen at any time prior to analysis.
Use the following table to determine which commodities to sample for each pathogen.
E. coli E. coli 0157:H7 Salmonella Shigella Cyclospora
cayetanensisHepatitis A Cantaloupe X X X Tomatoes X X X Loose-leaf lettuce X X X Green onions X X X X Spinach X X Cilantro X X Basil X X X Parsley X X X Snow peas X Salmonella cannot be enumerated when detected by the soak method.
-
Sample splitting:
Tomato, Cantaloupe, and Parsley
Each sub sample will be split into two approximately equal portions. One portion of each sub sample will be analyzed for E. coli, and Shigella using the sub sample rinse method. The other portion of each sub sample will be used for Salmonella testing as per the specialized soak methods for the particular commodity.Loose-leaf lettuce
Each sub sample will be split into two approximately equal portions. One portion of each sub sample will be analyzed for E. coli and E. coli O157:H7 using the sub sample rinse method. The other portion of each sub sample will be used for Salmonella testing as per the specialized soak method for the particular commodity.Green Onions
Each sub sample will be split into three portions. One portion of each sub sample will consist of 50 grams and will be analyzed for Hepatitis A using the protocol for the detection of viruses in produce (Attachment E). The remaining quantity will be split into two approximately equal portions; one portion will be analyzed for E. coli and Shigella using the sub sample rinse method, and the other portion of each sub sample will be used for Salmonella testing as per the specialized soak methods for the particular commodity.Spinach and Cilantro
Each sub sample will be split into two approximately equal portions. One portion of each sub sample will be analyzed for E. coli using the sub sample rinse method. The other portion of each sub sample will be used for Salmonella testing as per the specialized soak method for the particular commodity.Basil
Remove a 10 gram portion of each sub sample for analysis for Cyclospora cayetanensis. The remaining portion of each sub sample will be split into two approximately equal portions. One portion of each sub sample will be analyzed for E. coli using the sub sample rinse method. The other portion of each sub sample will be used for Salmonella testing as per the specialized soak method for the particular commodity. -
Sub-sample Rinse Preparation
Pre-sample preparation for all products that are to be analyzed by the Rinse Method.
To conduct meaningful bacterial analyses, the samples must be prepared for analysis in a manner that closely simulates the actions typically taken by consumers who provide minimal preparation (e.g., washing and/or trimming) prior to consumption.
All product analyses except Salmonella: Perform a light rinse to remove visible dirt. "Light rinse" means to place produce commodity under cold running tap water for several seconds until visible dirt is removed. For Salmonella analyses only, a preliminary rinsing of the produce under running tap water is not recommended.
For each individual sub sample, place contents into a sterile plastic bag. Add a volume of Butterfield's phosphate buffer solution that is equal to the weight of the product. For instance, if one sub sample weighs 500 g, add 500 ml Butterfield's phosphate buffer solution (1:1 dilution). Gently shake the bag with contents for 5 minutes using a shaker (e.g., orbital) at 100 rpm. This is considered to be the "sub sample rinse". Do not discard the "sub sample rinse" until the entire analysis is completed. Refrigerate the remaining rinse.
- Sub-Sample Rinse Method for
-
E. coli (Loose-leaf lettuce, cantaloupe, tomatoes, cilantro, spinach, parsley, basil, and green onions)
From each sub sample rinse (10 analyses/sample):
Prepare decimal dilutions by removing 50 ml (of sub sample rinse) into 450 ml of Butterfield's phosphate buffer solution (1:10). Then follow methodology as outlined in the BAM for E. coli.
NOTE: E. coli analysis: inoculation of the LST tubes will be conducted from 10-1 to 10-5 dilutions, only. It will not be necessary to prepare/use tubes for dilutions greater than 10-5for an end-point. Therefore, the maximum result that can be encountered would be > 110,000 MPN/g. The Laboratory should notify the CFSAN Assignment Contact (Carrie Lawlor at carrie.lawlor@fda.hhs.gov) when levels equal to or greater than 100 MPN of E. coli are found.
-
E. coli O157:H7
Note: Only loose-leaf lettuce is to be tested for E. coli O157:H7.
From each subsample rinse (10 analyses/sample):
Remove 125 ml (of sub sample rinse) and place in a sterile beaker/flask with 125 ml 2X EEB to perform the E. coli O157:H7 analysis. Then follow methodology as outlined in BAM, Chapter 4a, Sections K-Q.
NOTE: Since the normal flora levels are not anticipated to be high in these products, the level of antibiotic cefixime to be used in the EEB enrichment is recommended to be reduced to one-fourth of that stated in the BAM (Edition 8, Revision A/1998), to avoid the inhibition of any E. coli O157: H7 that may be present. See BAM, Ch. 4a, Section M.
DO NOT USE THE OPTIONAL METHOD DESCRIBED THAT USES DYNA BEADS.
Positive E. coli O157: H7
Submit one (1) isolate from each E. coli O157:H7 positive sub sample to the specified laboratories per the instructions for PFGE and ribotyping. All laboratories are to send isolates for PFGE and/or ribotyping analyses within 24 hrs after completion of the analytical portion of the sample analysis.
All cultures should be shipped by FedEx overnight and should conform to the rules and regulations regarding the shipment of infectious agents. Consult your supervisor if you have any questions.
Ensure that the appropriate servicing laboratory is selected and identified in FACTS - MIC screen.
Submit E. coli O157:H7 isolates for Pulse Field Gel Electrophoresis (PFGE) assay to respective servicing laboratories.
Submit E. coli O157:H7 isolates for ribotyping only to:
(#)
Regional Laboratory HFR-PA260)
19701 Fairchild
Irvine, CA 92612Submit E. coli O157:H7 isolates for antibiotic sensitivity assay to:
(#)
6th Avenue & Kipling Street
DFC BLDG. 20
Denver, Colorado 80225-0087
(#) -
Shigella Only analyze cantaloupe, tomatoes, parsley, and green onions for Shigella.
See Attachment A: Detection and Isolation of Shigella species from Produce.
Shigella analysis must be done on a composite basis (i.e., 2 composites per sample). Each composite for Shigella analysis will consist of 250 ml.
If the district laboratories do not have PCR primers and the positive control strain, please notify Keith Lampel, Ph.D., the CFSAN scientific contact for Shigella.
-
- Soak Method for
-
Salmonella - Do not use this method for tomatoes or for cantaloupe
Salmonella analysis will be done on a composite basis (i.e., 2 composites per sample). Each composite for Salmonella analysis will consist of 375 ml.
Prepare each composite by removing 75 grams from each of five (5) sub samples into a sterile beaker/flask. Add 3375 ml of appropriate pre-enrichment broth (see Attachment B).
Incubate 24±2 h at 35° C. Then follow the methodology as outlined in BAM On-line, at Chapter 5 for Salmonella.
Screen all samples for Salmonella using rapid methods listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology" dated April 24, 1998. If the laboratory does not have a copy of the memo, they should request a copy from the Division of Field Science, HFC-140.
If there is a presumptive positive based on the test kit, then perform:
[1] Confirmation analyses as outlined in the BAM.
-
Special Salmonella method only for use on cantaloupe:
See Attachment C: Soak Method for Salmonella analysis in Cantaloupe.
-
Special Salmonella method only for use on tomatoes:
See Attachment D: Tomato Soak Method for Salmonellaanalysis
-
Salmonella Positive Isolates
One (1) isolate from each Salmonella positive composite or sub sample is to be sent to each of the specified laboratories per the instructions for serotyping (speciation) and PFGE.
Following speciation, one slant from each serotyped isolate will be sent for antibiotic resistance testing.
All laboratories are to send Salmonella isolates for serotyping and PFGE analyses within 24 hrs after completion of the analytical portion of the sample analysis.
All cultures should be shipped by FedEx overnight and should conform to the rules and regulations regarding the shipment of infectious agents. Consult your supervisor if you have any questions.
For Salmonella serotyping, all bacterial cultures should be prepared and submitted according to the directions specified in the Bacteriological Analytical Manual (BAM), at Chapter 5, E.11 "Submission of cultures for serotyping."
Ensure that the appropriate servicing laboratory is selected and identified in FACTS - MIC screen.
The serotyping (speciation) laboratory should batch isolates of Salmonella for antibiotic resistance testing (20 isolates per batch) and ship to the identified laboratory for antibiotic resistance testing.
An electronic mail should be sent to the recipient before the shipment.
Submit Salmonella isolates for serotyping to the laboratories listed below.
Isolates from (#) will be serotyped in ARL:
Arkansas Regional Laboratory
3900 NCTR Road Building 26
Jefferson AR 72079
(#)Isolates from (#) will be serotyped in DEN:
Denver District Laboratory
6th Avenue & Kipling Street
DFC Building 20
Denver Colorado 80225-0087
(#)Serotyping laboratories submit Salmonella isolates for antibiotic sensitivity assay to:
(#)
6th Avenue & Kipling Street
DFC BLDG. 20
Denver, Colorado 80225-0087
(#)Submit Salmonella isolates for Pulse Field Gel Electrophoresis (PFGE) assay to respective servicing laboratories.
-
-
Hepatitis A Only analyze green onions for Hepatitis A
See Attachment E: Protocol for the Detection of Viruses in Produce.
- Cyclospora cayetanensis Only analyze basil and snow peas for Cyclospora cayetanensis.
-
Basil
See Attachment F: Detection of Cyclospora from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR).
-
Snow Peas
Cyclospora analysis for snow peas will be done on a composite basis (i.e., 2 composites per sample). Each composite for Cyclospora analysis will consist of 100 grams. Prepare each composite by removing 20 grams from each of five (5) sub samples and proceed with the protocol in Attachment F: Detection of Cyclospora from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR).
-
REGULATORY/ADMINISTRATIVE FOLLOW-UP
Further action should be considered if any of the following microorganisms are detected and confirmed:
- Generic/Total E. coli
- E. coli O157:H7
- Salmonella
- Shigella
- Hepatitis A
- Cyclospora cayetanensis
Please include the original entry number with each sample submitted for regulatory review. Please refer to the guidance outlined below:
Generic E. coli:
If found at levels equal to or greater than 100 MPN, after the CFSAN contact is notified, the competent authority in the producing country will be notified by CFSAN since these levels indicate gross insanitation.
E. coli O157:H7, Salmonella:
Contamination of produce with these pathogens is considered a significant risk to health. These pathogens may be present as the result of animal-to-food contamination that is out of control at the grower, or insanitation at the processor, or manufacturer. However, the pathogens may be introduced to the growing fields from natural sources. Therefore, a single instance of contamination may be the result of an unavoidable solitary occurrence and regulatory discretion will be applied. However, if more than a solitary occurrence of contamination occurs, either in the same lot or in subsequent lots, it is indicative of inadequate controls and additional lots are likely to be contaminated.
Regulatory Strategy:
- If TWO or more positive composites (Salmonella) or sub samples (E. coli O157:H7) are found in the initial sampling from one entry:
- Notify the importer of the results, refer to District Recall Coordinator, and recommend identified grower/shipper for detention without physical examination (DWPE) based on sections 402(a)(1) of the Federal Food, Drug, and Cosmetic Act (the Act).
- If ONE positive composite (Salmonella) or sub sample (E. coli O157:H7) is found in one entry:
- Notify the importer of the results, refer to District Recall Coordinator, and notify the DFS contact (Atin Datta at atin.datta@fda.hhs.gov) and the CFSAN Assignment Contact (Carrie Lawlor at carrie.lawlor@fda.hhs.gov) so that if a second positive is found by another district, shipper/grower can be recommended for DWPE. The CFSAN contact will provide positive sample information to DIOP for inclusion on the weekly class 3 sample reports to aid in disseminating the information to all districts. However, it will primarily be incumbent upon the original sampling district to follow through with and cease the intensified sampling.
- Initiate intensified sampling. Sample the next ten- (10) shipments/entries of that product from that grower/shipper. Intensified sampling may cease when a second violation (for the same or another pathogen) is detected. Ten (10) sub-samples are to be collected and individually analyzed. If intensified sampling occurs for green onions, do not collect a split sample for Hepatitis A analysis. Intensified sampling for green onions is required only for Salmonella, Shigella, and E.coli analyses. Do not composite sub-samples. Samples collected under intensified sampling should be analyzed for all pathogens directed in this assignment.
- If a second positive is detected for the same or another pathogen, this will result in the shipper/grower being recommended for DWPE and sampling should be discontinued.
- If a second positive is not confirmed in the ten (10) shipments/entries, discontinue intensified sampling.
NOTE: All DWPE recommendations need the concurrence of CFSAN and ORA headquarters prior to implementation and must be submitted to DIOP.
Shigella, Hepatitis A, and Cyclospora cayetanensis:
Contamination of a product with human source pathogens, Shigella, Hepatitis A, and Cyclospora cayetanensis, is considered a significant risk to health. Shigella contamination is also indicative of a direct human-to-food contamination. Hepatitis A is excreted in feces of infected people and can produce clinical disease when susceptible individuals consume contaminated water or foods. Hepatitis A is primarily transmitted by person-to-person contact through fecal contamination, but common-source epidemics from contaminated food and water also occur. Poor sanitation and crowding facilitate transmission. Contamination of foods by infected workers in food production facilities/processing plants and restaurants is common. No known non-human sources of the virus exist. It is likely that the cause of the contamination with Shigella and Hepatitis A is a result of insanitation at the grower or subsequent establishments. It is likely that subsequent lots may also be contaminated unless insanitary conditions or practices are corrected. Cyclospora cayetanensis is transmitted by the fecal-oral route; however, direct person-to-person transmission is unlikely because excreted oocysts require days to weeks under favorable environmental conditions to become infectious (i.e., sporulate). Most reported cases have occurred during spring and summer.
Regulatory Strategy:
- If ONE positive composite is found in one entry:
-
Notify the importer of the results, refer to District Recall Coordinator, and recommend identified grower/shipper for DWPE based on Section 402 (a)(1) of the Act in that "The article is subject to refusal of admission pursuant to Section 801(a)(3) of the Act in that it appears to bear or contain a poisonous or deleterious substance which may render it injurious to health [adulteration]".
NOTE: All DWPE recommendations need the concurrence of CFSAN and ORA headquarters prior to implementation and must be submitted to DIOP.
-
REMOVAL FROM DETENTION WITHOUT PHYSICAL EXAMINATION
FDA decisions to remove a product, shipper, grower, or importer from DWPE should be based on evidence establishing that the conditions that gave rise to the appearance of a violation have been identified and resolved and the Agency has confidence that further entries will be in compliance with the Act.
The following criteria are required in the evaluation for the removal from DWPE:
- Documentation of an investigation into causes of the violation, including an evaluation of the growing, manufacturing, packing, and/or transportation processes.
- The evaluation needs to be confirmed by a reputable source (FDA, another government agency, accredited certification/inspection body).
- The source of the problem must be identified.
- A corrective action plan must be developed, implemented, and verified.
- Any additional documentation that demonstrates that the action plan has corrected the problem.
If a farm investigation or verification of implemented corrective measures is not conducted by FDA, FDA may decide to audit the verification of the corrective actions before a grower is removed from DWPE. Since CFSAN concurrence is necessary before removing the product/firm from DWPE, all recommendations for removal from DWPE are to be submitted to DIOP for review and coordination with CFSAN when the district or other interested parties present documentation, which establishes that the corrective actions implemented adequately presents evidence that meets the criteria for removal from DWPE.
SUMMARY/EVALUATION
The Office of Plant and Dairy Foods will prepare a summary and evaluation of the findings within 120 days of the completion of the assignment.
CONTACTS
| CFSAN Assignment Contact: | Carrie Lawlor, (301) 436-2068 Office of Compliance, Division of Field Programs Compliance Programs Branch, HFS-636 |
|
CFSAN Import Regulatory Contact: |
Doriliz Mestey, (301) 436-2772 Office of Compliance, Division of Enforcement Import Branch, HFS-606 |
| CFSAN Import Regulatory Contact (Backup): | Salvatore Evola, (301) 436-2164 Office of Compliance, Division of Enforcement Import Branch, HFS-606 |
| CFSAN Program Office Contact: | Amy Green, (301) 436-2025 Office of Plant and Dairy Foods Division of Plant Product Safety Regulatory and Policy Branch, HFS-306 |
| CFSAN Scientific Contacts: | |
| E. coli and E. coli O157:H7: | Peter Feng, PhD, (301) 436-1650 Office of Plant and Dairy Foods Division of Microbiological Studies Microbiological Methods Development Branch, HFS-516 |
| Shigella: | Keith A. Lampel, PhD, (301) 827-8617 Office of Applied Research and Safety Assessment Division of Virulence Assessment Virulence Mechanisms Branch, HFS-025 |
| Salmonella: | H. Andrews, PhD, (301) 436-2008 Office of Plant and Dairy Foods Division of Microbiological Studies Microbiological Methods Development Branch, HFS-516 |
| Hepatitis A: | Biswendu B. Goswami, PhD, (301) 827-8627 Office of Applied Research and Safety Assessment Division of Molecular Biology Virulence Mechanisms Branch, HFS-025 |
| Cyclospora cayetanensis: | Palmer A. Orlandi, PhD, (301) 827-8643 Office of Applied Research and Safety Assessment, Division of Virulence Assessment Virulence Mechanisms Branch, HFS-025 |
ORA Import Alert and Procedures Inquires:
Linda Wisniowski, Division of Import Operations and Policy, HFC-170 at (301) 443-6553.
ORA Analytical Inquiries:
Atin Datta, PhD, Division of Field Sciences, HFC-141 at (301) 827-1030.
Marsha Hayden, Division of Field Sciences, HFC-141 at (301) 827-1039.
ORA Investigational Contact: Barbara Marcelletti, Division of Field Investigations, HFC-130 at (301) 827-5635.
(#)
Attachment A - Revised 8/2/05
Import Produce Assignment FY 2005 DFP # 05-16
Detection and Isolation of Shigella species From Produce
Notes:
Microbiological analysis and PCR are to be performed concurrently. PCR analysis should be performed on both the amplified product and suspect colonies.
Addition of a positive control spike of the rinse will run in parallel to the sample analysis (conventional and molecular) throughout the method.
Media and reagents:
For preparation of media and reagents, refer to the Bacteriological Analytical Manual (BAM). The number in parentheses following each medium refers to its listing in the media section of the BAM.
Media
- Shigella broth with novobiocin (M136)
- MacConkey agar (M91)
- Hektoen Enteric agar (M61)
- Xylose Lysine Desoxycholate agar (M179)
- Triple sugar iron (TSI) agar (M149)
- Motility test medium (semisolid) (M103)
- Decarboxylase basal medium (lysine, Falkow) (M44), or lysine iron agar (M89)
Reagents
- 1N Sodium hydroxide solution (R73)
- 1N Hydrochloric acid (R36)
Enrichment in broth medium
- Split the 250 ml, five-sub composite rinse to obtain two 125 ml rinse aliquots. One aliquot will serve as a positive control.
- Transfer each sub sample rinse (125 ml each) to one of two sterile 500 ml Erlenmeyer flasks containing 125 ml of 2X Shigella broth with novobiocin
(final concentration should be 0.5 ug/ml). The positive control rinse aliquot will be spiked at a level of <60 cfu/250 ml of rinse/enrichment broth. - Adjust pH, if necessary, to 7.0 ± 0.2 with sterile 1 N NaOH or 1 N HCl.
- Incubate at 40°C ± 2°C overnight (16 to 24 hours), aerobic conditions, with no shaking.
Bacteriological testing
Procedure
- Streak a loopful of enrichment and positive control broths onto MacConkey (MAC), Hektoen (HE), and Xylose Lysine Desoxycholate (XLD) agar plates immediately after enrichment.
- Incubate plates overnight (16 to 24 hrs) at 37° C ± 2° C.
- Identify suspect colonies.
- Prepare lysate from suspect colonies and test via PCR protocol (first round and nested). Include one positive control colony from each agar type.
- Inoculate as many as six to twelve suspicious colonies into the following media: TSI agar slant, lysine decarboxylase broth or lysine iron agar slant, and motility agar. Pick from the center of the colony without touching the agar). Include one positive control colony from each agar type.
- Incubate tubes at 37° C + 2° C for 20 hrs, but also examine after 48 hrs.
Examination/results
- Follow standard microbiological criteria for examining test results.
- The characteristics of Shigella are summarized as follows:
- MAC agar: Shigella colonies are translucent, with or without rough edges.
- HE agar: Shigella colonies are approx. 2-3 mm and appear green.
- XLD agar: Shigella colonies are 1-2 mm diameter, transparent or red, smooth colonies.
- TSI: K/A, H2S-, no gas
- Negative for motility
- Negative for production of lysine decarboxylase
PCR
- Note: If enrichment broth culture appears to contain large amounts of plant material and debris, decant approximately 50 ml of the enrichment broth cultures from sample and spiked rinse into centrifuge tubes (50 ml).
Perform a slow-speed spin (2000 rpm for 2 minutes) to remove debris. Carefully transfer 1.0 ml of supernatants to fresh micro centrifuge tubes. Centrifuge at 14,000 rpm for 3 minutes to pellet bacterial cells. Remove as much of the supernatant as possible (to avoid leaving behind any inhibitory compounds; aspiration may be a better alternative than decanting the supernatant). - Add 50 - 500 µg of 1 X phosphate buffer solution (PBS) (this will depend upon the size of the pellet). If the pellet is hardly visible, then add the smallest amount of 1 X PBS. PBS formulation: 11.42 grams NaCl, 1.08 grams Na2HPO4, 0.315 grams KH2PO4, 1.5 liters dH2O pH 7.4
- For PCR template preparation: Boil the cell suspension in a water bath for 5 minutes, cool on ice and centrifuge at 14,000 rpm for 3 minutes. Transferring the supernatant to another tube is not necessary; use the supernatant as template without disturbing the pellet.
-
PCR setup
The following is a typical set up for PCR methodology.
dH20 4-6.5 µl Mix 12.5 µl 10 X stock (DNA polymerase buffer*) Primers 2.5 µl each primer (10 pmoles/ ml stock) (will be provided) ipaHF and ipaHR Template 1-2.5 µl (e.g., positive control or PCR template prep) Total volume is 25 µl *HotStart Taq™ Master Mix Kit (Qiagen)
Primer sequences: ipaHF 5'GTT CCT TGA CCG CCT TTC CGA TAC CGT C 3' ipaHR 5'GCC GGT CAG CCA CCC TCT GAG AGT AC 3'
NOTE: A S. flexneri strain (2457M) is provided on a slant and should be streaked out onto nutrient agar plate (e.g., isolated colonies). This strain is a positive control, which can be used, with the PCR primers. However, this strain can be differentiated from any other Shigella isolate with another set of primers (607, 608), if needed, and its resistance to the antibiotic kanamycin [50 µg/ml]. All presumptive positive samples should be confirmed by nested PCR and also by primers 607 and 608 to make sure the positive samples are not due to cross contamination with the control strain. Amplification (PCR) with primers 607 and 608 will yield a 1.8 kb amplicon from the control strain (2457M) only; all other Shigella spp. will have a 1.0 kb amplicon. Control reactions can be run simultaneously (not multiplex) to ensure proper quality control of sample processing. A negative result, i.e. no PCR product from reactions using primers 607 and 608 only should not be interpreted as being negative for Shigella; the virulence plasmid could be completely or partially deleted. The ipaHF and ipaHR primers target the ipaH genes-there are 9 copies in the chromosome and virulence plasmid. Template is prepared by boiling a colony from an agar plate in 150 µl dH20 and using 1 µl in a PCR control tube. Another set of primers specific for this strain is available. It is recommended that the positive control be used to ensure that the reagents are working properly. -
PCR Amplification cycles and steps
First file is set at 95° C for 15 minutes
- Following cycles consists of the following steps:
- 94° C for 1 minute (denaturation)
- 60° C for 1 minute (annealing)
-
72° C for 1 minute (extension)
Total number of cycles is 30.
- 4° C for indefinite period of time (soak file)
-
Agarose Gel Analysis of PCR Products
After amplification, transfer 10 µl of the PCR products to another microcentrifuge tube containing 2 µl of tracking dye and load on 1% agarose gel.
NOTE: Do not add dye directly to the PCR product.
A 100 base pair ladder is used as a molecular weight standard. A 620 base pair product is expected from the positive samples. When reactions are completed, keep PCR product at 4° C or stored at -20° C.
If a 620 bp amplicon is seen on the agarose gel (presumptive positive), proceed to the nested PCR step below for confirmation.
NOTE: PCR primers
PCR primers (ipaH-F and ipaH-R) are targeted to the ipaH genes; there are multiple copies of this gene residing in the chromosome and in the virulence plasmid of Shigella.
-
Nested PCR protocol
Primers ipaH3 and ipaH4 are directed to internal sequences within the 620 bp amplicon generated from PCRs using primers ipaHF and ipaHR. Using primers ipaH3 and ipaH4, a 290 bp product should be amplified if the 620 bp fragment was generated from Shigella DNA. The objective of using the nested PCR assay is to confirm that the 620 bp fragment was amplified from Shigella.
- The PCR assay is as follows:
1. Distilled water 6.5 µl 2. 10 X buffer 12.5 µl (see note I below) 3. Primers 2.5 µl ipaH3 (stock is 10 pmol/µl) 2.5 µl ipaH4 (stock is 10 pmol/µl) 4. Template 1.0 µl (see explanation II below) -
PCR conditions (cycles and temperatures) are identical to amplification using PCR primers ipaHF and ipaHR.
After reactions are complete, run 8-10 µl through a 1 % agarose gel in 0.5 X Tris-acetate EDTA buffer, pH 8.3. Each gel should have a 100 bp ladder as molecular weight marker. A positive reaction generates a 290 bp fragment. This is a confirmatory test.
Notes:
- HotStartTaq™ Master Mix Kit (Qiagen)
- Usually if 1 µl of the PCR product is used directly from the reaction that amplified the 620 bp fragment, then 3 bands may be seen on the gel; the correct band at 290 bp and 2 other approximately 400 and 500 bp. The larger 2 bands are due to primers ipaHF and ipaHR being carried over from the first reaction. The larger amplified bands were generated from the combinations of ipaHF-ipaH4 and ipaHR-ipaHF. To avoid this, dilute the reactions that yielded a presumptive positive product 1:10 and 1:100 in separate tubes with dH2O. Use 1 µl of the diluted products as template. In some cases, faint bands around 400 and 500 bp may be seen on agarose gels using the 1:10 diluted product as template; this is explained above. A band at 290 bp is confirmation for the presence of Shigella.
-
The DNA polymerase used to develop this assay was from Qiagen. Others are probably suitable.
Primer sequence
ipaH3: 5'-CCA CTG AGA GCT GTG AGG
ipaH4: 5'-TGT CAC TCC CGA CAC GCCIt is recommended that the positive control be used to ensure that the reagents are working properly.
If a presumptive sample is analyzed by nested PCR and a 290 bp product is detected, save the PCR products from both sets of reactions (first round and nested). If necessary, send the products to:
Dr. Keith A. Lampel
FDA/CFSAN, HFS-515
5100 Paint Branch Parkway
College Park, MD 20740
301-436-2007
Reporting/actions
Interpretation:
Bacteriological:
Lactose negative on MacConkey/lactose agar plates
Negative for motility, hydrogen sulfide production, lysine
decarboxylase activity, no gas production from glucose.
PCR (of amplified product and of colonies):
Presumptive positive if first round PCR yields a 620 bp product
Confirmation is by nested PCR-amplification of 290 bp product
- Presumptive positive: first round PCR analysis of amplified product is positive AND/OR first round PCR analysis of colonies is positive.
- Confirmed positive: nested PCR analysis of amplified product is positive, AND/OR nested PCR analysis of colonies is positive.
- Negative: both PCR analysis of amplified product AND microbiology with PCR analysis of colonies are negative.
Reference:
Bacteriological Analytical Manual Online.
Attachment B
Import Produce Assignment FY 2005 DFP # 05-16
Soak Method for the Detection of Salmonella in Basil, Cilantro, Green Onions, Loose-Leaf Lettuce, Parsley, and Spinach
Note: This sample preparation is only to be used for the detection of Salmonella in basil, cilantro, green onions, loose-leaf lettuce, parsley, and spinach. See Attachment C for cantaloupe and Attachment D for tomatoes.
-
Pre-sample preparation.
Do not rinse the produce, even if there is visible dirt. Examine the produce "as is".
-
Sub-sample soak preparation:
For basil and cilantro:
Combine 75 g from each of 5 individual sub-samples into a sterile flask (375 g composite), or other appropriate container. Add 3375 ml tryptic soy broth and swirl, so that all of the produce is fully wetted. Loosely cap the flask. Let stand for 60 ± 5 min. Adjust pH to 6.8 ± 0.2, if necessary. Allow the samples to remain in the pre-enrichment broth during incubation.
For green onions, loose-leaf lettuce, parsley, snow peas, and spinach:
Combine 75 g from each of 5 individual sub-samples into a sterile flask (375 g composite), or other appropriate container. Add 3375 ml lactose broth and swirl, so that all of the produce is fully wetted. Loosely cap the flask. Let stand for 60 ± 5 min. Adjust pH to 6.8 ± 0.2, if necessary. Allow the samples to remain in the pre-enrichment broth during incubation.
-
Sample preparation/method: Incubate composite at 35 C for 24 ± 2 h.
After pre-enrichment, produce are to be selectively enriched as described below. The selective enrichment strategy is dependent on whether the culture method or a rapid method is to be used. Only rapid methods, for Salmonella, listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology" dated April 24, 1998, may be used. If the laboratory does not have a copy of the memo, they should request a copy from the Division of Field Science, HFC-140.
For the Salmonella culture method (BAM, method 995.20) and rapid method 996.08, use Rappaport-Vassiliadis (RV) medium and tetrathionate (TET) broth. For the rapid methods 989.14, 990.13, 992.11, or 993.08 use selenite cystine (SC) and TET broths.
For the Salmonella culture method, transfer 0.1 ml mixture to 10 ml RV medium and 1 ml mixture to 10 ml TET. Vortex. Treat all of the above produce as high microbial load foods. Incubate RV medium for 24 ± 2 h at 42 ± 0.2° C and incubate TET broth 24 ± 2 h at 43 ± 0.2° C. Incubate both RV and TET in air incubator. After incubation, follow the BAM Online, Salmonella, Chapter 5, section D, Isolation of Salmonella.
For rapid method kits, selectively enrich as instructed by the kit manufacturer.
None of the rapid method test kits listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology", dated April 24, 1998, have been validated for the analysis of all of the different kinds of produce found in this assignment. Thus, should the analyst decide to use a rapid method which has not been validated for a particular kind of produce, it will be necessary to do a comparative seeding study.
If a sample is a presumptive-positive based on the test kit, then perform confirmation analysis as described in the BAM Online, above.
Attachment C
Import Produce Assignment FY 2005 DFP # 05-16
Soak Method for Salmonella analysis in Cantaloupe
| Note: | This sample preparation is only to be used for the detection of Salmonella in Cantaloupe; when other organisms are being analyzed for, follow the soak method as stated in Attachment B. |
-
Pre-sample preparation
Do not rinse the cantaloupes, even if there is visible dirt. Examine the cantaloupe "as is".
-
Sub-sample soak preparation
For each individual sub sample (e.g., one cantaloupe), place contents into a sterile plastic bag (Biopro Sample Bag, 12 x 18 inches, catalog number BP-41218, available from International Bioproducts, phone 800-729-7611). Add a volume of lactose broth that is needed to allow the cantaloupe to float. Normally this volume of lactose broth is 1.5 times the weight of the cantaloupe. For instance, a cantaloupe weighing 1200 g will need a volume of 1800 ml lactose broth. Place the plastic bag, with cantaloupe and lactose broth, into a non-sterile 5 liter beaker for support during incubation. Allow the open-end flap of the plastic bag to "fold over" so as to form a secure, but not airtight, closure during incubation.
-
Sample preparation/method
Incubate each, individual cantaloupe sub sample at 35 C for 24 plus or minus 2 hours.
After incubation, manually mix the contents of the bags containing the cantaloupes and the pre-enrichments. The sub sample pre-enrichments are then to be "wet composited". From each of 5 incubated sub samples, remove 0.1 ml lactose broth pre-enrichment and place into a tube or flask containing 50 ml Rappaport-Vassiliadis (RV) medium. For the other 5 incubated sub samples, remove 0.1 ml lactose broth and place into a tube or flask containing 50 ml RV medium. Incubate the 2 RV medium composites at 42 plus or minus 0.2 C in a circulating, thermostatically controlled water bath for 24 h.
In addition to subculturing the sub sample pre-enrichments to RV medium, these sub sample pre-enrichments are to be sub-cultured to tetrathionate (TET) broth. From each of 5 incubated sub samples, remove 1.0 ml lactose broth pre-enrichment and place into a tube containing 50 ml TET broth. For the other 5 incubated sub samples, remove 1.0 ml lactose broth and place into a tube containing 50 ml TET broth. Incubate the 2 TET broth composites at 35 C for 24 hours.
After incubation of the RV and TET composites, continue as directed in BAM Online, Chapter 5.
Note: Only the VIDAS Salmonella (SLM) Assay (Method 996.08 has been validated for use with cantaloupes.
None of the rapid method test kits listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology", dated April 24, 1998, have been validated for the analysis of cantaloupe. Thus, should the analyst decide to use rapid methods other than the VIDAS Salmonella SLM Assay, it will be necessary to do a comparative seeding study as described in the guidance memo of April 24, 1998 and in ORA-LAB1.
If a sample is a presumptive positive based on the test kit, then perform confirmation analysis as described in the BAM Online, above. It should be noted that the use of this soak method does not allow a most probable number determination of Salmonella for those samples that are qualitatively positive for this pathogen.
Please note that this procedure involves wet compositing of incubated sample pre-enrichments as opposed to dry compositing as described in the BAM. Validation data to support the use of wet compositing may be found in the following references:
- Price, W. R., R. A. Olsen, and J. E. Hunter. 1972. Salmonella testing of pooled pre-enrichment broth cultures for screening multiple food samples. Applied Microbiology. 23:679-682.
- Silliker, J. H. and D. A. Gabis. 1973. ICMSF methods studies. I. Comparison of analytical schemes for detection of Salmonella in dried foods. Can. J. Microbiology. 19:475-479.
Attachment D
Import Produce Assignment FY 2005 DFP # 05-16
Soak Method for Salmonella analysis in Tomatoes
| Note: | This sample preparation is only to be used for the detection of Salmonella in tomatoes; when other organisms are being analyzed for, follow the soak method as stated in Attachment B. |
- Pre-sample preparation: Do not rinse the tomatoes, even if there is visible dirt. Examine the tomatoes "as is".
- Sub-sample soak preparation: For each individual sub-sample (e.g., approximately 454 g tomatoes), place contents into a sterile plastic bag (Biopro Sample Bag, 12 x 18 inches, catalog number BP-41218, available from International Bioproducts, phone 800-729-7611). Add enough lactose broth to allow the tomatoes to float. This volume of lactose broth may be 1.5 times the weight of the tomatoes. For instance, tomatoes weighing 454 g will probably need a volume of approximately 675 ml lactose broth to float. Add more lactose broth, if necessary. Place the plastic bag, with tomatoes and lactose broth, into a non-sterile 5 liter beaker, or other appropriate container, for support during incubation. Allow the open-end flap of the plastic bag to "fold over" so as to form a secure, but not air-tight, closure during incubation.
-
Sample preparation/method: Incubate each, individual tomato sub-sample at 35°C for 24 ± 2 h.
After pre-enrichment, tomato sub-samples are to be selectively enriched as described below. The selective enrichment strategy is dependent on whether the culture method or a rapid method is to be used. Only rapid methods, for Salmonella, listed in the memo entitled, }"Guidance for the Use of Rapid Methods for Food Microbiology dated" April 24, 1998, may be used. If the laboratory does not have a copy of the memo, they should request a copy from the Division of Field Science, HFC-140.
For the Salmonella culture method (method 2000.06), use Rappaport-Vassiliadis (RV) medium and tetrathionate (TET) broth. For the rapid methods 989.14, 990.13, 992.11, 993.08, or 996.08 use selenite cystine (SC) and TET broths. Please note that method 996.08 (Vidas SLM method) may be changed in the near future: SC broth may be replaced with RV medium. In the event that RV medium is approved for use, with method 996.08, use TET and RV medium for this method.
After incubation, manually mix the contents of the bags containing the tomatoes and the pre-enrichments. The sub-sample pre-enrichments are then to be "wet composited". From each of 5 incubated sub-samples, remove 1.0 ml lactose broth pre-enrichment and place into a tube or flask containing 50 ml TET broth. For the other 5 incubated sub-samples, remove 1.0 ml lactose broth from each sub-sample and place into a tube or flask containing 50 ml TET broth. Incubate the 2 TET broth composites at 35°C for 24 h.
In addition to sub-culturing the sub-sample pre-enrichments to TET broth, for the rapid methods listed above, these sub-sample pre-enrichments are to be sub-cultured to SC broth. From each of 5 incubated sub-samples, remove 1.0 ml lactose broth pre-enrichment and place into a tube containing 50 ml SC broth. For the other 5 incubated sub-samples, remove 1.0 ml lactose broth from each sub-sample and place into a tube containing 50 ml SC broth. Incubate the 2 SC broth composites at 35°C for 24 h.
In addition to sub-culturing the sub-sample pre-enrichments to TET broths, for the culture method and possibly for method 996.08, these sub-sample pre-enrichments are to be sub-cultured to RV medium. From each of 5 incubated sub-samples, remove 0.1 ml lactose broth pre-enrichment and place into a tube containing 50 ml RV medium. For the other 5 incubated sub-samples, remove 0.1 ml lactose broth from each sub-sample and place into a tube containing 50 ml RV medium. Incubate the 2 RV medium composites at 42 ± 0.2°C in a circulating, thermostatically-controlled water bath for 24 h.
After incubation of the RV and TET composites, continue as directed in the BAM Online.
Please note that none of the rapid method test kits listed in the memo entitled, "Guidance for the Use of Rapid Methods for Food Microbiology", dated April 24, 1998, have been validated for the analysis of tomatoes. Thus, should the analyst use one of these rapid methods, then it will be necessary to do a comparative seeding study as described in the guidance memo of April 24, 1998 and in ORA-LAB1.
If a sample is a presumptive positive based on the test kit, then perform confirmation analysis as described in the BAM Online. It should be noted that the use of this soak method does not allow a most probable number determination of Salmonella for those samples that are qualitatively positive for this pathogen.
This procedure involves wet compositing of incubated sample pre-enrichments as opposed to dry compositing as described in the BAM.
For positive samples refer to Salmonella Isolates on page 8 of the Assignment.
Attachment E
Import Produce Assignment FY 2005 DFP # 05-16
Protocol for the Detection of Viruses in Produce
The following protocol was developed for the detection of foodborne viruses in produce such as scallion, and is probably applicable to other produce material such as cilantro or loose-leaf lettuce.
Materials required:
| 10X Tris-Glycine buffer | Sigma | T-4904 |
| Polyethylene Glycol (PEG, Average Mol. Wt. 8000) | Sigma | 81268 |
| Ribonucleic acid (Transfer) (10mg/ml) | Sigma | R8508 |
| Tri Reagent | MRC | TR118 |
| RNase/DNase free water | Any | |
| AMV reverse transcriptase | Promega | M9004 |
| 10X reverse transcriptase buffer | Promega | A3561 |
| Magnesium Chloride 25mM | Promega | A3511 |
| PCR nucleotide mix (10mM) | Promega | C1141 |
| Taq DNA polymerase in storage buffer B Oligonucleotide primers (see note 1). |
Promega | M1661 |
Procedure:
- Chop 50g or fewer scallions (leaf, stalk and bulb) into 2cm long pieces with a sterile razor blade and transfer the contents to a sealable plastic bag. Prepare as many samples as you want or can handle at a time. Add 50ml of 1X Tris-glycine buffer (diluted from 10X stock buffer with RNase/Dnase free water) to each bag. Close the bag securely. If a positive control is needed, add 20-200 pfu of virus to a sample prior to the addition of 1X buffer.
- Place the bags on a tilting platform and rock at maximum speed for 20 min. Decant the liquid to a sterile 50 ml centrifuge tube (we recommend Corning 25330). Discard the solid plant material.
- Centrifuge the tubes at 9000Xg (approximately 7500 rpm in a Sorvall GSA rotor with Delrin adapters) for 30 min at 4° C.
- Decant the liquid into a fresh tube, avoiding any pelleted material.
- To 10 to 20ml of the clarified extract, add BSA (fatty acid free, Promega W384A) from a 10mg/ml stock solution (50µl for every ml of extract), and sodium chloride from a 5M stock solution (87µl for every ml of extract, Ambion 9760G). Mix well by inversion. Calculate the total volume of the extract. To each extract, add equal volume of a 17% stock solution of PEG (prepared in nuclease free water and stored at 4° C). Mix thoroughly by inversion and incubate overnight at 4° C.
- Centrifuge at 9000Xg for 30 min at 4° C. Completely drain the liquid from each tube. Dissolve the pellet thoroughly in 0.75ml Tri Reagent containing 100mM beta-mercaptoethanol. Make sure to dissolve the material adhering to the side of the tube using a 1 ml Eppendorf type pipetor. Transfer the material to a 1.5 ml nuclease free eppendorf tube. Leave all the samples at room temperature for 5min.
- Add 0.2 ml Chloroform to each tube. If you have multiple samples, add chloroform to all tubes close the caps tightly, place them together in a small rack, and shake vigorously by hand for 1min. Let stand at room temperature for 5min, then centrifuge for 10 min at 4° C in a microfuge at top speed.(14,000 rpm).
- Remove the upper clear colorless phase to a fresh tube. Add 40µl 3M sodium acetate (Sigma S7899), mix by vortexing, Add 1µl (10µg) tRNA to each sample, mix, and add an equal volume of isopropanol. Mix well, and incubate in a -20° C freezer for 2 hours..
- Centrifuge at 14000 rpm at 4° C for 20min. Drain thoroughly, add 800µl 70% ethanol, and centrifuge again as above. Discard the supernatant, and drain inverted on paper towel until completely dry (do not use SpeedVac or similar equipment to dry the tubes).
- Dissolve the RNA in 90µl water by vortexing to cover the entire inner bottom surface of the tube. Add 10µl of 3M sodium acetate, and 250 µl 100% ethanol. Mix and incubate at -20° C for 2h to overnight.
- Centrifuge 14000 rpm at 4° C for 20min. Discard the supernatant. Add 0.8ml of 70% ethanol to each tube and centrifuge as above. Discard supernatant, and dry the tubes inverted on paper towel. Do not use SpeedVac. Dissolve the RNA in 20µl nuclease free water, by flicking and vortexing to cover the inner surface of the bottom part of the tube. Centrifuge briefly to collect the liquid at the bottom.
- For reverse transcription mix in a 0.5ml eppendorf tube up to 9.6µl of the RNA sample and 1µl (50 to 100 ng) reverse transcription (RT ) primer such as random hexamers available from any supplier. Alternatively, 0.5 to 1 µg Oligo dT15 can be used. Heat the mixture at 70° for 5min in a thermal cycler and chill on ice. Centrifuge briefly.
Add 9.4µl of the following reaction mixture: !0X reverse transcription buffer (Promega) 2µl 100mM DTT 2µl 10mM deoxynucleotide mix 1µl 25mM MgCl2 2.4 µl RNasin RNase inhibitor 20 -40 units perµl 1µl AMV reverse transcriptase 20u/µl 1µl All the above reagents are from Promega Heat the reactions in a thermal cycler at 22° for 10min followed by 42° for 90 min, and 95° for 5min. Chill immediately on ice and centrifuge at 14,000 rpm for 5 min. Proceed immediately to PCR or freeze at -20°. - Perform PCR with up to 10µl of the sample according to the protocol below. Rest of the samples may be stored frozen at -20° C.
- PCR protocol
Buffer 50 mM Tris-HCl, pH ; 75 mM KCl dNTPs 200 µM each MgCl2 3 mM Primers 50 pmol of forward and reverse primers Template 5-10 µl of reverse transcription reaction Taq polymerase 0.5 Units (Promega) Total volume 50 µl
Note 1: Primers BG 7 (5'-CCGAAACTGGTTTCAGCTGAGG-3')
BG 8 (5'-CCTCTGGGTCTCCTTGTACAGC-3')The expected size of an amplicon generated with BG7/BG8 is 276 bp. This is considered a presumptive positive result.
PCR products should be sent under refrigeration temperature to the attention of Yuan Hu, NRL, to perform DNA sequencing. An e-mail should also be sent to Yuan to alert him of the sample:
Yuan Hu, Microbiologist
FDA - Northeast Regional Laboratory
158 - 15 Liberty Avenue
Jamaica, New York 11433-1034Developed by Biswendu B. Goswami, PhD, Division of Molecular Biology, OARSA
Attachment F
Import Produce Assignment FY 2005 DFP # 05-16
Detection of Cyclospora from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR)
This protocol is derived from Chapter 19A, Revised Version of the BAM chapter entitled "Detection of Cyclospora and Cryptosporidium from Fresh Produce: Isolation and Identification by Polymerase Chain Reaction (PCR) and Microscopic analysis."
Palmer A. Orlandi, Christian Frazar, Laurenda Carter, and Dan-My T. Chu
- Materials and Equipment
- BagPage®+ filter bags (400 ml) and Bag Clips (Interscience, St Nom, France)
- Envirochek™ sampling capsule, 1 µ m nominal (Pall Gelman Laboratory)
- Rocker platform
- Rotary shaker
- Rotating wheel
- 150 ml analytical filter units (Nalgene, Cat No. 130-4045)
- 25 mm disposable filter funnels (Whatman Biosciences)
- Dynal L10 tubes Prod. No. 740-03)
- Dynal MPC®-1 (Prod. No 120.01)
- Dynal MPC®-S (Prod. No 120.20)
- Vacuum manifold (Vac-Man® Laboratory Vacuum Manifold 20-sample capacity; Promega)
- FTA Filters, Classic Card of 960circle pre-printed card formats (Whatman Biosciences)
- Photo laminating sheets (Scotch®)
- Conical 250 ml centrifuge tubes
- Sorvall RT7 Plus refrigerated centrifuge or equivalent (to centrifuge 250 ml conical centrifuge tubes)
- Blotting paper
- Heating block for incubation at 56° C
- Single punch (6 mm diameter) hole puncher
- Thin-walled 0.65 ml PCR tube (PGC)
- ART pipette tips (Molecular BioProducts)
- PTC-200 DNA Engine (MJ Research) or comparable thermal cycler.
- Horizontal gel electrophoresis apparatus and power supply.
- Polaroid camera or digital imaging system to capture ethidium bromide-stained gels
- Polaroid Type 667 film
- UV Transilluminator
- Reagents
- Water
- Deionized water (for washing produce [dH2O])
- Sterile deionized water (for PCR procedure)
- Envirochek™ elution buffer (0.01M Tris, pH 7.4 ; 0.001 M EDTA; 1% SDS)
- Silicone vacuum grease
- Albumin, bovine (BSA) (Sigma, A-7030)
- Celite (Sigma, C-8656)
- Polyvinyl polypyrrolidone (PVPP) (Sigma, P-6755)
- NET buffer: 0.1 M Tris, pH 8.0, 0.15M NaCl, 0.001M EDTA
- NET-BSA buffer-NET buffer containing 1% (w/v) BSA
- 20% celite in NET-BSA buffer (w/v)
- 10% PVPP (w/v) in dH2O
- 0.1 N HCl
- 0.1 N NaOH
- Immersion oil
- Clear fingernail polish, slide compound, paraffin wax or equivalent
- FTA Purification Buffer (Whatman Biosciences)
- FTA filter wash buffer: 0.01 M Tris, Ph 8.0; 0.1 mM EDTA
- DNA Primers-See Table 1 in PCR Section
- HotStartTaq™ Master Mix Kit (Qiagen)
- 0.5x Tris-acetate-EDTA buffer (0.5x TAE)
- Molecular biology-grade agarose (BioRad)
- Ethidium bromide
- 6x gel loading solution
- 100 bp and 25 bp DNA ladders (Invitrogen)
- Vsp I restriction endonuclease (Promega)
- Dra II restriction endonuclease (Hoffman-La Roche)
- NuSieve® 3:1 agarose (Biowhitaker Molecular Applications)
- Water
- Wash Procedure for Fresh Produce
- Place produce to be analyzed (10 g of basil or 100 g composite of snow peas) in a BagPage®+ filter bag, add 100 ml dH2O and seal with Bag Clip.
- Place on rocker platform and gently agitate for 30 minutes at room temperature, inverting the bag after 15 minutes.
- Decant supernatant from the BagPage®+ filter bag into clean 50 ml conical centrifuge tubes and centrifuge for 20 minutes at 2,000 x g.
- Isolation of Cyclospora from Fresh Produce Washes
- Aspirate supernatants (without disturbing debris pellets) to a volume not to exceed 45 ml when combined.
- Suspend pellets in remaining supernatants and combine.
- Add 2.5 ml 20% (w/v) celite in NET-BSA suspension (ensure that celite is thoroughly suspended prior to its addition to sample washes). Mix samples on a rotating wheel at room temperature for 15 minutes.
- Add 1.0 ml of 10% PVPP suspension (w/v). Mix samples on a rotating wheel at room temperature for 15 minutes.
- Prepare a 150 ml analytical filter unit by removing the membrane filter (0.45 µm or 0.2 µm) but retaining the grade 4 filter backing. Attach to a vacuum source.
- Pre-wet the analytical filter with a small volume (~10ml) of NET buffer.
- Decant celite/PVPP-containing sample wash into a prepared 150 ml analytical filter unit and vacuum filter. Ensure that the liquid passes through the filter septum to remove particulates and the celite particles from the suspension as it is filtered. The adsorbent celite should prevent filter clogging.
- Rinse the container with 10 ml NET to recover as much of the residual celite-containing sample and decant into the filter unit. Then rinse the celite and particulate material trap onto the filter with an additional 10 ml volume of NET.
- Prior to FTA filtration in step 4l, save ~10% of the filtered sample for microscopic examination.
- Prepare filter funnel unit(s) containing FTA filter disk as described in Figure 1 and attach to vacuum manifold.
- Under vacuum, pre-wet the FTA filter assembly.
- Slowly decant filtrate from step 4i into filter funnel unit while under vacuum until entire sample has passed through FTA filter.
- In succession while filter funnel unit is still attached to vacuum manifold, rinse filter twice with 10 ml of FTA purification buffer and twice with 10 ml of FTA filter wash buffer.
- Remove filter funnel unit from vacuum manifold, disassemble unit and dry FTA filter disk on 56° C heating block.
- Isolation of Cyclospora from Fresh Produce Washes
-
PCR Analysis
The molecular detection of Cyclospora spp is independently accomplished using nested PCR protocols. The differential identification of Cyclospora cayetanensis from other closely related non-human pathogenic parasites (i.e. Eimeria spp) employs a nested multiplex PCR assay. This assay can be accomplished using a conventional thermal cycler with heated lid.
- DNA Primers
Table 1: DNA Primer Sequences for Cyclospora-specific PCR Amplification† Primer Designation Primer Specificity Primer Sequence
(5'-3')Amplicon Size (bp) Designated Application F1E (forward) Cyclospora and Eimeria spp. TACCCAATGAAAACAGTTT 636 Primary Amplification R2B (reverse) CAGGAGAAGCCAAGGTAGG CC719 (forward) C. cayetanensis GTAGCCTTCCGCGCTTCG 298 Nested Amplification PLDC661
(forward)C. cercopitheci, C. colobi,
C. papionisCTGTCGTGGTCATCGTCCGC 361 Nested Amplification ESSP841
(forward)Eimeria spp GTTCTATTTTGTTGGTTTCTAGGACCA 174 Nested Amplification CRP999 (reverse) Cyclospora and Eimeria spp CGTCTTCAAACCCCCTACTGTCG Nested Amplification †All primer sequences were derived from the published sequences for the 18S rRNA genes of the respective organisms.
- General Sample Preparations for Primary PCR Amplifications
- Punch marked triplicate areas (6 mm diameter) from dried FTA filter disk using a single punch hole puncher
- Insert filter punches snuggly into bottom of 0.65 ml thin-walled PCR tubes.
- Dispense 50 µl HotStartTaq™ Master Mix into each PCR tube.
- Prepare reagent master mix (see Table 2) with the appropriate forward and reverse DNA primers (see Table 1) and dispense into each PCR tube.
- All PCR analyses must include positive and negative controls (see Table 3).
- Mix tubes with gentle tapping.
- Follow the appropriate thermal cycling protocol (Table 4) for primary PCR amplification.
Table 2: General PCR Conditions for Primary PCR Amplification Component Volume (µl)* Final Concentration FTA Filter Disk (DNA Template) HotStartTaq™ Master Mix 50.0 † Reagent Master Mix MgCl2, 25 mM 2.0 2.0‡ Forward Primer, 10 µM 2.0 0.2 µ M Reverse Primer, 10 µM 2.0 0.2 µ M Sterile deionized water 44.00 *100 µl total volume
†Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200 µ M of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
‡ Final MgCl2 concentration is that contributed by both the HotStartTaq ™ Master Mix and 25 mM MgCl2stock
Table 3: Controls for PCR amplifications Control Type Condition/Organism Negative Control-1 Reagent blank-no filter Negative Control-2 Reagent blank + unspotted, washed filter †Positive Controls:
Cyclospora Analysis:C. cayetanensis ‡¶Cyclospora spp (NHP) *Eimeria spp †Whenever possible, positive control FTA filters should be spotted with at least 103 organisms
‡Non-human primate-derived Cyclospora spp.
¶Not routinely available.
*Most available Eimeria spp are suitable.
Table 4: PCR Thermal Cycling Parameters for Cyclospora and Eimeriaspp. Step Number of Cycles Temperature and Time Primary PCR Initial Activation 1 95° C; 15 min Amplification 35 Denaturation: 94° C; 30 sec Annealing: 53° C; 30 sec Extension: 72° C; 90 sec Final Extension 1 72° C; 10 min Nested Multiplex PCR Initial Activation 1 95° C; 15 min Amplification 25 Denaturation: 94° C; 15 sec Annealing: 66° C; 15 sec - Conventional Nested Multiplex PCR Amplification for the Differential Identification of Cyclospora and Eimeria spp.
- Dispense 25 µl of HotStartTaq™ Master Mix into each PCR tube.
- Prepare reagent master mix (Table 5) and dispense into all tubes
- Complete reaction samples with the addition of the desired volume (1-3 µl) of primary amplicon solution.
- Be sure to include all positive and negative controls as in the primary amplification reactions.
- Mix tubes with gentle tapping.
- Follow the appropriate thermal cycling protocol listed in Table 4.
Table 5: Assay Conditions for the Conventional Nested Multiplex PCR Amplification of Cyclospora and Eimeria spp Component Volume (µl)* Final Concentration HotStartTaq™ Master Mix 25.0 † MgCl2, 25 mM 1.0 2.0 mM‡ CC719 (forward primer), 10 µ M 1.0 0.2 µ M PDCL661 (forward primer), 10 µ M 1.0 0.2 µ M ESSP841 (forward primer), 10 µ M 1.0 0.2 µ M CRP999 (reverse primer), 10 µ M 1.0 0.2 µ M Sterile deionized water 19.00 DNA Template (primary amplicon) 1.0 *50 µl total volume
†Final concentrations for components in the HotStartTaq™ Master Mix are as follows: 200 µ M of each dNTP, 1.5 mM MgCl2 and 2.5 U HotStarTaq™ DNA Polymerase
‡Final MgCl2 concentration is that contributed by both the HotStartTaq™ Master Mix and 25 mM MgCl2 stock.
- Following instruction for agarose gel electrophoresis (Section D, steps b-f)
- Agarose Gel Electrophoresis
- Mix 10 µl of nested amplification product with 2 -3 µl of gel loading solution.
- Load samples into wells of a 1.5% agarose gel prepared with 0.5 x TAE containing 0.2 µg/ml ethidium bromide. Include at least one lane containing 100 bp DNA ladder to approximate the size of any amplicon present.
- Run the gel at 125 volts (constant voltage) for at least 30 min.
- PCR products on the agarose gel can be visualized by using a UV transilluminator. Photograph the gel to have a permanent record of the results using a Polaroid Type 667 film (or a digital system, if you decide to include that in the material & methods).
- The primary amplicon from primer pair F1E/R2B for Cyclospora PCR may not be visible; therefore, only product from the nested reaction should be electrophoresed.
- Predicted sizes of PCR amplicons from Cyclospora spp, and Eimeria spp are listed in Table 1.
- DNA Primers
- FDA Survey of Domestic Fresh Produce Domestic Produce Assignment (DFP # 05-20) - HIGH Priority ORA Concurrence # 2005052501 - Amendment to 6/10/05 Assignment August 3, 2005
- FDA Survey of Domestic Fresh Produce FY 2000/2001 Field Assignment January 2003
- FDA Survey of Imported Fresh Produce Imported Produce Assignment FY 2001 - HIGH Priority DOEP # 01-07 January 18, 2001
- FDA Survey of Imported Fresh Produce FY 1999 Field Assignment January 30, 2001
- FDA Survey of Domestic Fresh Produce Domestic Produce Sampling Assignment - FY 00/01 DOEP # 00 - 16 May 10, 2000
- FDA Survey of Imported Fresh Produce REVISED Imported Produce Assignment - FY 99 DOEP # 99-4 November 1, 1999

